Characterisation of early changes in ovine CLN5 and CLN6 Batten disease neural cultures for the rapid screening of therapeutics

Accepted Manuscript Characterisation of early changes in ovine CLN5 and CLN6 Batten disease neural cultures for the rapid screening of therapeutics

Hannah L Best, Nicole J Neverman, Hollie E Wicky, Nadia L Mitchell, Beulah Leitch, Stephanie M Hughes PII: DOI: Reference:

S0969-9961(17)30001-3 doi: 10.1016/j.nbd.2017.01.001 YNBDI 3894

To appear in:

Neurobiology of Disease

Received date: Revised date: Accepted date:

29 August 2016 19 December 2016 1 January 2017

Please cite this article as: Hannah L Best, Nicole J Neverman, Hollie E Wicky, Nadia L Mitchell, Beulah Leitch, Stephanie M Hughes , Characterisation of early changes in ovine CLN5 and CLN6 Batten disease neural cultures for the rapid screening of therapeutics. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Ynbdi(2017), doi: 10.1016/j.nbd.2017.01.001

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Characterisation of early changes in ovine CLN5 and CLN6 Batten disease neural cultures for the rapid screening of therapeutics Hannah L Best1,4, Nicole J Neverman1,4, Hollie E Wicky1,4, Nadia L Mitchell3,4, Beulah Leitch2, Stephanie M Hughes1,4 Department of Biochemistry and 2 Anatomy, School of Biomedical Sciences, Brain Health Research Centre, University of Otago, Dunedin, New Zealand. 3 Faculty of Agriculture and Life Sciences, Lincoln University, Canterbury, New Zealand. 4 Batten Animal Research Network (BARN), New Zealand.

CR

IP

T

1

Corresponding Author:

M

AN

US

Dr. Stephanie Hughes Department of Biochemistry University of Otago P.O Box 56 Dunedin 9054 New Zealand

Email: [email protected]

AC

CE

PT

ED

Telephone: +64 3 479 3761

ACCEPTED MANUSCRIPT

Abstract Batten disease (neuronal ceroid lipofuscinosis) refers to a group of neurodegenerative lysosomal storage diseases predominantly affecting children. There are currently no effective treatments,

IP

T

and the functions of many of the associated gene products are unknown. Here we characterise

CR

fetal neural cultures from two genetically distinct sheep forms of Batten disease, with mutations in the lysosomal protein encoding gene CLN5 and endoplasmic reticulum membrane protein

US

encoding gene CLN6, respectively. We found similar reductions in autophagy, acidic organelles and synaptic recycling in both forms compared to unaffected cells. We then developed a high-

AN

throughput screen and tested for correction of deficient cells with lentiviral-mediated CLN5 or

M

CLN6 gene transfer and fibrate drugs, gemfibrozil and fenofibrate in CLN6 deficient neural cultures. These assays provide a simple system to rapidly screen candidate therapies or libraries

CE

Keywords:

PT

ED

of drugs prior to in vivo testing.

AC

Batten disease Neuronal ceroid lipofuscinosis CLN5 CLN6 Neuronal cell culture Gene therapy Autophagy

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT Introduction The neuronal ceroid lipofuscinoses (NCLs, Batten disease) are a group of severe autosomal recessive and incurable lysosomal storage disorders (LSD) (Rider and Rider, 1988). Hallmarks of the NCLs are progressive neurodegeneration and the accumulation of lysosomallyderived fluorescent storage bodies (Zeman, 1969), containing large amounts of subunit c of ATP

T

synthase (Palmer et al., 1989). Combined, the NCLs have an incidence of approximately 1 in

IP

12,500 live births, affecting males and females equally (Rider and Rider, 1988). There are at least 13 genetically distinct forms of NCL with congenital, childhood, and adult variants, each

CR

differing in terms of clinical progression and age of onset (Mole and Cotman, 2015). Symptoms include blindness, seizures, personality and behavioural changes, dementia, regression in

US

communication and motor skills, and premature death (Lake and Cavanagh, 1978). Currently the only treatments are palliative, although results of gene therapy and enzyme replacement trials are

AN

encouraging (Katz et al., 2015; Worgall et al., 2008).

Mutations in CLN5 and CLN6 predominantly cause variant late-infantile NCL. Both

M

proteins are highly conserved across mammalian species. CLN5 is a soluble lysosomal protein (Isosomppi et al., 2002) with suggested roles encompassing neuronal maintenance, neurogenesis,

ED

autophagy and synaptic endocytosis (Mamo et al., 2012; von Schantz et al., 2008). CLN6 encodes an ER membrane protein (Kousi et al., 2012); suggested functions include endocytosis of

PT

lysosomal proteins and selective transport of lipids and proteins essential for the function and acidification of the lysosome (Heine et al., 2004; Heine et al., 2007; Holopainen et al., 2001a).

CE

Naturally occurring NCL disease-causing mutations have been identified in several animals including mice, sheep, cows, dogs and pigs (Bond et al., 2013). In New Zealand, there

AC

are two well-established sheep flocks; South Hampshire (Jolly and West, 1976) and Borderdale (Jolly et al., 2002), with naturally occurring mutations in CLN6 and CLN5 respectively (Frugier et al., 2008; Tammen et al., 2006). Sheep CLN5 and CLN6 share 90% and 92% amino acid identities with the respective human homologues. Currently both flocks are part of gene therapy trials (Neverman et al., 2015; Palmer et al., 2015). Prior to the start of gene therapy trials, ovine neural cultures proved invaluable for testing lentiviral transduction and tropism in sheep neurons (Linterman et al., 2011). Isolated NCL neural cultures have also been used to demonstrate the time-dependent accumulation of fluorescent lysosomal storage bodies (Hughes et al., 2014), including subunit c of ATP synthase, the selective loss of GABAergic neurons (Oswald et al.,

ACCEPTED MANUSCRIPT 2001), and mitochondrial, lysosomal and autophagic dysfunction (Cao et al., 2011; Thelen et al., 2012). The aims of this study were to characterise ovine neural cultures further and to develop a pharmaceutical screening system for use prior to in vivo testing. To achieve this we used markers to probe the autosomal-lysosomal pathway (ALP) and endosomal-lysosomal pathway (ELP), both shown in previous studies to be altered in Batten disease (Cotman et al., 2002). We

T

identified reduced autophagy, acidic organelles and bulk synaptic endocytosis. This three-tiered

IP

assay system was then used to evaluate the potential of two therapeutic approaches: wild-type

CR

(wt) CLN-containing lentivirus (LVMNDwtCLN) and small molecule fibrate drugs, both of which have shown success in other models of Batten disease (Hong et al., 2015; Neverman et al.,

AC

CE

PT

ED

M

AN

US

2015).

ACCEPTED MANUSCRIPT Methods Cell culture Heterozygous control (CLN+/-; referred to hereafter as ‘Control’) and affected (CLN-/) ovine fetal brains were harvested at mid-gestation, between 65 to 70 days, prepared as single cell suspensions and stored in liquid nitrogen for future use, as described previously (Hughes et al.,

IP

T

2014). Both plates and coverslips were pre-treated with 15 µg/ml poly-L lysine for 24 h, followed by 10% fetal bovine serum (FBS; Life Technologies, HYCSH30406.02) in DMEM.

CR

Cells were thawed rapidly from liquid nitrogen stocks in a 37 °C water bath. Cell clumps were removed using a BD FalconTM 40 μm nylon cell strainer and single cells pelleted by

US

centrifugation, 1,000 rpm, 5 min. The pellet was suspended in DMEM/F12 1:1 neural media (1% L-glutamine, 1% penicillin-streptomycin, 10% FBS and 4 mM KCl; Life Technologies NZ,

AN

11966025, 11765054, 2503008, and 1514012 respectively). Cells were plated at 1 x 105 cells per well of a 24 well plate, or 30,000 cells per well of a 96 well plate, in neural media. B27 growth

M

supplement (Life Technologies NZ, 17504044) was added to each well at a final concentration of 2%. After plating, half the media was replaced every 3 days. All experiments were carried out

ED

with between 3 and 10 animals of each genotype, with technical replicates for each neural preparation. The animals per genotype used for each experiment is stated as ‘n =’ in the

PT

appropriate figure legends.

CE

Detection of acidic organelles Cultures were treated with LysoTracker Red DND-99 (Life Technologies NZ, L7528) to

AC

quantify acidic organelles. A final concentration of 50 nM LysoTracker Red, with 1 µg/mL Hoechst 33342 nuclear stain (Life Technologies NZ, 62249), was added to each well. As a control for pH changes, acidification of the ALP was inhibited using lysosomotropic ammonium chloride (NH4Cl, final concentration 20 mM) (Misinzo et al., 2008). After 30 min the LysoTracker Red solution was removed, cells rinsed in Dulbecco's phosphate-buffered saline pH 7.4 (dPBS), and fixed with 4% paraformaldehyde (PFA) in dPBS for 10 min. Acidic organelles were imaged immediately as described below and quantified for average red fluorescent intensity per cell in relative fluorescent units (RFU).

ACCEPTED MANUSCRIPT Detection of autophagy Autophagy was monitored using an Enzo Life Sciences Cyto-ID Autophagy Detection Kit (Enzo, ENZ-51031-K200) as per manufacturer’s instructions. This assay utilises a 488 nmexcitable detection reagent that emits fluorescence when incorporated into autophagic compartments. For detection, cell culture media was removed from all wells and cells washed

T

with 1x assay buffer containing 5% FBS, 100 µL of Microscopy Dual Detection Reagent was

IP

added to each well and the plate returned to the incubator for 45 min, as per the manufacturer

CR

instructions. The 1x assay buffer wash was repeated twice and cells fixed at room temperature with 4% PFA for 10 min. Cells were imaged as described below and quantified by average green

US

fluorescent intensity per cell (RFU). Endocytosis of tetramethylrhodamine dextrans

AN

Fluorescently labelled 40 kDa tetramethylrhodamine dextrans (Life Technologies NZ, D1842) were used to study endocytosis at synapses. Ninety minutes prior to the addition of

M

dextran, gabazine was added to the plate at a final concentration of 5 µM (Abacus-ALS, SR95531) to antagonise GABAA receptors, and therefore indirectly over-simulate excitatory

ED

synapses and induce dextran uptake. Cultures were then treated with 5 µM dextran and 1 µg/ mL Hoechst 33342 nuclear stain. After 30 min, cells were washed thoroughly with dPBS to remove

PT

non-endocytosed dextran. Cells were fixed at room temperature with 4% PFA for 10 min. Dextran uptake was imaged as described below and data were analysed by two methods; average

CE

red fluorescent intensity per cell, and average number of cells associated with dextran puncta. Both methods showed significant differences, data are displayed at average red fluorescent

AC

intensity per cell (RFU). Immunocytochemistry Immunocytochemistry (ICC) was used to identify neurons in culture and the relative expression of lysosome-associated membrane protein (LAMP1) after treatment with virus or fibrate drugs. Cells were fixed with 4% PFA for 10 min and washed briefly with PBS. Cells were blocked with PBS containing 3% normal goat serum (NGS). Neurons were recognised by reaction to guinea-pig anti-microtubule-associated protein 2 (MAP2) (Synaptic Systems, D00042, 1:1000), lysosomes by reactions to rabbit anti-LAMP1 (Novus, NB120-19294, 1:250)

ACCEPTED MANUSCRIPT and CLN5 and CLN6 using antibodies raised by injecting rabbits with adenovirus (Haskell et al., 2003) expressing ovine CLN5 and CLN6. Primary antibodies were left on at 4 ᵒC overnight. Following wash steps, secondary antibodies were goat anti-rabbit Alexa 594 (Invitrogen A11037, 1:1000) or goat-anti-guinea pig Alexa 488 (Invitrogen, A11073, 1:1000). Following labelling, cells were incubated with 4’, 6-diamidino-2-phenylindole (DAPI) (Life Technologies, D1306,

T

100 ng/ml) for 10 min at room temperature. Imaging for analysis is described below (Neural

IP

culture imaging and statistical analysis).

CR

Lentiviral packaging

Approval for the generation and use of lentiviral vectors was obtained from the

US

Environmental Protection Agency (EPA), New Zealand (#GMD03091). HIV-1 derived lentiviral plasmids expressing ovine CLN5, ovine CLN6 or GFP under the myeloid proliferative U5

AN

enhancer element (MND) or synapsin promotor (Syn) were packaged using a second generation packaging system (Zufferey et al., 1997). An ‘empty’ control lentiviral vector (LVMNDMCS),

M

containing only a multiple cloning site, was also packaged. Briefly, 5.4 x 106 293FT cells (Life Technologies NZ, R70007) were transfected with transgene, psPAX2 and VSV-G plasmids

ED

(ViraPowerTM Lentiviral Packaging Mix, Invitrogen, K497500), in OptiMEM containing Lipofectamine-2000 (Life Technologies NZ, 116680027). psPAX2 was a kind gift from Didier

PT

Trono (Addgene plasmid # 12260). Medium containing virus was collected 48 h post transfection and concentrated by ultracentrifugation in a Beckman SW28 rotor at 110,000 x g for 90 min at 4

CE

°C. The viral pellet was suspended in phosphate-buffered saline containing 40 g/L lactose, and stored at 80 °C (Schoderboeck et al., 2015).

AC

Quantitative RT-PCR (qRT-PCR) was used to determine genomic viral titres using primer sequences specific for the woodchuck hepatitis virus posttranscriptional regulatory element

(WPRE;

Fwd

5’

CCGTTGTCAGGCAACGTG,

Rev

5’ AGCTGACAGGTGGTGGCAAT), an enhancer contained in many retroviral vectors and that is incorporated in the 3’ UTR of transgene transcripts (Lizee et al., 2003). Briefly, LV was incubated with DNase I (Life Technologies, 1804701), and RNA was isolated (RNeasy mini kit, QIAGEN, 74104), followed by reverse transcription (Transcriptor High Fidelity Reverse Transcription, Roche, 05081955001). Viral DNA was diluted and compared to a standard curve created from a known quantity of transgene plasmid. Viral genomic titres ranged from 1 x 109 to

ACCEPTED MANUSCRIPT 7 x 109 viral genomes/ mL. For confirmation of CLN5/6 overexpression and to calculate the percentage of transduced cells, 1 µL of virus was added to wells of a 24-well plate and transduction efficiency calculated by analysing the percentage of transduced cells using antibodies that only detect over expressed CLN5 and CLN6 (Fig. S1).

T

Lentiviral administration to neural cultures

IP

Cells were transduced during the maintenance stages of cell culture 3 - 4 days in vitro (DIV), receiving either LVMNDwtCLN or an ‘empty’ control, multiple cloning site (MCS), containing

CR

lentivirus (LVMNDMCS) using approximately 40 viral genomes per cell. Assays, following

Fibrate administration to neural cultures

US

lentiviral incubation, were performed after an additional 5 DIV.

AN

Stock solutions (10 mM) of fibrate compounds were made by dissolving gemfibrozil (Sigma NZ, G9518) and fenofibrate (Sigma NZ, F6020) in dimethyl sulphoxide (DMSO). Drugs

M

were added to the plate (final concentration 5 - 300 µM) for 24 h prior to fluorescent assay detection or immunocytochemistry and 16 h prior to RNA extraction. An equivalent amount of

ED

the highest DMSO concentration utilised was added to untreated control wells.

PT

Neural culture imaging and statistical analysis High-throughput screening (HTS) of fluorescent intensity values from LysoTracker, Cyto-ID and

CE

Dextran were obtained using the Cytell Cell Imaging System (GE Healthcare Life Sciences, Buckinghamshire, UK, 29-0567-49). The Cytell ‘Quick Count’ feature was used to detect

AC

Hoechst nuclear stain to calculate cell counts. The GFP BioApp, or a modified RFP version, was used to obtain total fluorescence and also to calculate % of nuclei associated with LysoTracker, Cyto-ID or dextran staining. A minimum of 6 images per well with 3 wells per treatment were imaged during screening. Exposure and gating for cell count and label associated nuclei were selected manually prior to screening by the user, as part of the Bioapp step-wise protocol. BipApp guides can be accessed online at, www. gelifesciences.com/GELS/campaigns/cytell-cellimaging-system-resource-center. Gating and exposure settings were kept constant for all plates being screened in that instance, and in each screening session equal numbers of control and

ACCEPTED MANUSCRIPT affected samples were used. Average fluorescent intensity per cell was calculated by dividing total fluorescent intensity by cell count. For MAP2 and LAMP1 immunocytochemistry and determining functional viral titers. Experiments were imaged using the Cytation5 Cell Imaging Multi-Mode Reader (BioTek, 12576) configured with DAPI, GFP and Texas Red light cubes. Typically, samples were imaged to capture a 3 x 3 montage, at 20 x magnification, and automatically stitched together.

T

Subpopulation analysis was used to determine cell counts and fluorescent intensity of MAP2/

IP

LAMP1. Average intensity of MAP2/ LAMP1 per cell and the percentage of MAP2 positive

CR

cells were used to obtain neuronal specific counts for culture characterisation (Held and Vishwanath., 2016). Cell nuclei object masks were defined as between 5 uM and 40 uM, and

US

size and gating for MAP2 positive cells were determined, post-capture, through manual selection of MAP2 positive nuclei and gating accordingly. Percentages of CLN5 and CLN6 positive cells

AN

was calculated using the same method.

Raw data, from Cytell and Cytation analyses, were normalised by dividing the value of the

M

affected or affected-treated values by the minimum value of the control (Malo et al., 2006). Normalised data were tested for statistical significance using GraphPad Prism 6 software for

ED

Windows, GraphPad Software, La Jolla California USA, www.graphpad.com. Analysis was performed using either the unpaired t-test (exact p value in brackets), an ordinary one-way

PT

ANOVA or two-way ANOVA (* p < 0.05, ** p < 0.01, *** p < 0.001), suitable statistical tests for HTS using multiple replicates (Zhang et al., 1999). Data are represented as average

CE

fluorescent intensity/cell in relative fluorescent units (RFU) +/- standard error of the means (SEM); all error bars on graphs represent SEM. In those instances in which one-way ANOVA

AC

showed significance, statistical analysis is presented from significance values obtained from multiple comparisons using Dunnett’s multiple comparison test between treatments and control data. In those instances in which a 2-way ANOVA showed an interaction between variables, statistical analysis is presented from significance values obtained from multiple comparisons using Tukey’s post-hoc analyses. Representative images were captured using an Olympus IX71 fluorescence microscope with an Olympus DP71 camera attachment.

ACCEPTED MANUSCRIPT Quantitative real-time PCR Total RNA was extracted from neural cultures using a Norgen Total RNA Purification Kit (Norgen, Ontario Canada, 17200) and 500 ng RNA treated with DNase I (1 U) and 1 x DNase buffer for 15 min at room temperature (Life Technologies NZ, 1806801). Reactions were stopped with 2.5 mM EDTA, 65 °C for 10 min. cDNA was generated using 60 µM random hexamer

T

primers, 21 U reverse transcriptase (RT), 200 nM dNTPs, 20 U RNase I and 1x reaction buffer.

IP

Quantitative PCR was performed using a LightCycler (LC) 480 Instrument (Roche), SYBR green I Master Mix (Roche, 04707516001) and manually designed primers against target genes;

CR

LAMP1 (Fwd 5’TCGGCAGTGTTCGTGGT3’, Rev 5’TTTGACACTTCCGCACCAG3’).

primers were also designed manually, ATPase

A1

US

The expression of target genes was normalised to two validated reference genes, to which

5’GCTGACTTGGTCATCTGC3’,

(Fwd

AN

5’CAGGTAGGTTTGAGGGGATAC3’)

and

RPL19

Rev (Fwd

5’AGCCTGTGACTGTCCATTCC3’, Rev 5’ACGTTACCTTCTCGGGCATT3’). Each reaction

M

contained 1 µl of cDNA 1:12 in sterile water, 1x LC SYBR green I Master Mix, 500 nM primers

ED

made up to 10 µl with sterile water. Specific amplification was confirmed by analysis of melt curves and sequencing of PCR products. Master Mix only and -RT negative controls were

PT

included on each plate. No amplification was seen in any of these controls. CP values were obtained from Roche LC software and relative quantification analysed using the Pfaffl method

CE

with expression relative to the mean of the 2 reference genes (Pfaffl, 2001). Transmission electron microscopy (TEM)

AC

Neurons were cultured on 13 mm Thermanox coverslips. At 8 DIV the culture medium

was removed and the cells were gently rinsed in dPBS and then immediately incubated at 37 ºC in EM grade fixative (2% paraformaldehyde, 2% glutaraldehyde in 0.1 M PB) for 1 h. Coverslips were washed three times (5 min each on ice) with phosphate buffer (0.1 M) before being transferred into coverslip baskets to post-fix the cells in 1% osmium tetroxide (OsO4) in ddH2O for 30 min. The cells were then washed ten times for 2 min in ddH2O before tertiary fixation with 1% uranyl acetate (UA) in ddH2O for 30 min. The cells were washed again three times in ddH2O before being dehydrated through an ethanol gradient series for 5 mins at each percentage, 50, 70,

ACCEPTED MANUSCRIPT 95, and 100%. The 100% ethanol step was repeated, followed by propylene oxide (PO) treatment for 15 min. Cells were embedded in epoxy resin by slowly increasing the ratio of epoxy: PO 1:2, 1:1, 2:1 (15 min for each step), then 100% epoxy, 1 h, and finally fresh 100% epoxy overnight at RT. BEEM capsules were filled with epoxy resin (with BDMA, medium hardness) and the coverslips placed cell side down onto the resin. Capsules were transferred into a 60 ºC oven to

T

polymerise for 48 h. Ultrathin sections (60-70 nm) were cut with a diamond knife, stained with

IP

UA and lead citrate and imaged in a Philips CM100 transmission electron microscope (Philips/FEI Corporation, Eindhoven, Holland) fitted with a MegaView III digital camera

AC

CE

PT

ED

M

AN

US

CR

(Olympus, Münster, Germany).

ACCEPTED MANUSCRIPT

Results Fluorescent markers were used to identify changes within the ALP and ELP in mixed neural cell

T

cultures, isolated from CLN5-/- and CLN6-/- sheep. These cultures have previously been shown to

IP

contain neurons, neuroblasts, astrocytes and microglia (Linterman et al., 2011; Hughes et al.,

CR

2014). Due to the neurodegenerative nature of Batten disease, one might assume changes are simply due to a decrease in the number of neurons. To qualify this, immunocytochemistry based

US

neuron quantification showed no differences in the proportion of MAP2-positive nuclei, but did show a decrease in the CLN6-/- MAP2 staining area, indicating there are not reduced numbers of

AN

neurons in affected cells, but the CLN6-/- cells are reduced in size (Fig. S2). This indicates that the differences observed here are due to inherent changes within the cells and not due to a

M

decrease in neuron number, qualifying the use of mixed cultures for experimental design. The disease-associated changes found in this study are summarised in table 1.

ED

Acidic organelles are significantly decreased in CLN6-/-neural cultures

PT

As lysosomal storage is a predominant feature of Batten disease, prenatal primary ovine neural cell cultures were used to determine if changes in the pH of lysosomes, and other acidic

CE

organelles, are evident in preclinical disease. CLN6-/- neural cells showed a 60% loss in average LysoTracker fluorescent intensity, measured in relative fluorescent units (RFU) in comparison to

AC

healthy controls (1.52 +/- 0.34 Control vs. 0.62 +/- 0.22 CLN6-/-, p = 0.0010, Fig. 1A,B). This loss of LysoTracker intensity suggests a change in lysosome acidity and/or

lysosomal biogenesis. To address this, we looked at lysosomal density, using LAMP1, and the effect of the lysosomotropic agent NH4Cl which has been shown to cause inhibition of ALP acidification and autophagosome/lysosomal fusion (Hart and Young., 1991). The fluorescent intensity in NH4Cl treated control neural cell cultures was significantly reduced by 81% (1.52 +/0.34 Control vs. NH4Cl treated 0.28 +/- 0.16, Fig. 1C,D), suggesting that the majority of LysoTracker staining was due to acidification within the ALP. In affected cells, there was no significant change in LysoTracker intensity with NH4Cl incubation, indicating CLN6-/- affected

ACCEPTED MANUSCRIPT cells have inherent increased pH (Fig. 1C,D). LAMP1 expression in CLN6-/- was not significantly different to expression in control cells (Fig. 1E,F), signifying decreased LysoTracker staining is due to a reduction in lysosomal acidity, and not decreased lysosomal biogenesis. Autophagy is significantly reduced in CLN6-/- neural cultures

T

Reduced lysosomal acidity impairs many vital cellular processes including the final stages

IP

of autophagy where autophagosomes fuse with lysosomes. To this end, we used Cyto-ID dye to

CR

quantify autophagic compartments. Average green fluorescence intensity per cell was reduced by 37% in CLN6-/- cultures, in comparison to controls (1.26 +/- 0.23 Control vs. 0.80 +/- 0.16

US

CLN6-/-, p = 0.0067, Fig. 1G,H). This CLN6-/- associated decrease in 488 nm emission represents a decrease in the number of pre-autophagosomes, autophagosomes, autolysosomes stained green

AN

(Guo et al., 2015).

M

Synapse activity-dependent bulk endocytosis is significantly decreased in CLN6-/- neural cultures Synaptic endocytosis is vital for the reuptake of neurotransmitters and recycling of

ED

synaptic vesicle components. Inert fluorescent dextrans of 40 kDa were used to monitor fluid phase activity-dependent bulk endocytosis (ADBE) in primary neural cultures. CLN6-/- cultures

PT

showed a 39% decrease in cells endocytosing 40 kDa dextran in comparison to control cultures (1.30 +/- 0.29 Control vs 0.79 +/- 0.32 CLN6-/-, p = 0.0313, Fig. 1I,J). Without prior gabazine

CE

excitation there was minimal to no detectable dextran internalisation (Fig.1K,M), indicating that internalisation was due to ADBE occurring specifically at neurons, and not the Rho dependent

AC

fluid-phase pathway previously shown to endocytose dextran (Sabharanjak et al., 2002). These fluorescent dextrans are almost exclusively taken up into nerve terminals by ADBE during periods of high neuronal activity (Clayton and Cousin, 2009). To ensure that the endocytosis of dextran was occurring in neurons, mature neurons were labelled with green fluorescent protein (GFP) by transducing cultures with a lentivirus expressing GFP under the control of the synapsin promoter. GFP-positive neurons showed evidence of dextran accumulation at sites likely representing synapses in both control and disease cultures (Fig. 1N).

ACCEPTED MANUSCRIPT Lentiviral overexpression of CLN6 increases autophagic flux, acidic organelles and ADBE Transduction of affected primary ovine neural cultures with lentiviral vectors, expressing wtCLN6, indicated these cellular changes were corrected by the introduction of a copy of the functional ovine CLN6 gene. Immunocytochemistry confirmed an overexpression of CLN6, at 48 hours post-transduction (Fig. S1).

T

Overexpression of CLN6 in affected cells caused a 129% increase in LysoTracker

IP

fluorescent intensity (0.62 +/- 0.22 CLN6-/- vs. 1.42 +/- 0.34 virus treated, Fig. 2A-C), a 31% increase in Cyto-ID fluorescence (0.80 +/- 0.16 CLN6-/- vs. 1.05 +/- 0.14 virus treated, Fig.

CR

2F,G), and a 39% increase in fluorescent dextran intensity per cell (0.79 +/- 0.32 CLN6-/- vs. 1.15

US

+/- 0.14 virus treated, Fig. 2H,I). To confirm CLN6 overexpression was responsible for increased fluorescent marker intensity, cultures were treated with a control lentiviral vector, LVMNDMCS, which resulted in no significant change (Fig. S1).

AN

Notably, overexpression of CLN6 also increased LysoTracker intensity in control cells (Fig. 2B,C), implicating CLN6 in the regulation of vesicle pH or lysosomal biogenesis. To

M

explore this further, cells overexpressing CLN6 were also treated with NH4Cl. This did not alter

ED

LAMP1 expression (1.3 +/- 0.23 control vs 1.35 +/- 0.12 CLN6-/- vs 1.15 +/- 0.13 CLN6-/- virus treated vs 1.28 +/- 0.14 CLN6-/- virus treated + NH4Cl), indicating that increased LysoTracker

PT

staining upon CLN6 overexpression is due to acidification of the cell (Fig. 2D,E).

CE

Lentiviral overexpression of CLN6-/- partially restores autophagy-related ultrastructural changes Further evidence of impaired autophagy and lysosomal function was evident at the ultrastructural

AC

level. TEM was used to compare general cellular health, as well as stages of autophagy, including: autophagosomes (also termed initial autophagic vacuoles, AVi) and late stage autolysosomes (also termed late degradative autophagic vacuoles, AVd); residual bodies containing undigested material and membraneous whorls (*); and cytoplasmic vacuoles (V) (Fig. 3) (Biazik et al., 2015; Klionsky et al., 2014). Control cells had intact nuclei bound by a distinct double membrane and abundant welldeveloped cytoplasmic organelles, including extensive rough endoplasmic reticulum (RER), abundant ribosomes, Golgi (G), and numerous mitochondria (M) with parallel cristae as expected

ACCEPTED MANUSCRIPT to meet the high-energy demand of neurons (Fig. 3A, Ai). CLN6-/- cells also had intact cellular nuclei and some had regions of cytoplasm containing well-developed cytoplasmic organelles (Fig. 3B). However, the majority of CLN6-/- cells were distinct from controls, exhibiting significant vacuolisation and accumulations of undigested storage material including membranous whorls in residual bodies (Fig. 3E, H, K). In areas with significant storage material accumulation, the cytoplasm appeared pale and diffuse, with fewer organelles (Fig. 3H).

IP

T

Components of the autophagy pathway were considerably easier to identify in CLN6-/cells due to increased number and size of autophagosomes and autolysosomes. AVi were

CR

identified by the presence of an outer double-membrane surrounding sequestered cytoplasmic material and intact cytoplasmic organelles such as RER and ribosomes (Klionsky et al., 2014).

US

AVd had a single membrane, or partially degraded double membrane, and contained cytoplasmic organelles in various stages of degradation with increased electron density (Fig. 3D-H). In

AN

contrast to controls, CLN6-/- cells were peppered with AVi and, more obviously, AVd, even in areas devoid of storage material accumulation and vacuolisation (Fig. 3B, E, Ei, red arrows).

M

Typically, CLN6-/- cells accumulated large AVd, in excess of 3000 nm, and undigested material sequestered in electron dense residual bodies together with large membranous whorls (Fig. 3H).

ED

This is indicative of decreased waste degradation due to inefficient AVd, possibly due to reduced acidity upon fusion of small acidic lysosomes with large AVi. A single membranous whorl was

PT

observed in healthy controls (Fig. 3G). The most prevalent morphology in CLN6-/- cells was the degree of cytoplasmic

CE

vacuolisation. These vacuoles were large, single-membraned, mostly empty, and occupied a significant proportion of cytoplasmic space (Fig. 3K). Increased vacuolisation could be due to

AC

residual empty vacuoles forming after autophagosome-lysosome fusion, which subsequently fuse to form macro-vacuoles (El Hasasna et al., 2015), or due to autophagic apoptosis (Golstein and Kroemer, 2007; Kroemer et al., 2005). In contrast, control cells only had a few small vacuoles, generally less than 200 nm in size, widely dispersed within normal cytoplasm filled with abundant organelles. The most prominent and significant change, after incubation with LVMNDCLN6, was the dramatic reduction in cytoplasmic vacuolisation (Fig 3C,L). Although some large AVd persisted after treatment, the cytoplasm surrounding them was packed full of healthy organelles (Fig. 3F,I).

ACCEPTED MANUSCRIPT This indicates wtCLN6 addition increased residual vacuole clearance, or reduced autophagic apoptosis, resulting in a cytoplasm packed with well-formed organelles. Fibrate drug administration increases levels of autophagy and acidic organelles in CLN6-/neurons Fibrates are a class of small molecule, commercially available, FDA-approved lipid-

T

lowering drugs that have anti-inflammatory and neuroprotective effects on neurons (Pahan,

IP

2006). Dysfunctional lysosomes are a feature of all known NCLs and fibrates have been shown

CR

to induce lysosomal biogenesis via nuclear translocation of transcription factor EB (TFEB), considered to be the master regulator of lysosomal biogenesis (Ghosh et al., 2015; Sardiello and

US

Ballabio, 2009). We found two fibrate drugs, gemfibrozil (gem) and fenofibrate (fen) both increase autophagy, acidic organelles and ADBE in CLN6-/- affected cultures (Fig.4A-F).

AN

Gemfibrozil and fenofibrate were added to cultures at a range of concentrations, between 5 and 300 µM for 24 hours prior to biomarker assay. Toxicity was assessed in parallel via total cell count (Fig 4G). From this the optimum concentrations of drug to restore the biomarker to

M

control levels whilst not inducing cell death could be assessed (Fig. 4B,D,F). At optimum

ED

concentrations, LysoTracker increased with 25 µM of fenofibrate or gemfibrozil treatment resulting in a 82% and 95% rise in intensity per cell, respectively (1.03 +/- 0.83 CLN6-/- vs 1.48 +/- 0.18 fen vs 1.62 +/- 0.17 gem, Fig. 4A,B), and a 30% and 64% autophagy increase with 50

PT

µM fenofibrate and 25 µM gemfibrozil, respectively (0.85 +/- 0.12 CLN6-/- vs. 1.26 +/- 1.17 fen vs 1.40 +/- 0.61 gem, Fig. 4C,D), and a 45% and 65% increase in ADBE with 100 µM

CE

fenofibrate and 50 µM gemfibrozil, respectively (0.79 +/- 0.32 CLN6-/- vs 1.15 +/- 0.12 fen vs 1.3 +-/ 0.1 gem, Fig. 4E,F). Gemfibrozil restored both autophagy and ADBE to levels observed

AC

in controls at lower concentrations than fenofibrate. This is in agreement with other studies that show gemfibrozil exerts a stronger therapeutic effect (Pahan, 2006). At higher concentrations both drugs caused a significant increase in overall cell death (Fig. 4H,I). To confirm that induction of autophagy and acidic organelles resulted from upregulation of lysosomal genes, we looked at mRNA and protein expression of LAMP1, a primary target of TFEB (Palmieri et al., 2011). Gemfibrozil, but not fenofibrate, treatment resulted in a significant increase in expression of LAMP1 RNA (p = 0.0129). Both drugs significantly increased expression of LAMP1 protein at 50 µM (Fig. 4H,I).

ACCEPTED MANUSCRIPT Analysis of early changes and viral correction in CLN5-/- ovine neural culture After characterisation of CLN6-/- cultures, we tested whether the same assays could be used to characterise changes in CLN5-/- cultures. Determination of the functional titers confirmed overexpression of CLN5 at a minimum of 48 hours post addition of virus (Fig. S1). Similar trends, to CLN6-/- cultures, were seen in CLN5-/- cultures, with a 33% decrease in LysoTracker

T

intensity (1.42 +/- 0.24 Control vs. 0.92 +/- 0.16 CLN5-/-, p = 0.0079, Fig. 5A,B), a 21% decrease

IP

in autophagy (1.21 +/- 0.12 Control vs. 0.95 +/- 0.09 CLN5-/-, p = 0.0015, Fig. 5E,F) and a 42%

CR

reduction in the average dextran fluorescence per cell (1.67 +/- 0.48 Control vs. 0.97 +/- 0.20 CLN5-/-, p = 0.0080, Fig. 5G,H). In contrast to CLN6-/- affected cultures, CLN5-/- cultures

US

showed a 49% increase in expression of LAMP1 (Fig.5 C,D), indicating an upregulation of lysosomal biogenesis in CLN5-/- cultures. This implies that the decrease in LysoTracker staining

AN

is due to decreased acidity and not a decrease in functioning lysosomes. This represents the first significant difference we have identified between CLN5-/- and CLN6-/- cultures.

M

Addition of LVMNDCLN5 resulted in restoration of activity, a 24% increase in autophagy (0.95 +/- 0.09 CLN5-/- vs. 1.17 +/- 0.10 CLN5-/- + LV; Fig. 5E,F), a 46% increase in

ED

acidic organelles (0.92 +/- 0.16 CLN5-/- vs. 1.40 +/- 0.10 CLN5-/- + LV; Fig. 5A,B) and a 78% increase in dextran uptake (0.97 +/- 0.20 CLN5-/- vs. 1.72 +/- 0.46 CLN5-/- + LV; Fig. 5G,H).

CE

PT

Overexpression of CLN5 caused a 26% decrease in LAMP1 (Fig. 5C, D).

Table 1. Summary of changes to ALP and ELP activity in CLN5-/- and CLN6-/- cell cultures.

AC

LysoTracker % Change CI 95% ↓33 -0.8322 to -0.1726 ↓60 -1.323 to -0.4921

CLN5 CLN6

Cyto-ID % Change ↓21 ↓37

CI 95% -0.4019 to -0.1281 -0.7560 to -0.1680

40 kDa dextran % Change CI 95% ↓42 -1.178 to -0.2286 ↓39 -0.9573 to -0.05869

ACCEPTED MANUSCRIPT Discussion At present, there are no established therapies for any form of Batten disease and the exact mechanisms of neurodegeneration, and therefore the potential therapeutic targets, are largely unknown. Here, selected assays were used to characterise common cellular changes in CLN5 -/and CLN6-/- ovine neural cultures, and these changes were used as biomarkers for therapeutic

T

screening. We report CLN5-/- and CLN6-/- neural cultures have reduced autophagy, acidic

IP

organelles and synaptic endocytosis in comparison to unaffected heterozygous controls (table 1).

HTS of therapeutic targets in cell culture models.

CR

The fluorescent screening assays utilised are fast and easily replicable; qualities useful for future

To examine cellular changes we used mixed cell population neural cultures, due to the

US

well-accepted significance of glial cells as pivotal providers of neuronal metabolic and spatial support, oxidative stress protection, and neuronal survival, as well as the modulation of multiple

AN

other neuronal functions (Ji et al., 2013; Ray et al., 2014; Ricci et al., 2009). This setup provides a more accurate view of the inherent and induced cellular changes observed during these studies.

M

Initial quantification in both culture models showed no change in neuron proportion, indicating

ED

that the observed differences in fluorescent markers are due to intrinsic changes to the cell types and not simply due to a decrease in neurons, as one might expect from a neurodegenerative

PT

condition.

The cellular changes described here are not unexpected. Lysosomal dysfunction and

CE

storage body accumulation are extensively described NCL pathologies, presenting in all known disease subtypes. Enhancing lysosomal function, and the intrinsically linked autophagic pathway,

AC

to improve neuronal function and survival has become a focal point for treating neurodegenerative disease (Levine et al., 2015; Martini-Stoica et al., 2016; Menzies et al., 2015). During autophagy, cytoplasmic debris and organelles are engulfed in double membraned AV, termed autophagosomes. Fusion of autophagosomes with lysosomes exposes the cellular waste to an acidic environment for degradation, completing the ALP (Bento et al., 2016). ALP defects are implicated in numerous neurodegenerative disorders including Alzheimer’s disease, Parkinson’s disease and Huntington’s disease (Martini-Stoica et al., 2016; Xu et al., 2016). Inducing the ALP could be a viable therapy for Batten disease treatment, with ALP-associated deficits present in multiple variants and several wtCLN proteins, including CLN3 and CLN5, residing within the

ACCEPTED MANUSCRIPT ALP (Isosomppi et al., 2002; Mole et al., 2004). These experiments further demonstrate ALP dysfunction in Battens variants, and support further investigation into ALP induction for therapy. Constitutive autophagy is neuroprotective and is of particular importance for postmitotic cells, such as neurons (Hara et al., 2006). Here, we show evidence of decreased autophagy in CLN-/- neurons, by use of an AV selective dye. Autophagy deficits are a

T

common pathological characteristic of several Batten disease forms, including CLN3,

IP

CLN6, CLN7 and CLN10, although the exact points of autophagy dysfunction are unknown (Brandenstein et al., 2016; Cao et al., 2006; Koike et al., 2005; Thelen et al., 2012).

CR

Accumulated LC3-positive vesicles have been observed in both the Cln3∆ex7/8 and Cln6nclf mouse models (Cao et al., 2006; Thelen et al., 2012) and fibroblasts isolated from human

US

CLN2-/- and CLN3-/- patients have shown reduced autophagosome formation and maturation (Vidal-Donet et al., 2013), indicating possible blocks in AV maturation, or autophagosome-

AN

lysosome fusion. This is supported by our EM data showing an accumulation of storage material in AVd, indicating dysfunctional autolysosomal degradation and clearance,

M

potentially due to insufficient AV maturation or acidification. In contrast, the Cyto-ID dye indicates reduced AV in CLN-/- neurons, suggesting an accumulation of dysfunctional AV,

ED

which are not marked by Cyto-ID. This decrease could also be due to reduced cytoplasmic volume, as indicated by TEM identifying a large degree of cytoplasmic vacuolisation.

PT

It is not known whether reduced autophagy is a primary consequence of CLN5/ CLN6 loss, or reduced in response to another factor such as the impaired lysosomal pH,

CE

which is apparent in both CLN5-/- and CLN6-/- cultures. Inducing autophagy alone in the Cln3 mouse model has been shown to have no impact on cell survival, suggesting that

AC

autophagy is a secondary problem (Cao et al., 2006). Under conditions of impaired AV clearance, autophagy induction could further exacerbate pathology (Tung et al., 2012). Further study is therefore needed to locate the defect in the ALP and the relationship to the primary genetic defects in these diseases. Increased levels of autophagy can be associated with activation of cellular stress and death (Ogata et al., 2006). Consequently, pharmaceutical screens addressing only autophagy induction have resulted in a large number of false positives (Chauhan et al., 2015). For example, increased expression of LC3-puncta, indicating autophagosome formation, is a widely used marker of autophagy induction but can also be a result of a block in

ACCEPTED MANUSCRIPT autophagosome maturation (Levine et al., 2015; Renna et al., 2010). To eliminate the possibility of increased autophagy as a result of cell death it is important to implement a multistep screening system. We utilised LysoTracker, a marker of acidic organelles such as lysosomes, to probe levels of acidic organelles as accumulation of undigested storage material and lysosomal dysfunction are well-documented NCL pathological characteristics in patients and animal

T

models. Decreased organelle pH has been previously documented in CLN6-/- patient

IP

fibroblasts (Holopainen et al., 2001b) and murine Cln3∆ex7/8 and Cln6nclf cerebellar cell lines

CR

(Cao et al., 2011; Fossale et al., 2004).

Decreased lysosomal pH causes non-functional AVd, as an acidic pH is crucial for

US

hydrolase activity and efficient waste degradation. Both CLN5-/- and CLN6-/- neural cultures show decreased levels of LysoTracker staining. LysoTracker intensity, in CLN5-/- and CLN6/-

AN

, was not associated with a decreased expression of lysosomal marker, LAMP1. This points

towards a functional pH related defect, and not reduced lysosomal biogenesis. Conversely,

M

CLN5-/- cells showed an increase in LAMP1 expression. An upregulation of lysosomal enzymes is a phenomena shown in other Batten models, and likely represents an increased

ED

number, or size, of lysosomes due to the increasing undigested storage material (Bartsch et al., 2013; Pohl et al., 2007). Although there was no change in CLN6-/- LAMP1 expression,

PT

the presence of increased lysosomal storage quantity and size was identified via TEM at the ultrastructural level. It will be interesting in the future to analyse the ultrastructural

CE

characteristics of CLN5-/- cells. As a third biomarker for characterisation and correction, we used fluorescent dextrans,

AC

large inert markers of fluid phase endocytosis, to observe ADBE of synaptic vesicle (SV) components and as an indicator of ELP function. A continuous supply of SVs is essential for propagation and termination of synaptic signalling (Soykan et al., 2016). Previous studies have shown that during high-intensity neuronal excitation, fluorescent dextran is almost exclusively internalised by ADBE, since individual synaptic vesicles are too small to internalise a fluorescently-tagged 40 kDa dextran (Clayton and Cousin, 2009). ADBE generates endosome-like structures for fluid phase uptake, from which smaller SVs can bud for replenishment of the SV recycling pool (Cheung et al., 2010). After stimulation, CLN5-/-

ACCEPTED MANUSCRIPT and CLN6-/- cultures show significantly less internalised dextran, suggesting that ADBE and therefore SV production are compromised. Synaptic alterations have been shown in other NCLs, including reduced synaptic vesicle pool size and synaptic currents in a Cln1-/- mouse model (Kielar et al., 2009; Peng et al., 2015) and a loss of synaptic proteins in the CLN5-/Borderdale sheep model (Amorim et al., 2015). Another explanation for the reduced dextran uptake in CLN6-/- cultures is the selective loss of GABAergic neuronal subtypes, identified

T

previously (Oswald et al., 2001).

IP

To demonstrate the application of this in vitro screening system, two therapeutic

CR

methods previously tested in Batten disease - gene therapy and fibrate drugs – were screened for restoration of autophagy, organelle pH and synaptic endocytosis in ovine

US

culture models. Lentiviral-mediated wtCLN overexpression resulted in restoration of all markers towards intensity levels found in controls. In light of successful cell culture studies,

AN

LV and AAV-mediated gene therapy is currently underway in CLN5-/- and CLN6-/- sheep (Neverman et al., 2015; Palmer et al., 2015). Gene therapy has also shown highly promising

M

results in a mouse model of CLN3 (Bosch et al., 2016) and a canine model of CLN2 (Katz et al., 2015).

ED

To test our assay system with small molecules, we used two fibrate drugs; gemfibrozil and fenofibrate (Pahan, 2006). Fibrates induce nuclear translocation of TFEB,

PT

resulting in upregulation of a wide-variety of genes involved in autophagy and lysosomal biogenesis (Sardiello and Ballabio, 2009; Settembre et al., 2011). TFEB activation is a

CE

promising area for ALP-focused therapeutics in neurodegenerative disease. Previous work has shown a TFEB-dependent upregulation of CLN2 enzymatic activity in a Cln2-/- mouse

AC

model, (Ghosh et al., 2012) and increased degradation of pathogenic tau tangles in an Alzheimer’s disease model (Polito et al., 2014). Addition of gemfibrozil and fenofibrate to CLN6-/- neural cultures resulted in a dose-responsive increase in autophagy and acidic organelles. In addition, increased gene expression of LAMP1 indicates this effect was mediated via TFEB, as shown previously (Hong et al., 2015). Continuing studies will test the effect of fibrates in CLN5-/-, given the increase of LAMP1 expression in affected cultures. The cellular changes described in this study are common in various forms of NCL, contributing to the hypothesis that NCL protein function converges on the same processes or pathways (Cooper, 2010). It also indicates that a common therapy may be applicable. The

ACCEPTED MANUSCRIPT reported changes are evident at a stage well before the onset of overt disease, with ovine disease typically presenting symptoms at 7 to 9 months of age. This highlights the importance of intervention at the earliest possible stages to optimise patient outcome. ALP and synaptic changes identified here reveal areas for further research and therapeutic intervention. The fluorescent assays used here are applicable for in vitro functional screening of compounds, prior to in vivo testing, for Batten disease treatment, and may also

CR

IP

T

prove useful in cell culture models of other degenerative disorders.

US

Acknowledgements

The authors would like to thank Professor David Palmer, Lincoln University, for his help in

AN

organising tissue for cell cultures and editorial assistance with the manuscript, the staff of the Johnstone Memorial Laboratory and the Ashley Dene Research Farm, Lincoln University for

M

their help in animal care and breeding and Sharon Lequeux (Otago Centre for Electron Microscopy) for EM expertise. Funding for this study was obtained from the New Zealand

ED

Neurological Foundation, the Otago School of Medical Sciences Dean’s Bequest funds and the Brain Health Research Centre, NZ. HB is funded by a University of Otago Doctoral Scholarship

PT

and the Hanns Mohler Roche scholarship, and NN by a Neurological Foundation Miller Scholarship. Viruses were packaged by the Otago Viral Vector Facility and, in part, funded by

AC

CE

the Brain Research New Zealand Centre of Research Excellence.

ACCEPTED MANUSCRIPT Figure 1. CLN6-/- primary ovine neural cultures show a significant decrease in acidic organelles, autophagic vesicles (AV) and activity-dependent bulk endocytosis (ADBE) of fluorescent dextran. A. LysoTracker (red) and Hoechst (blue) in representative images of control, CLN6-/-. B. Quantification of average red fluorescent intensity per cell in relative fluorescent units (RFU); ** p = 0.0010, unpaired t-test, n = 5. C. control and CLN6-/- treated

T

with NH4Cl to prevent lysosomal acidification. D. Quantification with, or without, NH4Cl co-incubation (+NH4Cl), in comparison to controls; ** p < 0.01 *** p < 0.001, two-way

IP

ANOVA, n = 5 per genotype. E. LAMP1 expression (red) in control and CLN6-/-. F.

CR

Quantification of average red fluorescent intensity per cell (RFU); not significant, unpaired t-test, n = 4 G. AV were detected using Cyto-ID dye (green), representative images of both

US

control and CLN6-/- cell cultures. H. Quantification of average green fluorescent intensity per cell (RFU); ** p = 0.0067, un-paired t-test, n = 5. I. Representative images of 40 kDa

AN

dextran endocytosis (red) in control and CLN6-/- cultures and K. control and CLN6-/without gabazine pre-treatment. J. Quantification of average red fluorescent intensity per

M

cell (RFU); * p = 0.0313, unpaired t-test, n = 4. M. Quantification with, or without (-G), gabazine pre-treatment of average red fluorescent intensity (RFU), in comparison to control;

ED

** p < 0.01, *** p < 0.001, two-way ANOVA, n = 4. N. Representative images of GFP under the synapsin promotor showing dextran uptake into neurons. All images the same

CE

PT

size, representative scale bar in A. 20 µm.

Figure 2. Lentiviral mediated CLN6-overexpression in CLN6-/- cell cultures restores

AC

acidic organelles, AV, and ADBE dextran uptake. Incubation with LysoTracker (red) and Hoechst (blue) in A. representative images of control, CLN6-/-, CLN6-/- + LVMNDCLN6 (LV) and C. control + LV. B. Quantification of average red fluorescent intensity per cell (RFU), n = 5. D. LAMP1 expression in control, CLN6-/- and CLN6-/- + LV + NH4Cl. E. Quantification of red fluorescent intensity per cell (RFU) indicating CLN6 overexpression and perturbation of cellular pH has no influence on LAMP1 expression, in comparison to controls; n = 4. F. Cyto-ID autophagy dye (green) in representative images showing control, CLN6-/- and CLN6-/- + LV G. Quantification of average green fluorescent intensity per cell (RFU), n = 5. H. ADBE of 40 kDa dextran in control, CLN6-/- and CLN6-/- + LV. I.

ACCEPTED MANUSCRIPT Quantification of average red fluorescent intensity per cell (RFU), n = 4. J. Representative images of GFP under the synapsin promotor showing dextran uptake into neurons. All statistics calculated via two-way ANOVA * p < 0.05, ** p < 0.01, *** p < 0.001.

T

Representative scale bar in A. 20 µm.

IP

Figure 3. TEM shows an increased frequency of large AVd, accumulation of undigested storage material, and cytoplasmic vacuoles in CLN6-/- cells when compared to controls.

CR

Treatment for 5 DIV with LVMNDCLN6 (LV) dramatically decreases cytoplasmic vacuolisation. A-Ci Representative images of abundant and healthy cellular organelles (white

US

arrowheads) including nuclei (N), mitochondria (M), Golgi (G), rough endoplasmic reticulum (RER). Insert B. an early AV with a double membrane, observed more frequently in CLN6-/-

AN

cells. D-E. Representative images of AVi and AVd (red arrowheads). Inserts in D. smaller AVd in control cells in comparison to AVd in E, Ei CLN6-/- cultures. G-I Representative

M

images of AVd (red arrowheads) and residual bodies (*). Insert G. efficient waste degradation, in control cells, in contrast to accumulation of membranous whorls in CLN6-/-, insert H. J-L

ED

Representative images of cytoplasmic vacuoles (V), showing marked increases in CLN6-/-, and subsequent decrease after LV treatment. Insert L. a healthy nuclear membrane in a treated cell

PT

in contrast to CLN6-/- in K. Scale bars 2000 nm: A, Ai, C, F, I, H, K, Ki 1000 nm: B, Ci, D,

CE

E, G, J, L and 500 nm: Ei, Hi. Figure 4. Addition of fibrate drugs to CLN6-/- cultures restores acidic organelles and

AC

autophagy to levels, similar to that observed, in control cultures. LysoTracker (red) and Hoechst (blue) in representative images of A. CLN6-/-, CLN6-/- + fenofibrate (25 µM) and gemfibrozil (25 µM). B. Optimal concentration of compound to restore biomarker to control RFU levels, quantified as average red fluorescent intensity per cell in relative fluorescent units (RFU), n = 5. Significance shown is in comparison to control, one-way ANOVA. C. Cyto-ID autophagy detection dye (green) in representative images of CLN6-/-, CLN6-/- + fenofibrate (50 µM) and gemfibrozil (25 µM). D. Optimal concentration of compound to restore biomarker to control RFU levels, quantified as average Cyto-ID autophagy detection

ACCEPTED MANUSCRIPT dye intensity, per cell (RFU), n = 5. Significance shown is in comparison to control, oneway ANOVA. E. endocytosis of 40 kDa dextran (red) in CLN6-/-, CLN6-/- + fenofibrate (100 µM) and gemfibrozil (50 µM). F. Optimal concentration of compound to restore biomarker to control RFU levels, quantified as average red fluorescent intensity per cell in relative fluorescent units (RFU), n = 5. Significance shown is in comparison to control, one-

T

way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001. G. Dose response in RFU (left y-axis)

IP

depicted as bars plotted with average cell count depicted as a line graph (right y-axis) over a series of concentrations (5, 25, 50, 100, 150, 250 & 300 µM) demonstrating toxicity of

CR

compounds on cell death. H. Expression of LAMP1 (red) post fenofibrate or gemfibrozil (50 µM) incubation. I. Quantification of relative expression via average fluorescent intensity per

US

cell (RFU) of LAMP1 in control, CLN6-/- and CLN6-/- + fenofibrate or gemfibrozil. All

AN

images the same size, representative scale bar in A. 20 µm.

Figure 5. LVMNDCLN5 (LV) restores defects in acidic vesicles, AV and ADBE

M

towards activity observed in control cultures. A. LysoTracker (red) and Hoechst (blue) in representative images of control, CLN5-/- and CLN5-/- + LV. B. Quantification of average

ED

red fluorescent intensity per cell (RFU), n = 5. C. LAMP1 expression in control, CLN5-/and CLN5-/- + LV. D. Quantification of average red fluorescent intensity per cell (RFU),

PT

indicating increased LAMP1 expression in CLN5-/- that is reduced by LV treatment E. CytoID autophagy dye (green) in representative images showing control, CLN5-/- and CLN5-/- +

CE

LV. F. Quantification of average green fluorescent intensity per cell (RFU), n = 6. G. ADBE of fluorescent dextran (red) in representative images of control, CLN5-/- and CLN5-/- + LV.

AC

H. Quantification of average red fluorescent intensity per cell (RFU), n = 6. All statistical analysis performed using a two-way ANOVA, in comparison to control, * p < 0.05, ** p < 0.01. Representative scale bar in A. 20 µm.

ACCEPTED MANUSCRIPT Figure S1. Transduction of CLN5 or CLN6 containing lentivirus (LV) causes a significant increase in cells expressing CLN5 or CLN6, respectively, at 48 hours posttransduction. LV (1.5 µl) containing either, A-B. multiple cloning site (MSC), C. CLN5, or D. CLN6, was added at 1.5 µl to wells of a 24-well plate for 48 hours. Representative images of ICC with A,C. anti-CLN5 (green) or B,D anti-CLN6 (red), both counterstained

T

with DAPI (blue). Quantification of the proportion of E. CLN5 or F. CLN6 positive cells, n

IP

= 4. All statistical analysis performed using an un-paired t test, **** p < 0.0001.

CR

Representative scale bar in A. 50 µM

Figure S2. There is no change in percentage of neurons between control and CLN5-/-

US

or CLN6-/- affected ovine neural cultures. Reduced size of neurons is apparent in CLN6-/- cells, when compared to controls. Representative images of MAP2 staining

AN

(green) and DAPI (blue) in A. control, B. CLN6-/- and C. CLN5-/- mixed population neural cell cultures. D. The percentage of MAP2 positive nuclei is unchanged between control,

M

CLN6-/- and CLN5-/- cultures, n = 4. E. The area of MAP2 staining per MAP2 positive nuclei is reduced in CLN6-/- cells, suggesting reduced neuron size, n = 4. All statistical

ED

analysis performed using a one-way ANOVA, in comparison to control, ** p < 0.01.

AC

CE

PT

Representative scale bar in A. 100 µm.

ACCEPTED MANUSCRIPT References

AC

CE

PT

ED

M

AN

US

CR

IP

T

Amorim, I. S., et al., 2015. Molecular neuropathology of the synapse in sheep with CLN5 Batten disease. Brain and Behavior. 5. Bartsch, U., et al., 2013. Apoptotic photoreceptor loss and altered expression of lysosomal proteins in the nclf mouse model of neuronal ceroid lipofuscinosis. Invest Ophthalmol Vis Sci. 54, 6952-9. Bento, C. F., et al., 2016. Mammalian Autophagy: How Does It Work? Annu Rev Biochem. Biazik, J., et al., 2015. The versatile electron microscope: an ultrastructural overview of autophagy. Methods. 75, 44-53. Bond, M., et al., 2013. Use of model organisms for the study of neuronal ceroid lipofuscinosis. Biochim Biophys Acta. 1832, 1842-65. Bosch, M. E., et al., 2016. Self-Complementary AAV9 Gene Delivery Partially Corrects Pathology Associated with Juvenile Neuronal Ceroid Lipofuscinosis (CLN3). J Neurosci. 36, 9669-82. Brandenstein, L., et al., 2016. Lysosomal dysfunction and impaired autophagy in a novel mouse model deficient for the lysosomal membrane protein Cln7. Human Molecular Genetics. 25, 777-791. Cao, Y., et al., 2006. Autophagy is disrupted in a knock-in mouse model of juvenile neuronal ceroid lipofuscinosis. Journal of Biological Chemistry. 281, 20483-20493. Cao, Y., et al., 2011. Distinct Early Molecular Responses to Mutations Causing vLINCL and JNCL Presage ATP Synthase Subunit C Accumulation in Cerebellar Cells. Plos One. 6. Chauhan, S., et al., 2015. Pharmaceutical screen identifies novel target processes for activation of autophagy with a broad translational potential. Nature Communications. 6. Cheung, G., et al., 2010. Activity-dependent bulk endocytosis and clathrin-dependent endocytosis replenish specific synaptic vesicle pools in central nerve terminals. J Neurosci. 30, 8151-61. Clayton, E. L., Cousin, M. A., 2009. Quantitative monitoring of activity-dependent bulk endocytosis of synaptic vesicle membrane by fluorescent dextran imaging. Journal of Neuroscience Methods. 185, 76-81. Cooper, J. D., 2010. The neuronal ceroid lipofuscinoses: the same, but different? Biochem Soc Trans. 38, 1448-52. Cotman, S. L., et al., 2002. Cln3 (Deltaex7/8) knock-in mice with the common JNCL mutation exhibit progressive neurologic disease that begins before birth. Hum Mol Genet. 11, 2709-21. El Hasasna, H., et al., 2015. Rhus coriaria induces senescence and autophagic cell death in breast cancer cells through a mechanism involving p38 and ERK1/2 activation. Sci Rep. 5, 13013. Fossale, E., et al., 2004. Membrane trafficking and mitochondrial abnormalities precede subunit c deposition in a cerebellar cell model of juvenile neuronal ceroid lipofuscinosis. BMC Neurosci. 5, 57. Frugier, T., et al., 2008. A new large animal model of CLN5 neuronal ceroid lipofuscinosis in Borderdale sheep is caused by a nucleotide substitution at a consensus splice site (c.571+1G>A) leading to excision of exon 3. Neurobiol Dis. 29, 306-15.

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Ghosh, A., et al., 2012. Gemfibrozil and fenofibrate, Food and Drug Administration-approved lipidlowering drugs, up-regulate tripeptidyl-peptidase 1 in brain cells via peroxisome proliferatoractivated receptor alpha: implications for late infantile Batten disease therapy. J Biol Chem. 287, 38922-35. Ghosh, A., et al., 2015. Activation of peroxisome proliferator-activated receptor alpha induces lysosomal biogenesis in brain cells: implications for lysosomal storage disorders. J Biol Chem. 290, 10309-24. Golstein, P., Kroemer, G., 2007. A multiplicity of cell death pathways. Symposium on apoptotic and non-apoptotic cell death pathways. EMBO Rep. 8, 829-33. Guo, S., et al., 2015. A rapid and high content assay that measures cyto-ID-stained autophagic compartments and estimates autophagy flux with potential clinical applications. Autophagy. 11, 560-72. Hara, T., et al., 2006. Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature. 441, 885-9. Hart, P. D., Young, M. R., 1991. Ammonium chloride, an inhibitor of phagosome-lysosome fusion in macrophages, concurrently induces phagosome-endosome fusion, and opens a novel pathway: studies of a pathogenic mycobacterium and a nonpathogenic yeast. J Exp Med. 174, 881-9. Haskell, R. E., et al., 2003. Viral-mediated delivery of the late-infantile neuronal ceroid lipofuscinosis gene, TPP-I to the mouse central nervous system. Gene Ther. 10, 34-42. Heine, C., et al., 2004. Defective endoplasmic reticulum-resident membrane protein CLN6 affects lysosomal degradation of endocytosed arylsulfatase A. J Biol Chem. 279, 2234752. Heine, C., et al., 2007. Topology and endoplasmic reticulum retention signals of the lysosomal storage disease-related membrane protein CLN6. Mol Membr Biol. 24, 74-87. Held, P., Vishwanath, M., Monitoring viral infection of mammalian cells using digital fluorescence microscopy. In: B. Instruments, (Ed.), BioTek Instruments Application Guides, 2016. Holopainen, J. M., et al., 2001a. Elevated lysosomal pH in neuronal ceroid lipofuscinoses (NCLs). Eur J Biochem. 268, 5851-6. Holopainen, J. M., et al., 2001b. Elevated lysosomal pH in neuronal ceroid lipofuscinoses (NCLs). European Journal of Biochemistry. 268, 5851-5856. Hong, M., et al., 2015. Fibrates inhibit the apoptosis of Batten disease lymphoblast cells via autophagy recovery and regulation of mitochondrial membrane potential. In Vitro Cell Dev Biol Anim. Hughes, S. M., et al., 2014. Inhibition of storage pathology in prenatal CLN5-deficient sheep neural cultures by lentiviral gene therapy. Neurobiology of Disease. 62, 543-550. Isosomppi, J., et al., 2002. Lysosomal localization of the neuronal ceroid lipofuscinosis CLN5 protein. Human Molecular Genetics. 11, 885-891. Ji, K., et al., 2013. Microglia actively regulate the number of functional synapses. PLoS One. 8, e56293. Jolly, R. D., et al., 2002. Neuronal ceroid-lipofuscinosis in Borderdale sheep. N Z Vet J. 50, 199202. Jolly, R. D., West, D. M., 1976. Blindness in South Hampshire sheep: a neuronal ceroidlipofuscinosis. N Z Vet J. 24, 123.

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Katz, M. L., et al., 2015. AAV gene transfer delays disease onset in a TPP1-deficient canine model of the late infantile form of Batten disease. Sci Transl Med. 7, 313ra180. Kielar, C., et al., 2009. Molecular correlates of axonal and synaptic pathology in mouse models of Batten disease. Hum Mol Genet. 18, 4066-80. Klionsky, D. J., et al., 2014. Autophagosomes, phagosomes, autolysosomes, phagolysosomes, autophagolysosomes... wait, I'm confused. Autophagy. 10, 549-51. Koike, M., et al., 2005. Participation of autophagy in storage of lysosomes in neurons from mouse models of neuronal ceroid-lipofuscinoses (Batten disease). Am J Pathol. 167, 1713-28. Kousi, M., et al., 2012. Update of the mutation spectrum and clinical correlations of over 360 mutations in eight genes that underlie the neuronal ceroid lipofuscinoses. Hum Mutat. 33, 4263. Kroemer, G., et al., 2005. Classification of cell death: recommendations of the Nomenclature Committee on Cell Death. Cell Death Differ. 12 Suppl 2, 1463-7. Lake, B. D., Cavanagh, N. P. C., 1978. Early-Juvenile Battens Disease - Recognizable Subgroup Distinct from Other Forms of Batten Disease - Analysis of 5 Patients. Journal of the Neurological Sciences. 36, 265-271. Levine, B., et al., 2015. Development of autophagy inducers in clinical medicine. Journal of Clinical Investigation. 125, 14-24. Linterman, K. S., et al., 2011. Lentiviral-mediated gene transfer to the sheep brain: implications for gene therapy in Batten disease. Hum Gene Ther. 22, 1011-20. Lizee, G., et al., 2003. Real-time quantitative reverse transcriptase-polymerase chain reaction as a method for determining lentiviral vector titers and measuring transgene expression. Hum Gene Ther. 14, 497-507. Malo, N., et al., 2006. Statistical practice in high-throughput screening data analysis. Nat Biotechnol. 24, 167-75. Mamo, A., et al., 2012. The Role of Ceroid Lipofuscinosis Neuronal Protein 5 (CLN5) in Endosomal Sorting. Molecular and Cellular Biology. 32, 1855-1866. Martini-Stoica, H., et al., 2016. The Autophagy-Lysosomal Pathway in Neurodegeneration: A TFEB Perspective. Trends Neurosci. 39, 221-34. Menzies, F. M., et al., 2015. Compromised autophagy and neurodegenerative diseases. Nature Reviews Neuroscience. 16, 345-357. Misinzo, G., et al., 2008. Inhibition of endosome-lysosome system acidification enhances porcine circovirus 2 infection of porcine epithelial cells. Journal of Virology. 82, 1128-1135. Mole, S. E., Cotman, S. L., 2015. Genetics of the neuronal ceroid lipofuscinoses (Batten disease). Biochim Biophys Acta. 1852, 2237-41. Mole, S. E., et al., 2004. CLN6, which is associated with a lysosomal storage disease, is an endoplasmic reticulum protein. Exp Cell Res. 298, 399-406. Neverman, N. J., et al., 2015. Experimental therapies in the neuronal ceroid lipofuscinoses. Biochim Biophys Acta. 1852, 2292-300. Ogata, M., et al., 2006. Autophagy is activated for cell survival after endoplasmic reticulum stress. Mol Cell Biol. 26, 9220-31. Oswald, M. J., et al., 2001. Changes in GABAergic neuron distribution in situ and in neuron cultures in ovine (OCL6) Batten disease. Eur J Paediatr Neurol. 5 Suppl A, 135-42. Pahan, K., 2006. Lipid-lowering drugs. Cell Mol Life Sci. 63, 1165-78.

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Palmer, David N., et al. "Ovine ceroid lipofuscinosis. The major lipopigment protein and the lipid-binding subunit of mitochondrial ATP synthase have the same NH2-terminal sequence." Journal of Biological Chemistry 264.10 (1989): 5736-5740. Palmer, D. N., et al., 2015. Recent studies of ovine neuronal ceroid lipofuscinoses from BARN, the Batten Animal Research Network. Biochim Biophys Acta. 1852, 2279-86. Palmieri, M., et al., 2011. Characterization of the CLEAR network reveals an integrated control of cellular clearance pathways. Hum Mol Genet. 20, 3852-66. Peng, S., et al., 2015. Suppression of agrin-22 production and synaptic dysfunction in Cln1 (-/-) mice. Ann Clin Transl Neurol. 2, 1085-104. Pfaffl, M. W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45. Pohl, S., et al., 2007. Increased expression of lysosomal acid phosphatase in CLN3-defective cells and mouse brain tissue. J Neurochem. 103, 2177-88. Polito, V. A., et al., 2014. Selective clearance of aberrant tau proteins and rescue of neurotoxicity by transcription factor EB. Embo Molecular Medicine. 6, 1142-1160. Ray, B., et al., 2014. Human primary mixed brain cultures: preparation, differentiation, characterization and application to neuroscience research. Mol Brain. 7, 63. Renna, M., et al., 2010. Chemical Inducers of Autophagy That Enhance the Clearance of Mutant Proteins in Neurodegenerative Diseases. Journal of Biological Chemistry. 285, 1106111067. Ricci, G., et al., 2009. Astrocyte-neuron interactions in neurological disorders. J Biol Phys. 35, 317-36. Rider, J. A., Rider, D. L., 1988. Batten disease: past, present, and future. Am J Med Genet Suppl. 5, 21-6. Sabharanjak, S., et al., 2002. GPI-anchored proteins are delivered to recycling endosomes via a distinct cdc42-regulated, clathrin-independent pinocytic pathway. Developmental Cell. 2, 411-423. Sardiello, M., Ballabio, A., 2009. Lysosomal enhancement: a CLEAR answer to cellular degradative needs. Cell Cycle. 8, 4021-2. Schoderboeck, L., et al., 2015. Chimeric rabies SADB19-VSVg-pseudotyped lentiviral vectors mediate long-range retrograde transduction from the mouse spinal cord. Gene Therapy. 22, 357-364. Settembre, C., et al., 2011. TFEB Links Autophagy to Lysosomal Biogenesis. Science. 332, 14291433. Soykan, T., et al., 2016. Modes and mechanisms of synaptic vesicle recycling. Curr Opin Neurobiol. 39, 17-23. Tammen, I., et al., 2006. A missense mutation (c.184C>T) in ovine CLN6 causes neuronal ceroid lipofuscinosis in Merino sheep whereas affected South Hampshire sheep have reduced levels of CLN6 mRNA. Biochim Biophys Acta. 1762, 898-905. Thelen, M., et al., 2012. Disruption of the Autophagy-Lysosome Pathway Is Involved in Neuropathology of the nclf Mouse Model of Neuronal Ceroid Lipofuscinosis. Plos One. 7. Tung, Y. T., et al., 2012. Autophagy: a double-edged sword in Alzheimer's disease. J Biosci. 37, 15765.

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Vidal-Donet, J. M., et al., 2013. Alterations in ROS activity and lysosomal pH account for distinct patterns of macroautophagy in LINCL and JNCL fibroblasts. PLoS One. 8, e55526. Von Schantz, C., et al., 2008. Brain gene expression profiles of Cln1 and Cln5 deficient mice unravels common molecular pathways underlying neuronal degeneration in NCL diseases. BMC Genomics. 9, 146. Worgall, S., et al., 2008. Treatment of late infantile neuronal ceroid lipofuscinosis by CNS administration of a serotype 2 adeno-associated virus expressing CLN2 cDNA. Hum Gene Ther. 19, 463-74. Xu, W., et al., 2016. Amyloid precursor protein-mediated endocytic pathway disruption induces axonal dysfunction and neurodegeneration. J Clin Invest. Zeman, W., 1969. What Is Amaurotic Idiocy. Lipids. 4, 76-7. Zhang, J. H., et al., 1999. A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J Biomol Screen. 4, 67-73. Zufferey, R., et al., 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nature Biotechnology. 15, 871-875

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Figure 4

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Figure 5

ACCEPTED MANUSCRIPT Highlights:

Neural cultures from CLN5 and CLN6 Batten disease display characteristic pathologies.

T

High throughput screening assays can be used to determine efficacy of therapeutics.

CR

IP

Lentiviral CLN5 or CLN6 expression corrects lysosomal and endocytic defects in vitro.

AC

CE

PT

ED

M

AN

US

Fibrates correct defects in CLN6 neural cultures.