Characterisation of Shiga toxin-producing Escherichia coli (STEC) isolated from seafood and beef

FEMS Microbiology Letters 233 (2004) 173–178 www.fems-microbiology.org

Characterisation of Shiga toxin-producing Escherichia coli (STEC) isolated from seafood and beef H.S. Kumar a

a,b

, Indrani Karunasagar a, I. Karunasagar a,*, Tsukamoto Teizou c, Kensuke Shima b, Shinji Yamasaki b

Department of Fishery Microbiology, University of Agricultural Sciences, College of Fisheries, Mangalore 575 002, India b Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Japan c Osaka Prefectural Public health Institute, Japan Received 1 August 2003; received in revised form 17 October 2003; accepted 9 February 2004 First published online 25 February 2004

Abstract Shiga toxin-producing Escherichia coli (STEC) strains isolated in Mangalore, India, were characterised by bead-enzyme-linked immunosorbent assay (bead-ELISA), Vero cell cytotoxicity assay, PCR and colony hybridisation for the detection of stx1 and stx2 genes. Four strains from seafood, six from beef and one from a clinical case of bloody diarrhoea were positive for Shiga toxins Stx1 and Stx2 and also for stx1 and stx2 genes. The seafood isolates produced either Stx2 alone or both Stx1 and Stx2, while the beef isolates produced Stx1 alone. The stx1 gene of all the beef STEC was found to be of recently reported stx1 c type. All STEC strains and one non-STEC strain isolated from clam harboured EHEC-hlyA. Interestingly, though all STEC strains were negative for eae gene, two STEC strains isolated from seafood and one from a patient with bloody diarrhoea possessed STEC autoagglutinating adhesion (saa) gene, recently identified as a gene encoding a novel autoagglutinating adhesion. Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: STEC; Bead ELISA; Colony hybridization; stx1c

1. Introduction Shiga toxin-producing Escherichia coli (STEC) are considered a major cause of gastrointestinal disease in developed countries [1,2]. The nature of illness can range from mild form of diarrhea to more severe forms known as hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS). Contaminated food and water are major sources of STEC infections [3]. The food types most commonly associated with outbreaks of food poisoning are of bovine origin, in particular minced beef and beef burgers [4,5] and unpasteurised milk [6]. Most of the outbreaks previously reported, where food is thought to be the source of infection, have been associated with the consumption of beef [7–12]. However, it has been in*

Corresponding author. Tel./fax: +91-824-246384. E-mail addresses: [email protected], karuna8sagar@ yahoo.com (I. Karunasagar).

creasingly recognized that fresh vegetables and fruits other than beef or beef-product can be the sources of STEC infection [13,14]. Though the serotype O157:H7 is predominantly associated with human infections in US, UK, Canada and Japan, many other serotypes are prevalent in other part of the world and known to cause diseases similar in severity to that caused by O157:H7. Several recent outbreaks have been attributed to nonO157 STEC [15]. Non-O157 STEC is more often isolated from foods and animal feces [5,15–17]. However, not all STEC serotypes have been reported to be associated with severe human disease. Of several virulence determinants reported to have been associated with STEC, the production of one or more Shiga toxins is considered to be most important [18]. Shiga toxins are of two types, Stx1 and Stx2 encoded by stx1 and stx2 genes, respectively. Variants of Stx2 have been reported which include Stx2c [19], Stx2d [20], Stx2e [21] and Stx2f [22]. Though originally

0378-1097/$22.00 Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsle.2004.02.008

174

H.S. Kumar et al. / FEMS Microbiology Letters 233 (2004) 173–178

believed to be a non-variant toxin, subtypes of Stx1 namely Stx1c and Stx1OX3 have recently been reported [23,24]. Other accessory virulence factors of STEC comprise production of a 94-kDa outer membrane protein called intimin, encoded by eae gene present on a 34-kb chromosomal pathogenecity island termed the locus for enterocyte effacement (LEE) [25] and an enterohemolysin (EHEC-hlyA) encoded by a large plasmid-borne ehxA gene [26,27]. In addition, a novel autoagglutinating adhesin, designated Saa, encoded by the saa gene present on a megaplasmid has recently been found in a LEE-negative non-O157 STEC strain that was isolated from a patient of HUS [28]. To date, more than 200 serotypes of E. coli are known to produce Shiga toxin(s) [15]. However, it is not possible to categorize STEC as pathogenic or nonpathogenic by serotyping alone. Within STEC, serotypes with pathogenic potential and serotypes that have not been associated with human disease exist. Although, Stx is considered the primary virulence factor, a combination of virulence factors is required for full virulence [15,29,30]. Since there is a need to determine the clinical significance of STEC strains associated with foods, it is important to identify the various virulence determinants commonly reported in them. Here, we report the characterization of STEC strains isolated in Mangalore, India and the usefulness of a combination of methods that include bead-ELISA, Vero cell cytotoxicity assay, PCR and colony hybridisation in typing STEC strains from foods.

2. Materials and methods 2.1. Escherichia coli strains Escherichia coli strains used in this study were the representative serotypes isolated from seafood and beef

in Mangalore [31]. The clinical isolate (ONT:H21) used in this study was isolated from a patient with bloody diarrhea. Briefly, 25 g of the samples were enriched in 225 ml modified EC broth (mEC) containing 20 lg ml
1 of novobiocin. Following 6 h incubation, streaking was done on sorbitol MacConkey agar (SMAC) and both the sorbitol fermenting and non-fermenting colonies were selected for biochemical identification of E. coli. E. coli O145:H-isolated from diarrhoeal patient in 1985 in Japan was used as positive control for stx1 , stx2 , eae and ehxA genes. E. coli O91:H21 strain B2F1 was used as a positive control for saa gene. The test organisms were grown overnight in Luria Bertani (LB) broth in a shaker incubator at 37 °C. The standard E. coli strains carrying cloned stx1 and stx2 genes were grown in LB-medium supplemented with 50 lg ml
1 of ampicillin. 2.2. Polynucleotide probes and colony hybridization stx1 and stx2 -specific polynucleotide probes were prepared from a 0.9-kb HincII–HpaI fragment of stx1 gene [32] and a 0.86-kb PstI–SmaI fragment of A subunit of stx2 gene [33]. These fragments were labeled with [a-32 P]dCTP by random primed labeling method (Amersham). The colony hybridization test was performed as described previously [34]. 2.3. PCR PCR was performed for stx1 , stx2 , eae, saa and ehxA, the virulence genes commonly associated with STEC. The sequences of the primers used for PCR are given in Table 1. An overnight culture diluted 1:10 in TE (10 mM Tris–HCl, pH 8.0, 1 mM EDTA) was boiled for 10 min and a 5-ll portion was used as template for PCR in a 50ll reaction mix containing a 10 PCR buffer, 200 lM concentration of deoxynucleotide triphosphates, 1 lM concentration of each primer, and 2.5 U of Taq

Table 1 PCR primers used in this study Primer

Sequence (50 –30 )

Target

Lin-F Lin-R VTcom-u VTcom-d VT1-u VT1-d VT2-u VT2-d Stx1c-1 Stx1c-2 EhxA-u EhxA-d Eae-u Eae-d SAA-u SAA-d

gaacgaaataatttatatgt tactgacattgttagttt gagcgaaataatttatatgtg tgatgatggcaattcagtat caacactggatgatctcag ccccctcaactgctaata atcagtcgtcacactggt ctgctgtcacagtgacaaa ttttcacatgttacctttcct catagaaggaaactcattagg ggtgcagcagaaaaagttgtag tctcgcctgatagtgtttggta aaacaggtgaaactgttgcc ctctgcagattaacctctgc cgtgatgaacaggctattgc atggacatgcctgtggcaac

stx1 and stx2

900

[35]

stx1 and stx2

518

[36]

stx1 family

349

[37]

stx2 family

110

[37]

stx1c

498

[38]

ehxA

1551

[39]

eae

350

[39]

saa

119

[48]

Product size (bp)

Reference

H.S. Kumar et al. / FEMS Microbiology Letters 233 (2004) 173–178

polymerase (Takara, Kyoto, Japan). PCR conditions used for stx-common [35,36], stx1 , stx2 [37], stx1c [38], eae [39] and ehxA [39] were essentially the same as described previously. The stx1 and stx2 primers were used in a single PCR assay. For saa, the conditions for PCR consisted of an initial 94 °C denaturation step for 5 min followed by 30 cycles of 94 °C for 10 s, 58 °C for 30 s and 72 °C for 30 s and a final delay of 5 min at 72 °C. PCR was carried out in a PTC 100 Thermocycler (M.J Research, MA, USA). The amplified products of PCR were electrophoresed on a 2% agarose gel, stained with ethidium bromide (0.5 lg ml
1 ) and photographed using Bio-Rad 2000 gel imaging system. 2.4. Bead-ELISA The production of Stx1 and Stx2 by the strains was tested by bead-ELISA. Polyclonal antibodies raised in rabbits against purified Stx1 and Stx2 were used for coating the solid phase beads. The antigen–antibody complex was detected using a Fab’-horse radish peroxidase conjugated second antibody as described previously [36]. 2.5. Vero cytotoxicity assay The biological activity of the toxins was tested on Vero cell line as previously described [40]. 2.6. Serotyping The serotyping was performed by slide agglutination with antisera against O1–O173 and H1–H56 prepared at the Osaka Prefecture Public Health Institute, Osaka, Japan followed as originally described [41].

175

3. Results and discussion Of the E. coli strains isolated from seafood, beef and a clinical sample included in this study, 11 were found to be producing either or both of Stx1 and Stx2 by bead ELISA. Among these, four isolates were from seafood, six from beef and one from a clinical case of bloody diarrhoea. All the Stx positive strains exhibited cytotoxicity to Vero cells. No strain was negative by bead ELISA and positive by Vero cell assay and vice versa thus exhibiting a 100% correlation between the two assays. The results of stx PCR correlated well with bead ELISA and Vero cell assay in the case of seafood and clinical isolates (Table 2). The primers common to stx1 and stx2 amplified the genes in four seafood isolates and one clinical isolate that were also positive by one or both of individual primers for stx1 and stx2 . Two seafood isolates produced both the Shiga toxins and were also positive by stx1 and stx2 PCR. Similarly the only clinical isolate which produced Stx1 and Stx2 detected by bead ELISA was also positive by stx1 and stx2 PCR. However, differences were noticed in the PCR results of beef isolates. Six strains isolated from beef produced stx1 when tested by bead-ELISA and were also cytotoxic to Vero cells. In all these strains, the common primers to stx1 and stx2 genes [36] could not amplify the stx genes. Interestingly, four strains were positive for stx1 when tested by stx1 -specific primer set [37], while 2 were negative by both stx common and stx1 primer sets but still produced Stx1 that was detected by bead-ELISA and cytotoxicity to Vero cells. The beef isolates of STEC were further characterised using stx common primers previously described by Lin et al. [35] and stx1c primers [38]. All the beef isolates were positive by Lin common primers and also by stx1c gene specific primers indicating that the stx1

Table 2 Results of PCR, colony hybridization and bead ELISA Strain

Serotype

Source

PCR/hybridization stx1

stx1c

stx2

ehxA

eae

saa

Stx1 (S/L)

Stx2 (S/L)

A3 A4 A5 A6 A7 B2 B3 B4 B5 B6 B7 S3

ONT:NM ONT:H7 O76:H21 O76:H21 ONT:NM O110:NM O110:NM O110:NM O110:NM O110:NM O110:NM ONT:H21

Clam Clam Clam Fish Fish Beef Beef Beef Beef Beef Beef Clinical

) ) +/+ +/+ ) +/+a +/+a +/+a +/+a +/+a )/+a +/+

) ) ) ) ) + + + + + + )

+/+ ) +/+ +/+ +/+ ) ) ) ) ) ) +/+

+ + + + + + + + + + + +

) ) ) ) ) ) ) ) ) ) ) )

) ) + + ) ) ) ) ) ) ) +

)/) )/) +/+ +/+ )/) +/+ +/+ +/+ +/+ +/+ +/+ +/+

+/+ )/) +/+ +/+ +/+ )/) )/) )/) )/) )/) )/) +/+

S ¼ culture supernatant; L ¼ cells lysed by sonication. All the strains were positive by stx common primers [35]. a Indicates weak reaction.

Bead ELISA

176

H.S. Kumar et al. / FEMS Microbiology Letters 233 (2004) 173–178

gene of these strains was an stx1c variant. In probe hybridisation assay, all the seafood isolates that were positive by PCR for either or both of stx genes were also positive with the corresponding polynucleotide probes for stx genes. No strain was positive by probe hybridization and negative by PCR and vice versa. The clinical isolate was stx1 and stx2 probe positive. All the six beef isolates producing Stx1 showed faint probe hybridization signal with stx1 probe. None of the isolates possessed the eae gene. However, two strains of stx1 and stx2 -positive E. coli O76:H21 isolated from seafood and one stx1 and stx2 -positive E. coli ONT:H21 isolated from the bloody stool of a diarrhoeal patient possessed saa gene. All STEC strains were positive by PCR for ehxA gene. The eae gene has been thought to be an important virulence factor in STEC. However, some severe cases of STEC infection recorded sporadically or in outbreaks have been caused by LEE-negative strains [42,43]. Paton et al. [28] reported the saa gene encoding a novel outer membrane protein, which appears to be an autoagglutinating adhesin on the large plasmid of certain strain of LEE-negative but not LEE-positive STEC strains. In this study, saa gene was detected in STEC strains isolated from a patient with severe bloody diarrhea and also from seafood. Interesting differences were also observed between seafood isolates and beef isolates. Seafood isolates were positive for either stx2 alone or for both stx1 and stx2 . No isolate was positive for only stx1 and none was stx1c type. The beef isolates on the other hand were positive only for stx1 variant gene, stx1c . The detection of STEC in seafood is of particular importance as this reflects secondary contamination. All the isolates from beef were positive for stx1 supporting previous hypothesis that bovine isolates are predominantly stx1 positive. In general, cattle are considered reservoirs of STEC [44]. A few studies in India too suggest the bovine reservoir for STEC [39,45]. The isolation of non-O157 STEC strains from patients has also been reported from India [39,46]. Prevalence of STEC O157:H7 in beef imported to Malaysia from India has been previously reported [11]. The present study strengthens the earlier observations that STEC strains are widely prevalent in meat of animal origin, especially in beef in India. We previously reported [31] the detection of stx genes in supernatants of beef enrichments by direct PCR using the common primers described by Karch and Mayer [47]. But the isolates obtained from PCR positive samples were found to be negative when tested by the same primers. The same strains were included in this study and were found to be negative by common primers [36] but four of them were positive by primers for stx1c gene. This is the first report of stx1c gene in STEC strains from India. Though toxin assays such as the highly sensitive beadELISA and the Vero cell cytotoxicity assay help to

identify strains possessing stx gene variants, such tests can be performed only in specialized laboratories and it is time consuming to perform the assays described in this study when large number of strains have to be tested. The presence of saa gene in non-O157 LEEnegative STEC strains reported from India for the first time is in agreement with some earlier reports of non-O157 strains possessing the saa gene [28]. Further studies are required to confirm the significance of Saa in the severity of STEC infection.

Acknowledgements H.S.K. was a recipient of UNESCO fellowship for young scientist. The work in India on STEC was done under the Indo-German collaborative project.

References [1] Griffin, P.M. and Tauxe, R.V. (1991) The epidemiology of infections caused by Escherichia coli 157:H7, other enterohemorrhagic Escherichia coli and associated hemolytic uremic syndrome. Epidemiol. Rev. 13, 60–98. [2] Karmali, M.A. (1989) Infection by Verocytotoxin-producing Escherichia coli. Clin. Microbiol. Rev. 2, 15–38. [3] Griffin, P.M., Bell, B.P., Cieslak, P.R., Tuttle, J., Barrett, T.J., Doyle, M.P., McNamara, A.M., Shefer, A.M. and Wells, J.G. (1994) Large outbreak of Escherichia coli O157:H7 in the Western United States: the big picture. In: Recent Advances in Verotoxinproducing Escherichia coli infections (Karmali, M.A. and Goglio, A.G., Eds.), pp. 7–12. Elsevier Sciences, B.V., Amsterdam, The Netherlands. [4] Davis, M., Osaki, C., Gordon, D., Hinds, M.W., Mottram, K., Winegar, C., Anver, E.D., Tarr, P.I., Jardine, D., Goldoft, M., Bartleson, B., Lewis, J. and Kobayashi, J.M. (1993) Multistate outbreak of Escherichia coli O157:H7 infections from hamburgersWestern United States, 1992–93. JAMA 269, 2194– 2198. [5] Willshaw, C.A., Thirwell, J., Jones, A.P., Parry, S., Salmon, R. and Hickey, M. (1994) Verocytotoxin-producing Escherichia coli O157 in beef burgers linked to an outbreak of diarrhea, hemorrhagic colitis and hemolytic uremic syndrome in Britain. Lett. Appl. Microbiol. 19, 304–307. [6] Chapman, P.A. and Wright, D.J. (1993) Untreated milk as a source of Verotoxigenic Escherichia coli O157. Veterinary Record 133, 171–172. [7] Belongia, E.A., MacDonald, K.L., Parham, G.L., White, K.E., Korlath, Lobato, M.N., Strand, S.M., Casale, K.A. and Osterholm (1991) An outbreak of Escherichia coli O157:H7 colitis associated with consumption of precooked meat patties. J. Infect. Dis. 164, 338–343. [8] O’Brien, A.D., Melton, A.R., Schmitt, C.K., McKee, M.L. and Griffin, E. (1993) Profile of Escherichia coli O157:H7 pathogen responsible for hamburger-borne outbreak of hemorrhagic colitis and hemolytic uremic syndrome in Washington. J. Clin. Microbiol. 31, 2799–2801. [9] Ostroff, S.M., Griffin, P.M., Tauxe, R.V., Shipman, L.D., Greene, K.D., Wells, J.G., Lewis, J.H., Blake, P.A. and Kobayashi, J.M. (1990) A state-wide outbreak of Escherichia coli O157 infections in Washington State. Am. J. Epidemiol. 132, 239–247.

H.S. Kumar et al. / FEMS Microbiology Letters 233 (2004) 173–178 [10] Pai, C.H., Ahmed, N., Lior, H., Johnson, W.M., Sims, H.V. and Woods, D.E. (1988) Epidemiology of sporadic diarrhoea due to Verocytotoxin-producing Escherichia coli: a two year prospective study. J. Infect. Dis. 157, 1054–1057. [11] Radu, S., Mutalib, S.A., Rasul, G., Ahmed, Z., Morigaki, T., Asai, N., Kim, Y.B., Okuda, J. and Nishibuchi, M. (1998) Detection of Escherichia coli O157:H7 in beef marketed in Malaysia. Appl. Environ. Microbiol. 64, 1153–1156. [12] Riley, L.W., Remis, R.S., Helgerson, D., McGee, H.B., Wells, J.G., Davis, B.R., Helbert, R.J., Olcott, E.S., Johnson, L.M., Hargett, N.T., Blake, P.A. and Cohen, M.L. (1983) Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308, 681–685. [13] Besser, R., Lett, S., Weber, J., Doyle, M., Barrett, T., Wells, J. and Griffin, P. (1993) An outbreak of diarrhea and hemolytic uremic syndrome from Escherichia coli O157:H7 in fresh-pressed apple cider. JAMA. 269, 2217–2220. [14] Hilborn, E.D., Mermin, J.H., Mshar, P.A., Hadler, J.L., Voetsch, A., Wojtkunski, C., Swartz, M., Mshar, R., Lambert-Fair, M.A., Farrar, J.A., Glynn, M.K. and Slutsker, L. (1999) A multistate outbreak of Escherichia coli O157:H7 infections associated with consumption of mesclun lettuce. Arch. Intern Med. 159, 1758– 1764. [15] Johnson, R.P., Clarke, R.C., Wilson, J.B., Read, S.C., Rahn, K., Renwick, S.A., Sandhu, K.A., Alves, D.A., Karmali, M.A., Lior, H., McEwen, S.A., Spika, J.S. and Gyles, C.L. (1996) Growing concerns and recent outbreaks involving non-O157:H7 serotypes of Verotoxigenic Escherichia coli. J. Food. Prot. 59, 1112– 1122. [16] Montenegro, M.A., Bulte, M., Trumpf, T., Aleksic, S., Reuter, G., Bulling, E. and Helmuth, R. (1990) Detection and characterisation of fecal Verotoxin-producing Escherichia coli from healthy cattle. J. Clin. Microbiol. 28, 1417–1421. [17] Smith, H.R., Cheasty, T., Roberts, D., Thomas, A. and Rowe, B. (1991) Examination of retail chickens and sausages in Britain for Verocytotoxin-producing Escherichia coli. Appl. Environ. Microbiol. 57, 2091–2093. [18] Gyles, C.L. (1992) Escherichia coli cytotoxins and enterotoxins. Can. J. Microbiol. 38, 734–746. [19] Schmitt, C.K., McKee, M.L. and O’Brien, A.D. (1991) Two copies of Shiga-like toxin II-related genes common in enterohemorrhagic Escherichia coli strains are responsible for the antigenic heterogeneity of the O157:H- strain E2511. Infect. Immun. 59, 1065–1073. [20] Pierard, D., Muyldermans, G., Moriau, L., Stevens, D. and Lauwers, S. (1998) Identification of new Verocytotoxin type 2 variant B-subunit genes in human and animal Escherichia coli isolates. J. Clin. Microbiol. 36, 3317–3322. [21] Weinstein, D.L., Jackson, M.P., Samuel, J.E., Holmes, R.K. and O’Brien, A.D. (1988) Cloning and sequencing of a Shiga-like toxin type II variant from Escherichia coli strain responsible for edema disease of swine. J. Bacteriol. 170, 4223–4230. [22] Schmidt, H., Scheef, J., Morabito, S., Caprioli, A., Wieler, L.H. and Karch, H. (2000) A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl. Environ. Microbiol. 66, 1205–1208. [23] Paton, A.W., Paton, J.C., Goldwater, P.N., Heuzenroeder, M.W. and Manning, P.A. (1993) Sequence of a variant Shiga-like toxin type-I operon of Escherichia coli O111:H-. Gene 129, 87– 92. [24] Paton, A.W., Beutin, L. and Paton, J.C. (1995) Heterogeneity of the amino-acid sequences of Escherichia coli Shiga-like toxin typeI operons. Gene 153, 71–74. [25] McDaniel, T.K., Jarvis, K.G., Donnenberg, M.S. and Kaper, J.B. (1995) A genetic locus for enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA. 92, 1664–1668.

177

[26] Schmidt, H., Beutin, L. and Karch, H. (1995) Molecular analysis of plasmid-encoded hemolysin f Escherichia coli O157:H7 strain EDL 933. Infect. Immun. 63, 1055–1061. [27] Schmidt, H. and Karch, H. (1996) Enterohemolytic phenotypes and genotypes of Shiga toxin-producing Escherichia coli O111 strains from patients with diarrhea and hemoltyic uremic syndrome. J. Clin. Microbiol. 34, 2364–2367. [28] Paton, A.W., Srimanote, P., Woodrow, M.C. and Paton, J.C. (2001) Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 69, 6999–7009. [29] Beutin, L., Geier, D., Zimmermann, S. and Scheutz, F. (1993) Prevalence and some properties of Verotoxin (Shiga-like toxin)producing Escherichia coli in seven different species of healthy domestic animals. J. Clin. Microbiol. 31, 2483–2488. [30] Beutin, L., Geier, D., Zimmermann, S. and Karch, H. (1995) Virulence markers of Shiga like toxin-producing Escherichia coli strains originating from healthy domestic animals of different species. J. Clin. Microbiol. 33, 631–635. [31] Kumar, H.S., Otta, S.K., Karunasagar, I. and Karunasagar, I. (2001) Detection of Shiga-toxigenic Escherichia coli (STEC) in fresh seafood and meat marketed in Mangalore, India by PCR. Lett. Appl. Microbiol. 33, 334–338. [32] Kurazono, H., Sasakawa, C., Yoshikawa, M. and Takeda, Y. (1987) Cloning of a Verotoxin (VT1, Shiga-like toxin 1) gene from a VT1-converting phage isolated from Escherichia coli O157:H7. FEMS Microbiol. Lett. 44, 23–26. [33] Yutsudo, T., Kurazono, H., Sasakawa, C., Yoshikawa, M., Iwaya, M. and Takeda, Y. (1987) Cloning of a Verotoxin (VT2) gene from a VT-2 converting phage isolated from Escherichia coli O157:H7. FEMS Microbiol. Lett. 48, 273–276. [34] Lin, Z., Yamasaki, S., Kurazono, H., Ohmura, M., Karasawa, T., Inoue, T., Sakamoto, S., Suganami, T., Takeoka, T., Taniguchi, Y. and Takeda, Y. (1993) Cloning and sequencing of two new Verotoxin 2 variant genes of Escherichia coli isolated from human and bovine diarrhea. Microbiol. Immunol. 37, 451–459. [35] Lin, Z., Kurazono, H., Yamasaki, S. and Takeda, Y. (1993) Detection of various variant VT in Escherichia coli by PCR. Microbiol. Immunol. 37, 543–548. [36] Yamasaki, S., Lin, Z., Shirai, H., Terai, A., Oku, Y., Ito, H., Ohmura, M., Karasawa, T., Tsukamoto, T., Kurazono, H. and Takeda, Y. (1996) Typing of Verotoxins by DNA colony hybridisation with poly- and oligonucleotide probes, a beadenzyme-linked immunosorbent assay and polymerase chain reaction. Microbiol. Immunol. 40, 345–352. [37] Pal, A., Ghosh, S., Ramamurthy, T., Yamasaki, S., Tsukamoto, T., Bhattacharya, S.K., Nair, G.B. and Takeda, Y. (1999) Shiga toxin-producing Escherichia coli from healthy cattle in a semiurban community in Calcutta, India. Ind. J. Med. Res. 110, 83–85. [38] Zhang, W., Bielaszewska, M., Kuczius, T. and Karch, H. (2002) Identification, characterisation, and distribution of a Shiga toxin 1 gene variant (stx1c ) in Escherichia coli strains isolated from humans. J. Clin. Microbiol. 40, 1441–1446. [39] Khan, A.S., Yamasaki, S., Sato, T., Ramamurthy, T., Pal, A., Datta, S., Chowdhury, N.R., Das, S.C., Sikdar, A., Tsukamoto, T., Bhattacharya, S.K., Takeda, Y. and Nair, G.B. (2002) Prevalence and genetic profiling of virulence determinants of non-O157 Shiga toxin-producing Escherichia coli isolated from cattle, beef and humans, Calcutta, India. Emerg. Infect. Dis. 8, 54–62. [40] Noda, M., Yutsudo, T., Nakabayashi, N., Hirayama, T. and Takeda, Y. (1987) Purification and some properties of Shiga-like toxin from Escherichia coli O157:H7 that is immunologically identical to Shiga toxin. Microb. Pathogen. 2, 339–349. [41] Ewing, W.H. (1986) Edwards and Ewing’s identification of Enterobacteriaceae, fourth ed. Elsevier, New York.

178

H.S. Kumar et al. / FEMS Microbiology Letters 233 (2004) 173–178

[42] Paton, A.W. and Paton, J.C. (1998) Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 11, 450–479. [43] Paton, A.W., Woodrow, M.C., Doyle, R.M., Lanser, J.A. and Paton, J.C. (1999) Molecular characterisation of a Shiga toxigenic Escherichia coli O113:H21 strain lacking eae responsible for a cluster of cases of hemolytic uremic syndrome. J. Clin. Microbiol. 37, 3357–3361. [44] Fagan, P.K., Hornitzky, M., Bettelheim, K.A. and Djordjevic, S.P. (1999) Detection of Shiga-like toxin (stx1 and stx2 ), intimin (eae), and enterohemorrhagic Escherichia coli (EHEC) hemolysin (EHEC-hlyA) genes in animal feces by multiplex PCR. Appl. Environ. Microbiol. 65, 868–872.

[45] Bannerjee, R., Kapoor, K.N., Agarwal, R.K. and Ghatak, S. (2001) Verotoxin-producing Escherichia coli (VTEC) in foods of animal origin. J. Food. Sci. Technol. 38, 82–84. [46] Gupta, S., Soni, N.K., Kaur, P. and Sood, D.K. (1992) Verocytopathic activity of Escherichia coli O157 and other ‘O’ serogroups isolated from patients of diarrhea. Indian J. Med. Res. 95, 71–76. [47] Karch, H. and Mayer, T. (1989) Single primer pair for amplifying segments of distinct Shiga like toxin genes by polymerase chain reaction. J. Clin. Microbiol. 27, 2751–2757. [48] Paton, J.C. and Paton, A.W. (2002) Direct detection and charcterisation of Shiga toxigenic Escherichia coli by multiplex PCR for stx1 , stx2 , eae, ehxA and saa. J. Clin. Microbiol. 40, 271– 274.