Characterisation of the Cdc2-related kinase 2 gene from Plasmodium knowlesi and P. berghei1

Molecular and Biochemical Parasitology 95 (1998) 229 – 240

Characterisation of the Cdc2-related kinase 2 gene from Plasmodium knowlesi and P. berghei 1 Rinke Vinkenoog a, Ma´rcia Aparecida Speranc¸a a,b, Jai Ramesar a, Alan W. Thomas c, Hernando A. del Portillo b, Chris J. Janse a, Andrew P. Waters a,* a

Laboratory of Parasitology, Leiden Uni6ersity Medical Centre, Wassenaarseweg 62, 2333 AL Leiden, The Netherlands b Department of Parasitology, Instituto de Ciencias Biomedicas, Uni6ersity of Sao Paulo, Sao Paulo, Brazil c Biomedical Primate Research Centre, Department of Parasitology, Lange Kleiweg 157, 2288 GJ Rijswijk, The Netherlands Received 16 February 1998; received in revised form 7 July 1998; accepted 15 July 1998

Abstract The complete sequence of the cdc2-related kinase 2 (CRK2 ) gene from Plasmodium knowlesi and from P. berghei was determined. In both species, the CRK2 gene is closely linked to an elongation factor 1 a gene. The two CRK2 proteins are highly homologous to the P. falciparum PfPK5 protein. The CRK2 gene of both species is expressed at a low level during the asexual cell-cycle within the host erythrocytes. The P. berghei CRK2 mRNA is also present in gametocytes and in stages during development in the mosquito, suggesting a role of this protein in different parts of the life cycle. A conserved sequence located in the 5% untranslated region immediately upstream of the initiator ATG has the potential to form a stem-loop structure. Although the CRK2 protein possesses most of the domains that are conserved among cdc2-proteins, neither a recombinant P. knowlesi CRK2 protein nor a recombinant P. berghei protein was able to complement a yeast cdc28ts mutant. Furthermore and in contrast to the P. falciparum PfPK5 protein, a recombinant monomeric P. knowlesi CRK2 protein showed no kinase activity. © 1998 Elsevier Science B.V. All rights reserved. Keywords: Malaria; Cdc2; Cell cycle; Kinase

Abbre6iations: cdc, cell division cycle; cdk, cyclin-dependent kinase; CRK, cdc2-related kinase; PCR, polymerase chain reaction; hpi, hours post infection; SDS-PAGE, sodium dodecyl sulphate-polyacrylamide gel electrophoresis; Ni-NTA, Ninitrotriacetic acid. * Corresponding author. Tel: + 31 71 5276858; fax: + 31 71 5276850; e-mail: [email protected] 1 Note: Nucleotide sequence data reported in this paper are available in the EMBL, GenBank™ and DDJB databases under the accession numbers AJ224152 and AJ224155.

1. Introduction Malaria parasites display a unique and complex life cycle which takes place in two different hosts. They replicate in different stages of the life cycle: by mitotic cell division in four different stages and by a obligatory sexual reproduction process in the

0166-6851/98/$ - see front matter © 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 6 - 6 8 5 1 ( 9 8 ) 0 0 1 0 4 - 2

230

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

mosquito. In each of these five replicative stages, the unicellular parasites must undergo one or more rounds of cell cycle. The cell cycle in eukaryotes is a highly regulated process in which many (conserved) proteins are involved. Several aspects of the cell cycle of Plasmodium are significantly different from those of other eukaryotes. During mitosis for example, chromosome condensation proceeds in an aberrant manner [1] and the nuclear membrane remains intact [2]. In addition, nuclear replication and division is not always followed by cell division, which leads to the formation of a syncytial cell containing multiple nuclei. We have started to characterize genes in Plasmodium which code for proteins that are known to have an important role in eukaryotic cell cycle regulation. A central role in the cell cycle of eukaryotic organisms is performed by the p34cdc2 kinase [3,4], a serine/threonine kinase encoded by the gene named CDC28 in the budding yeast Saccharomyces cere6isiae [5] and cdc2 in the fission yeast Schizosaccharomyces pombe [6] and most other eukaryotes. In lower eukaryotes, the p34cdc2 protein is active at two points in the cell cycle: in late G2 at the onset of mitosis and in late G1 at the onset of the DNA-replication phase (S-phase) [7]. In vertebrates, the latter function is taken over by the related p33cdk2 protein, which is absent in lower eukaryotes [8,9]. The activity of the p34cdc2 protein itself is regulated post-translationally. Both the formation of a complex with a cyclin and diverse (de)phosphorylation events are the main processes controlling p34cdc2 kinase activity [10,11]. The central position in this conserved network of reactions has led to a high degree of conservation of the p34cdc2 protein sequence. In practice, many eukaryotic cdc2 -genes are characterised as such by their ability to functionally complement a cdc2 ts/CDC28 ts mutation in either budding or fission yeast [12 – 14]. In a number of eukaryotes, including some parasitic protozoa like Leishmania mexicana and Trypanosoma brucei [15,16] the presence of a family of cdc2 -homologous genes has been shown. The name CRK (cdc2 -related kinase) has been postulated for members of the cdc2 family. According to the definition of Mottram [16], any

gene showing a sequence homology of more than 40% at the protein level to p34cdc2 and including conserved domains such as the 16 amino acid PSTAIRE-domain can be called CRK. Some of these genes, like human cyclin-dependent kinase 2 (cdk2 ), have been shown to play a role in cell cycle regulation, but in other cases the function of the CRK genes is yet unclear. In the malaria parasite P. falciparum, a number of so-called CRK genes have been isolated [17,18]. One of these, the P. falciparum PfPK5 gene most probably plays a role in cell cycle regulation during S-phase [17,19,20]. The PfPK5 protein shows a high amount of homology to the p34cdc2 consensus sequence, but is mutated at three positions in the conserved PSTAIR box involved in cyclinbinding. In this article, we describe the isolation and characterisation of a gene highly homologous to the P. falciparum PfPK5 gene in the simian malaria species P. knowlesi as well as in the rodent malaria species P. berghei. We have named these genes cdc2-related kinase 2 (CRK2 ) [21]. 2. Materials and methods

2.1. Parasites The P. knowlesi line H clone A as described [22] was used. P. knowlesi stage-specific RNA was isolated from culture initiated by adding 0.1 volume mature schizonts isolated from rhesus monkeys to pre-warmed 37°C fresh, uninfected, leucocyte-free red blood cells at an haematocrit of 5% [23]. The P. berghei gametocyte producing HP-clone and the non-producer clone 233 of ANKA-strain and the non-producer clone 1 of the K173-strain, were used. Synchronisation of blood stage development and purification of the different developmental stages of P. berghei was performed as described before [24,25]. DNA and RNA from P. berghei and P. knowlesi was purified as described by [26] after separation of the infected red blood cells from contaminating leucocytes using Plasmodipur™-leucocytes filters [27]. The research protocol was approved by an independent animal care and use committee and performed according to the relevant Dutch European laws.

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

2.2. Isolation and sequencing of the CRK2 genes A partial Sau3A genomic library of P. knowlesi in phage EMBL4 (F. Perler, New England Biolabs, USA) was screened with a 1 kb internal PCR fragment of the PkCRK2 gene as a probe [21], referred to as probe Pk1. Five phage positive with Pk1 were amplified and phage DNA was isolated from plate lysates. After initial characterization, the insert of phage 25 was mapped and subcloned in the EcoRI-site of vector pBS-KS (Stratagene). Phage-based PCR fragments from of three other phage were amplified with P. knowlesi CRK2 oligonucleotide C6 (CGGGATCCCGGAAATACACTCATGAAGTCG) and phage EMBL4 specific oligonucleotides and directly cloned into the pGEM-T vector (Promega). A partial Sau3A genomic library of P. berghei in phage lambda zap-SK (Dr M. Ponzi, Istituto di Sanitate Superiore, Roma, Italy) was screened with a 1 kb internal PCR fragment of the P. berghei CRK2 gene as a probe [21], referred to as probe Pb1. From a positive phage, the internal pBS-SK vector plus insert was isolated by in vivo-excision. Sequences were obtained using the dideoxynucleotide chain-termination method using [35S]dATP and T7 DNA-polymerase. Both plasmid primers and internal primers based on sequence obtained by initial sequencing reactions were used.

2.3. Northern analysis Transcription of the CRK2 genes was studied by Northern analysis. Gels containing 15 mg of RNA per lane, were blotted on Hybond-N + filters and the blots were hybridised with probe Pk1 or Pb1. As a control for the amounts of RNA loaded, the P. berghei Northern blot was hybridised with oligonucleotide TM4, which specifically hybridises to ribosomal RNA (CATGAAGATATCGAGGCGGAG).

3. RT-PCR cDNA of P. berghei and P. knowlesi was made with oligo-dT plus a HindIII-linker (CG-

231

CAAGCTTTTTTTTTTTTTTTTT) from 5 mg DNase I treated total RNA obtained from trophozoites. In P. berghei, reverse PCR was performed with nested primers L49C (GCCATTAGAGAAATTAG) and C5 (GGAATTCCAACTTCATGAGTATAT/CCTTCG) (94 °C, 45%%; 44°C, 1%; 72°C, 1%30%%; 35× ). Amplified fragments were hybridized with internal oligonucleotide L51C (AGTTACAGCAAAATCGTT). For the polyadenylation site analyses, PCR was performed using oligonucleotide C4 (CGGGATCCCGAAGA/GTATACTCATGAAGTTG) and oligo-dT plus a HindIII-linker (94°C, 1%; 41°C, 1%; 72°C; 2%; 40× ). PCR fragments were cloned in the pGEM-T vector and sequenced. Reverse PCR experiments in P. knowlesi were performed using the oligonucleotides L27C (TTACAAA GCACAAAATAATTACGG) and L29C (CTTTGTGTGTATGACATCATAC) (94°C, 30%%; 55°C, 1%; 72°C, 1%30%%; 35× ). Amplified fragments were hybridized with probe Pk1.

3.1. Yeast complementation assays. Full length P. berghei CRK2 cDNA was obtained by PCR using oligonucleotides L124C (CGGGATCC ATGGAA/GAAATAT/ CCATGGA/TTTA/GG and L206C (GCGGTCGACTTAATTAGTTTCTTTAAAATACGG ). The obtained PCR fragment was cut with BamHI and cloned in the BamHI site of vector pMR438 (kindly provided by Dr J. Colasanti, Cold Spring Harbor Laboratories, USA) to create construct pPbCRK2-yc. The P. knowlesi CRK2 gene cDNA was obtained by PCR using degenerate oligonucleotides L124C and L125C (GGGAAGCTTCC/TTTG/ AAAG/ATACGCATGC/TTC/GIAG; I, inosine). The obtained PCR-fragment was cloned into the E. coli expression vector pQE30 (Qiagen), creating plasmid pPkCRK2-2, excised from this vector by cutting with BamHI and HindIII and cloned directly into the BamHI/HindIII sites of yeast complementation vector pEMBLyex4 (kindly provided by Dr D. Williamson, NIMR, London, UK), creating vector pRV73. Cloning into the BamHI/SalI sites of vector pMR438 was done via

232

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

cloning into vector pBS-linker. Plasmid pBSlinker was made by cloning into the HindIII and SalI sites of pBS-KS an artificial sequence, obtained by melting together the two oligonucleotides L207A (AGCTTTAATTAGCTGAGTTTAG) and L208A (TCGACTAAACTCAGCTAATTAA), thus providing a stop codon in every frame between the HindIII and the SalI site. The P. knowlesi CRK2 cDNA was cloned BamHI/HindIII into pBS-linker, excised by digesting with BamHI and SalI and cloned in the BamHI/SalI sites of yeast expression vector pMR438, thereby creating vector pRV72. Both pEMBLyex4 and pMR438 have a URA3 gene as auxotrophic marker for selection in yeast and the BamHI site behind the GAL-promoter.The following CDC28 ts-Saccharomyces cere6isiae strains were used in complementation assays: cdc28 -1N (ura3, leu2, ade2) (kindly provided by Dr J. Colasanti) and cdc28 -4 (ura3) (kindly provided by Dr D. Williamson). Both strains were transformed by electroporation. Transformants were obtained by growth on media lacking uracil at 25°C. Transformant colonies were tested for ability to complement the cdc28 ts-mutation by restreaking them on plates containing 2% galactose as carbon source and growing at a temperature of 37°C. Complementation assays were performed both on selective galactose plates lacking uracil and on rich (YPD) plates containing galactose instead of glucose as a carbon source.

3.2. Kinase assays E. coli SG13009 and M15 containing plasmid pPkCRK2-2 were grown overnight in Luria Broth (LB) diluted 1:60 in 12.5 ml and grown at 37°C till OD600 0.7 – 0.9. IPTG was added in a final concentration of 2 mM, after which the culture was grown for an additional 5 h. Cells were harvested and resuspended in lysis buffer (50 mM Tris–HCl pH 7.4, 1 mM phenylmethylsulphonyl fluoride) and lysozyme was added in a final concentration of 1 mg ml − 1. After 10 min. on ice, NaCl was added in a final concentration of 300 mM. The cells were lysed by sonication (4×15 s), after which the suspension was spun at 12000×g for 15 min. at 4°C, transferred to a

clean tube, to which 50 ml 50% Ni-nitrotriacetic acid (Ni-NTA) bead slurry was added. The tube was then filled with coupling buffer (100 mM Tris–HCl pH 7.4, 300 mM NaCl) and incubated for 1 h at 4°C under gentle agitation. The suspension was centrifuged at 12000× g for 30 min. The pellet was washed twice with KAB (50 mM 3-[N-Morpholino]propanesulphonic acid, pH7.2, 20 mM MgCl2, 2 mM Dithiothreitol, 10 mM Ethylene Glycol-bis(b-aminoethylEther)). The Ni-NTA beads were then resuspended into 50 ml freshly prepared and prewarmed KAM (5 ml 10 mg ml − 1 Histone H1, 8 ml 100 mM ATP, 186 ml KAB, 1 ml 35S-g dATP 3000 Ci mmol − 1; 10 mCi ml − 1). After incubating at 30°C for 30 min, 50 ml 2× Laemmli SDS-PAGE loading buffer was added. The suspension was boiled for 5 min and 30 ml was loaded on an SDS-PAGE gel. Gels were run and exposed overnight against an autoradiogram. As positive control, human cdc2/cyclin A and cdk2/cyclin A complexes produced in baculovirus in Sf9 cells were used.

3.3. Antisera and expression of the recombinant CRK2 proteins in yeast Expression of vector pPkCRK2-2 was induced as described. After lysis of the cells by sonication, expressed proteins were purified over NiNTA columns as described and dialysed against PBS (0.058 M Na2HPO4, 0.017 M NaH2PO4, 0.068 M NaCl). Mice were immunized with the full length CRK2 protein according to the following scheme: day 1, 100 mg protein in PBS/ 50% Freund’s Complete Adjuvant; day 15, 100 mg protein in phosphate buffered saline (PBS)/ 50% Freund’s incomplete adjuvant; day 38, 175 mg protein in PBS; days 84 and 110, 100 mg protein in PBS; day 139, 150 mg protein in PBS. At day 159, the mice were bled by heart puncture. The blood samples were incubated at 37°C for 1 h and spun at 10000× g for 10 min to collect serum fractions which were frozen in aliquots at − 70°C. To check expression of the recombinant CRK2 proteins in yeast, S. cere6isiae cdc28 -4 was grown on galactose plates at 30°C. Yeast cells were isolated from the plate, washed in water, resus-

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

233

Fig. 1. Map of the P. knowlesi insert of phage 25 (a) and the P. berghei insert of plasmid pRVb63 (b). R, EcoRI; B, BamHI; H, HindIII; C, ClaI. Shaded boxes, coding sequences; open boxes, non-coding intervening sequences; black boxes, phage arm sequence. Arrows denote the orientation of the genes. Arrows under the enlarged CRK2 sequence depict the oligonucleotides described in the text.

pended in 1 volume of 2×sample buffer (10% glycerol, 2% SDS, 62 mM Tris, pH 6 · 8, 5% b-mercapto ethanol, bromophenol blue) and boiled for 5 min. Of the lysed yeast cell suspension, 10 ml were loaded on a 12% SDS-PAGE gel. After electrophoresis, the gel was electroblotted onto a nylon membrane that was then blocked with 5% bovine serum albumin in Tris-buffered saline with 0.05% (v/v) Tween-20 and incubated with the anti-CRK2 sera. As the second antiserum, rabbit anti-mouse IgG linked to hydrogen peroxidase was used.

4. Results

4.1. Isolation and sequence analysis of the CRK2 genes The entire P. knowlesi CRK2 gene was isolated from overlapping genomic DNA clones from the EMBL4 M phage library. A single clone containing the entire P. berghei CRK2 gene was isolated from the M-ZAP phage library (Fig. 1). The PkCRK2 and the PbCRK2 genes were completely

sequenced, including upstream and downstream regions. The open reading frames show a homology of 78.1% with each other and a homology of 77.8 and 81.6% with PfPK5, the putative cdc2 gene of P. falciparum [17]. The two genes contain four introns. We have previously shown the conserved position of the first three introns and their physical characterization [21]. The position of the fourth intron towards the 3% end of the gene is likewise conserved. The CRK2 genes encode proteins of 288 amino acids that show most hallmarks of a p34cdc2protein including all the characteristics of a serine/threonine kinase [28,29]. An exception is the conservative change of a glutamic acid for an aspartic acid at position 170 in kinase domain VII (Fig. 2). The Plasmodium CRK2 proteins are highly homologous with each other and are 54.9% (PkCRK2) and 53.5% (PbCRK2) homologous with the Schizosaccharomyces pombe p34cdc2protein. Conserved sequences involved in ATPbinding, ‘EKIGEGTYGVVYK’ (residues 8–20) and in cyclin-binding, the so-called PSTAIR-box [30] (residues 41–55) are present (Fig. 2). In both CRK2 proteins the PSTAIR-box differs from the

234

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

Fig. 2. Alignment of the protein sequence of the three Plasmodium CRK2 sequences, the S. pombe and mouse p34cdc2-proteins. Conserved domains discussed in the text are boxed. Residues which are known to be phosphorylated are shaded, the four tryptophan residues conserved in p34cdc2 are indicated by a large asterisk over the sequence. Triangles denote the position of the four introns in the Plasmodium CRK2 genes. Perfectly conserved residues are indicated by an asterisk under the sequence; conservatively substituted residues by a dot under the sequence.

consensus sequence by two conservative exchanges: an isoleucine for a valine at residue 43 and an isoleucine for a leucine at residue 53. As previously reported, P. falciparum PfPK5 has a third, non-conservative mutation: Thr47Ala [17]. Strikingly, this mutation which is located at the

exact splicing site for intron 1, is only present in P. falciparum. The PSTAIR-boxes from a range of other Plasmodium species (P. yoelii, P. 6inckei, P. chabaudi, P. 6i6ax) are identical to those of P. knowlesi and P. berghei [21]. Of the four tryptophan-residues found to be conserved in p34cdc2

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

235

Fig. 3. Conserved sequences in the 5% non coding region of the CRK2 gene of P. knowlesi, P. 6i6ax, P. berghei and P. falciparum. Dashes indicate identical residues; nd; sequences not determined. Sequences depicted in large capitals are part of a putative stem-loop structure. Sequences involved in the formation of a putative pseudoknot are boxed.

proteins, Trp 241 is replaced by a tyrosine. The generally conserved ‘GDSEID’ box (residues 203-208), is altered in all three Plasmodium species (Fig. 2). The Plasmodium CRK2 proteins contain all four residues which are known to be phosphorylated in p34cdc2 proteins: Tyr 15 and Thr 14, 158, and 274 (Fig. 2). This indicates that the Plasmodium CRK2 proteins may well be post-translationally modified by phosphorylation in a similar way as other p34cdc2 proteins. To localise the site of addition of the poly-A tail, P. berghei cDNA was amplified using oligo dT and internal CRK2 oligo C4. The PCR products were cloned and three transformants positive to hybridization with a 3% PbCRK2 probe were sequenced. All three have the poly-A tail attached at a different position. The last non-A nucleotide before the poly-A attachment was respectively at position 188, 214, and 233 bp downstream of the TAA-stop codon. By analyzing the upstream regions of the CRK2 genes, we found that in both species the CRK2 gene is linked to an Elongation factor 1a (EF-1a) gene. In P. knowlesi, we have been able to show the presence of two copies of the EF1a gene linked to the CRK2 gene [41]. The intergenic region between the EF-1a gene and the CRK2 gene is 638 bp long in P. berghei and 999 bp in P. knowlesi. When comparing the sequence of the intergenic regions of P. knowlesi, P. berghei, P. falciparum, and the 250 bp immediately upstream of the P. 6i6ax CRK2 gene, several well conserved boxes were detected in the 100 bp directly upstream of the CRK2 / PfPK5 genes. In all species, the spacing of these boxes was also conserved (Fig. 3). The fact that they are highly similar in four different species suggests this conservation is functional. Interest-

ingly, one of these sequences has the possibility to form a stem-loop structure just upstream of the ATG start codon which is conserved in P. berghei, P. falciparum, and P. 6i6ax and to a lesser extent in P. knowlesi (data not shown). Further upstream, P. knowlesi, P. berghei, and P. falciparum share a common putative TATA box embedded in the sequence ‘TATAAGC’ (Fig. 3).

4.2. Expression of the CRK2 genes By Northern analysis, a 1.5 kb mRNA species was detected in most asexual bloodstages of P. berghei and in (mature) gametocytes. In ringforms, the message is not detectable. The abundance of CRK2 message is low in all stages. The northern results were confirmed by reverse PCR analysis. The message was also present in 6 days old oocysts. In addition to the cDNA bands, in the asexual and gametocyte lanes a larger PCRfragment is visible, which may represent imperfectly spliced transcripts that have been found in a similar analysis of the P. knowlesi bloodstage CRK2 transcripts (data not shown). In the asynchronous RNA lane, a band of the size of the genomic DNA fragment is also present. We have not analyzed these extra bands. In both northern and rPCR analysis, the non-gametocyte producer clones 233 and K173 of P. berghei also showed transcription during the asexual cycle (Fig. 4 and data not shown), suggesting that the CRK2 gene is not only involved in the sexual cycle of the parasite. Northern analysis of P. knowlesi total RNA demonstrated a 1.5 kb mRNA species in all asexual bloodstage forms (data not shown).

236

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

4.3. Kinase acti6ity of the PkCRK2 protein To test whether the recombinant PkCRK2 protein has kinase activity without being bound to a cyclin, the protein was expressed in M15 and SG13009 bacterial cells, isolated under non-denaturing conditions and purified by incubation with Ni-NTA beads. After purification, on SDS-PAGE gel a clear band of 934 kDa was visible, indicating the presence of the recombinant protein. After

Fig. 4. Expression of the P. berghei CRK2 gene. (a) Upper panel, stage specific P. berghei northern blot probed with PbCRK2 (exp. 14 days). Lower panel, same blot probed with ssrRNA specific oligonucleotide TM4 (overnight exposure). (b) Reverse PCR on stage specific cDNA from P. berghei strains HP, c233 and K173 using nested PbCRK2 oligonucleotides L49C and C5 (gDNA: 651 bp; cDNA: 347 bp). Southern blot hybridised with internal PbCRK2 oligonucleotide L51C. Lane −, negative control (H2O); + , positive control (P. berghei genomic DNA); 5 hpi, ring stage; 14 hpi, trophozoites; 19 hpi, old trophozoites; 21 hpi, dividing schizonts; 23 hpi, mature schizonts.

incubation of PkCRK2 with histone H1 and 35S dATP, no radioactive signal could be detected. In the positive control lanes, already after a short exposure an intense signal at the histone H1 level could be seen (data not shown).

4.4. Complementation in yeast mutants S. cere6isiae strains cdc28 -4 and cdc28 -1N were transformed with the yeast vectors pEMBLyex4 and pMR438 and with the P. berghei CRK2-expression construct pPbCRK2-yc and the P. knowlesi CRK2-expression constructs pRV72 and pRV73. As a positive control, both strains were transformed with pLM1-3 (pMR438+the Zea mays cdc2 -cDNA). In all transformation experiments, after selection on uracil-lacking plates, a number of transformants were obtained. All transformants grew at 30°C on plates containing galactose as C-source. When shifted to 37°C, the cdc28 -1N and the cdc28 -4 strain transformed with the positive control plasmid LM1-3 were able to grow on galactose- but not on glucose-plates. All other constructs failed to restore growth at 37°C. Also at a lower (but still restrictive) temperature, the P. berghei and P. knowlesi constructs were not able to rescue the cdc28 -mutant yeast strains. To confirm that the recombinant Plasmodium CRK2 proteins were expressed in yeast, we isolated transformed yeast cells and incubated with antisera directed against P. knowlesi CRK2. In the yeast cell extracts containing either the P. knowlesi or the P. berghei recombinant CRK2 construct a clear band of 34 kDa is present, which is absent when those extracts are incubated with the pre-immune sera (Fig. 5).

5. Discussion We have identified in two malaria species, P. berghei and P. knowlesi, a gene encoding a cdc2 related kinase, that we have previously designated CRK2 [21]. The protein sequences fits, with a few exceptions, well into the consensus of p34cdc2 proteins. The two proteins PbCRK2 and PkCRK2 and their homologue of P. falciparum, PfPK5 [17], however are not able to complement

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

Fig. 5. Western blot containing S. cere6isiae cdc28-4 extracts expressing P. berghei (a) or P. knowlesi CRK2 (b). (a) Lanes 1 and 4, cdc28-4 transformed with pPbCRK2-yc; lanes 2 and 5, cdc28-4 transformed with expression vector pMR438; lanes 3 and 6, cdc28-4. (B) Lanes two, three, five, and six identical to (a); lanes 1 and 4, cdc28-4 transformed with pRV72. Lanes four to six incubated with anti-CRK2 sera; lanes 1–3 incubated with the pre-immune sera.

a yeast cdc2 /CDC28 ts mutant. The Plasmodium CRK2 proteins do possess the conserved PSTAIR-box, which is thought to be involved in cyclin binding. Compared with yeast and most other eukaryotic p34cdc2 proteins, the PSTAIRbox of PkCRK2 and PbCRK2 has two (conservative) mutations. The same PSTAIR-box is found in at least four other Plasmodium species. Strikingly, P. falciparum is the only species containing a third, non-conservative mutation in the PSTAIR-box of unknown significance. Although the PSTAIR-box is highly conserved in known p34cdc2 proteins, a consensus PSTAIR-box is not an absolute prerequisite for yeast complementation. The Dictyostelium discoideum cdc2 gene which also has its PSTAIR-box altered at two (different) sites, is still able to complement yeast, albeit with a lower efficiency [31]. The presence of a PSTAIR-box in CRK2 suggests that the Plasmodium CRK2 proteins will probably bind cyclins. Another conserved sequence in p34cdc2 is the sequence DSEI in the so-called GDSEID-box.

237

This sequence is important in regulation of phosphorylation of Thr 166 by the Cdc2-activating kinase CAK [32,33]. In all four Plasmodium CRK2 proteins sequenced thus far, this box is mutated at the second and the fifth position. Strikingly, the aberrations from the consensus within this box are not conserved within the genus Plasmodium indicating that in Plasmodium these residues are apparently inessential for a functional GDSEID box in the parasite itself. We have not been able to show kinase activity of the recombinant P. knowlesi CRK2 protein in E. coli. Since the vast majority of p34cdc2 proteins are only active as a kinase when bound to a cyclin and activated by phosphorylation, this result was not immediately surprising. However, Graeser et al. [19] have shown that recombinant PfPK5 is able to phosphorylate histone H1. There are indications that phosphorylation upon residue 160 in the PfPK5 protein stimulates PfPK5 kinase activity. This suggests that the Plasmodium CRK2/ PfPK5 proteins, which all contain Thr 160 in a conserved setting, may well be regulated by reversible phosphorylation on this residue as in other known p34cdc2 proteins. If in Plasmodium this phosphorylation is under control of the GDSEID box, the difference in sequence in the GDSEID boxes of P. falciparum (GVSEAD) and P. knowlesi (GVSETD) might be responsible for the absence of kinase activity of the recombinant PkCRK2 protein. Whether or not the altered GDSEID box is partly responsible with the failure to complement yeast is unclear. The previously mentioned complementing cdc2 protein of D. discoideum also has an altered sequence (GDCEID) while the non-complementing Drosophila melanogaster DmCdc2c and the Oryza sati6a cdc2Os-2 proteins have a perfect GDSEID-box and show an overall higher homology to the yeast p34cdc2 sequence than the Plasmodium CRK2 proteins. The CRK2 genes are expressed at the mRNA level throughout most of complete erythrocytic cycle. In P. berghei, we show that the message is also present in exflagellated gametocytes and in oocysts. This observed expression pattern does not exclude a putative function of the CRK2 gene in cell cycle regulation in the different replicative stages of the life cycle.

238

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

Are the CRK2 genes the functional homologues of cdc2 in Plasmodium or not? Based on expression pattern, kinase activity and inhibition studies Graeser et al. [19] suggest that PfPK5 activity is necessary to activate or maintain the Plasmodium S-phase, which is one of the functions of p34cdc2 in lower eukaryotes [20]. Over the last few years, in a growing number of parasitic protozoa cdc2related kinase genes have been found. In some taxa, a family of CRK2 genes was found to be present: Trypanosoma sp. [34], Crithidia fasciculata [35] and Plasmodium sp. [17,18,36]. While some members of these families are only distant relatives of cdc2, others do show a high amount of homology with the cdc2 consensus sequence. However, none of these genes fits perfectly into the p34cdc2 consensus; for instance, they all have a PSTAIR-box mutated in at least one site. Not one of them has the ability to complement a yeast cdc2 ts mutant. It is unlikely that in any of these species a ‘perfect’, yeast-complementing cdc2 gene is present. For instance in the genus Plasmodium several species have been screened by PCR and hybridisation using cdc2 -specific oligos and DNAsequences by different groups [17,18,21,40], but genes more homologous to cdc2 than the CRK2 / PfPK5 genes have yet to be found. It seems more likely that in the parasitic protozoa, which are evolutionary distant from both yeast and higher eukaryotes, the cdc2 -gene has evolved in such a way that functional complementation in yeast has become impossible. Nevertheless the cell cycle regulation in protozoa can still be performed in a similar way to other eukaryotes. As the EF-1a and the CRK2 are closely linked and transcribed in the same direction, it is likely that most, if not all, of the information necessary for initiation of transcription of the CRK2 gene will be present in the short intergenic region. To our knowledge, the intergenic region between the EF-1a gene and the CRK2 gene in P. berghei which is only 638 bp long is the shortest non-coding upstream region known in Plasmodium sp. The most distal poly-A addition site of the P. berghei EF-1a gene is located at 292 bp downstream of the EF-1a stop codon [41]. This limits the size of the sequence where the elements of the P. berghei CRK2 promoter may be expected.

A putative stem-loop structure is present upstream of the ATG-start codon. The presence at a conserved locus in the 5% untranslated region of the CRK2 gene in four different Plasmodium species suggest a function for this stem-loop structure. To our knowledge, such a structure is absent from CRK2 genes in other organisms. Interestingly, a part of the sequence in this structure has the ability to bind to a sequence in the first two codons of the CRK2 gene and thus form a pseudoknot. Stem-loop structures and pseudoknots can play a role in stability and function of mRNA and rRNA [37,38] and in translational control [39]. Although in general pseudoknots are found in non-coding regions of RNAs, functional pseudoknots have also been reported in coding regions of mRNAs [40]. It will require functional analyses to determine whether or not these structures are involved in transcription regulation of the CRK2 gene. The limited length of the intergenic regions between EF-1a and CRK2 make the CRK2 promoters suitable objects of promoter studies in Plasmodium.

Acknowledgements We wish to thank Drs D. Williamson and J. Colasanti for the use of expression vectors and yeast strains, Dr P Keblusek for providing us with positive controls in the kinase experiments and Drs F. Perler and M. Ponzi for providing us with P. knowlesi and P. berghei phage libraries. This work received support from the Commission of the European Communities in the framework of the ‘Science and Technology for Development’ program (TS3*-CT920-0116) and in the framework of the INCO DC program (IC18-CT960052).

References [1] Sinden RE. Cell biology. In: Killick-Kendrick R, Peters WA, editors. Rodent Malaria. New York: Academic Press, 1972:85 – 186.

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240 [2] Aikawa M. Parasitological review: Plasmodium: the fine structure of malarial parasites. Exp Parasitol 1971;30:284 – 320. [3] Nurse P. Universal control mechanism regulating onset of M-phase. Nature 1990;344:503–7. [4] Draetta G. Cell cycle control in eukaryotes: molecular mechanisms of cdc2 activation. Trends Biochem Sci 1990;15:378 – 83. [5] Nasmyth KA, Reed SI. Isolation of genes by complementation in yeast: molecular cloning of a cell cycle gene. Proc Natl Acad Sci USA 1980;77:2119–23. [6] Beach D, Durkacz B, Nurse P. Functionally homologous cell cycle control genes in budding and fission yeast. Nature 1982;300:706–8. [7] Reed SI, Wittenberg C. Mitotic role for the CDC28 protein kinase of Saccharomyces cere6isiae. Proc Natl Acad Sci USA 1990;87:5697–701. [8] Elledge SJ, Spottswood MR. A new human p34 protein kinase, cdk2, identified by complementation of a cdc28 mutation in Saccharomyces cere6isiae, is a homolog of Xenopus Eg1. EMBO-J 1991;10:2653–9. [9] Fang F, Newport JW. Evidence that the G1-S and G2-M transitionsare controlled by different cdc2 proteins in higher eukaryotes. Cell 1991;66:731–42. [10] Murray AW, Kirschner MW. Cyclin synthesis drives the early embryonic cell cycle. Nature 1989;339:275–80. [11] Krek W, Nigg EA. Differential phosphorylation of vertebrate p34cdc2 kinase at the G1/S and G2/M transitions of the cell cycle: identification of major phosphorylation sites. EMBO J 1991;10:305–16. [12] Lee MG, Nurse P. Complementation used to clone a human homologue of the fission cell cycle control gene cdc2. Nature 1987;327:31–5. [13] Colasanti J, Tyers M, Sundaresan V. Isolation and characterization of cDNA clones encoding a functional p34cdc2 homologue from Zea mays. Proc Natl Acad Sci USA 1991;88:3377 –81. [14] Krek W, Nigg EA. Structure and developmental expression of the chicken cdc2 kinase. EMBO J 1989;8:3071–8. [15] Mottram JC, Kinnaird JH, Shiels BR, Tait A, Barry JD. A novel cdc2-related kinase from Leishmania mexicana, LmmCRK1, is post-translationally regulated during the life cycle. J Biol Chem 1993;268:21044–52. [16] Mottram JC. Cdc2-related protein kinases and cell cycle control in Trypanosomatids. Parasitol Today 1994;10:253 – 7. [17] Ross-MacDonald PB, Graeser R, Kappes B, Franklin R, Williamson D. Isolation and expression of a gene specifying a cdc2-like protein kinase from the human malaria parasite Plasmodium falciparum. Eur J Biochem 1994;220:693 – 701. [18] Doerig C, Doerig C, Horrocks P, Coyle J, Carlton J, Sultan A, Arnot D, Carter R. PfCRK1: a developmentally regulated cdc2-related protein kinase of Plasmodium falciparum. Mol Biochem Parasitol 1995;70:167–74. [19] Graeser R, Franklin RM, Kappes B. Mechanisms of activation of the cdc2-related kinase PfPK5 from Plas-

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34] [35]

239

modium falciparum. Mol Biochem Parasitol 1996;79:125 – 7. Graeser R, Wernli B, Franklin RM, Kappes B. Plasmodium falciparum protein kinase 5 and the malarial nuclear division cycles. Mol Biochem Parasitol 1996;82:37 – 49. Vinkenoog R, Veldhuisen B, Speranca MA, del Portillo HA, Janse CJ, Waters AP. Comparison of introns in a cdc2-homologous gene in a number of Plasmodium species. Mol Biochem Parasitol 1995;71:233 – 41. Edeson JFB, Davey DG. Isolation of a virulent strain of Plasmodium knowlesi Sinton and Mulligan 1932. Trans R Soc Trop Med Hyg 1953;47:259 – 60. Deans JA, Alderson T, Thomas AW, Mitchell GH, Lennox ES, Cohen S. Rat monoclonal antibodies which inhibit the in 6itro multiplication of Plasmodium knowlesi. Clin Exp Immunol 1982;49:297 – 309. Janse CJ, Mons B, Croon JJAB, van der Kaay HJ. Long-term in vitro cultures of P. berghei and preliminary observations on gametocytogenesis. Int J Parasitol 1984;14:317 – 20. Janse CJ, Mons B, Rouwenhorst RJ, van der Klooster PFJ, Overdulve JP, van der Kaay HJ. In vitro formation of ookinetes and functional maturity of P. berghei gametocytes. Parasitology 1985;91:19 – 29. Paton MG, Barker GC, Matsuoka H, et al. Structure and expression of a post-transcriptionally regulated malaria gene encoding a surface protein from the sexual stage of Plasmodium berghei. Mol Biochem Parasitol 1993;59:263 – 75. Janse CJ, Camargo A, del-Portillo HA, et al. Removal of leucocytes from Plasmodium 6i6ax-infected blood. Ann Trop Med Parasitol 1994;88:213 – 6. Hanks SK, Quinn AM, Hunter T. The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 1988;241:42 – 52. Hanks SK, Quinn AM. Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Methods Enzymol 1990;200:38 – 81. Jeffrey PD, Russo AA, Polyak K, et al. Mechanism of CDK activation revealed by the structure of a cyclin A-CDK2 complex. Nature 1995;376:313 – 20. Michaelis C, Weeks G. Isolation and characterization of a cdc2 cDNA from Dictyostelium discoideum. Biochim Biophys Acta 1992;1132:35 – 42. Ayscough K, Hayles J, MacNeill SA, Nurse P. Cold-sensitive mutants of p34cdc2 that supress a mitotic catastrophe phenotype in fission yeast. Mol Gen Genet 1992;232:344 – 50. Fleig UN, Gould KL, Nurse P. A dominant negative allele of p34cdc2 shows altered phosphoamino acid content and sequesters p56cdc13 cyclin. Mol Cell Biol 1992;12:2295 – 301. Mottram JC, Smith G. A family of trypanosome cdc2-related protein kinases. Gene 1995;162:147 – 52. Brown L, Hines JC, Ray DS. The Crithidia fasciculata CRK gene encodes a novel cdc2-related protein contain-

240

R. Vinkenoog et al. / Molecular and Biochemical Parasitology 95 (1998) 229–240

ing large inserts between highly conserved domains. Nucl Acids Res 1992;20:5451–6. [36] Doerig C. Plasmodium cdc2-related kinases: do they regulate stage differentiation? Reply. Parasitol Today 1997;13:38 – 9. [37] Goguel V, Wang Y, Rosbash M. Short artificial hairpins sequester splicing signals and inhibit yeast pre-mRNA splicing. Mol Cell Biol 1993;13:6841–8. [38] Wyatt JR, Tinoco I. RNA structural elements and RNA

.

function. In: Gesteland RF, Atkins JF, editors. The RNA World. USA: Cold Spring Harbor Laboratory Press, 1993. [39] Westhof E, Jaeger L. RNA pseudoknots. Curr Opin Struct Biol 1992;2:327 – 33. [40] Dam E ten, Pleij K, Draper D. Structural and functional aspects of RNA pseudoknots. Biochemistry 1992;31:11665– 76. [41] Vinkenoog R, et al. Mol Biochem Parasitol 1998;94:1 – 12.