- Email: [email protected]
1 cell line as an alveolar epithelial cell model for drug disposition studies
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/ejps
Characterisation of the R3/1 cell line as an alveolar epithelial cell model for drug disposition studies Lenka Horálková a,b , Aneta Radziwon a , Sibylle Endter a , Rikke Andersen c , ˇ b , Carsten Ehrhardt a,∗ Roland Koslowski d , Marek W. Radomski a , Pavel Dolezal a
Trinity College Dublin, School of Pharmacy and Pharmaceutical Sciences, Westland Row, Dublin 2, Ireland Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic c Department of ADME & Assay Technology, Novo Nordisk A/S, Måløv, Denmark d Dresden University of Technology, Institute of Physiological Chemistry, Medical Faculty Carl Gustav Carus, Dresden, Germany b
a r t i c l e
i n f o
a b s t r a c t
Article history:
The rat cell line R3/1 displays several phenotypical features of alveolar epithelial type I
Received 29 September 2008
cells. In order to evaluate this cell line as potential in vitro model for drug disposition
Received in revised form
studies, R3/1 cells were cultured on Transwell filters and the transepithelial electrical resis-
14 November 2008
tance (TEER) was measured to test the integrity of cell layers. The mRNA expression of cell
Accepted 26 November 2008
junctional components including E-cadherin, occludin, ZO-1 and ZO-2 was studied using
Published on line 3 December 2008
reverse transcriptase-polymerase chain reaction (RT-PCR) and the corresponding proteins by immunofluorescence microscopy (IFM). Moreover, the expression pattern of catabolic
Keywords:
peptidases, carboxypeptidase M, aminopeptidases (AP): A, B, N and P, ␥-glutamyltransferase
Drug disposition
(GGT), dipeptidylpeptidase IV, angiotensin-converting enzyme (ACE), and endopeptidases
Alveolar epithelial cells
(EP) 24.11 and 24.15 was analysed in R3/1 cells and compared to rat alveolar epithelial I-like
Tight junctions
cells in primary culture.
Peptidases Drug absorption
TEER peaked at 99 ± 17 cm2 after 5 days in culture. Addition of 0.1 M dexamethasone (DEX) with 20% foetal bovine serum further increased TEER by 65%. However, none of the culture conditions used in our study yielded monolayers with TEER values comparable to those of primary cultures of rat pneumocytes. No transcripts encoding for E-cadherin and occludin were detected by RT-PCR. However, ZO-1 and -2 mRNA transcripts were found. IFM using a monoclonal antibody against occludin confirmed the absence of the protein in R3/1 cells. Of the investigated proteolytic enzymes, mRNA transcripts encoding APA and APB as well as EP 24.11 and EP 24.15 were detected; a pattern similar to that of rat alveolar epithelial I-like cells in primary culture. Thus, although R3/1 cells express certain markers typical for type I pneumocytes (e.g., T1␣, ICAM-1, connexin-43, caveolins-1 and -2) they do not form electrically tight monolayers. This excludes R3/1 cells from being used as an in vitro model for alveolar absorption. However, the cell line may be suitable to study stability of inhaled and endogenous proteins. © 2008 Elsevier B.V. All rights reserved.
∗
Corresponding author. Tel.: +353 1 896 2441; fax: +353 1 896 2783. E-mail address: [email protected] (C. Ehrhardt). 0928-0987/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.ejps.2008.11.010
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
1.
Introduction
Drug delivery via the pulmonary route represents an attractive avenue for the non-invasive delivery of many clinically relevant compounds. However, limitations need to be acknowledged, among which are the potential impact of active transport mechanisms (e.g., membrane transporters and vesicular transport) upon the epithelial absorption. Moreover, the influence of metabolic enzymes and catabolic peptidases on the drug disposition process (particularly of biopharmaceuticals) is poorly understood (Patton, 1996). Cell-based in vitro models are useful tools for investigations of drug transport and stability at the various epithelia of the lung (Sporty et al., 2008; Forbes and Ehrhardt, 2005). Due to the lack of availability of human lung tissue and ethical constrains pertaining to use of human tissues, most studies have been based on isolation and culture of alveolar epithelial cells (AECs) from the lungs of animals including mouse (Corti et al., 1996), rat (Goodman and Crandall, 1982), rabbit (Shen et al., 1999) and pig (Steimer et al., 2007). Since species differences between human and rodents might be more significant than once assumed (King and Agre, 2001), confirmation of relevance of rodent data to human using human pneumocyte cultures is crucial (Wang et al., 2007; Bur et al., 2006; Ehrhardt et al., 2005). Primary culture techniques of AECs which involve isolation, purification, and culture of alveolar epithelial type II (ATII) cells from tissues obtained after lung resections or from isolated perfused lungs, are used for most in vitro studies of alveolar epithelial function due to the paucity of appropriate alveolar epithelial cell lines that form functional tight junctions (Kim et al., 2001). These ATII cells, when plated on permeable supports or plastic under appropriate culture conditions, acquire type I cell-like phenotypes and morphologies (Demling et al., 2006; Fuchs et al., 2003; Wang et al., 2007). Although isolation of alveolar epithelial type I (ATI) pneumocytes from rat lungs has recently been reported with some success (Borok et al., 2002; Johnson et al., 2002; Chen et al., 2004), development of confluent ATI cell monolayers with electrically tight characteristics has not been reported thus far. It should be noted that unlike many other cells in primary culture, AEC generally exhibit a very limited proliferation profile and are therefore not suitable for passaging (Sporty et al., 2008). Thus, a new preparation of cells must be generated and used for each data set which is tremendously costly and time consuming. While a number of immortalised cell lines emanating from different cell types of the airway (i.e., tracheo-bronchial) epithelium of lungs from various mammalian species are available (Sporty et al., 2008; Kemp et al., 2008), reliable and continuously growing cell lines that possess alveolar epithelial cell morphology and phenotype have not been reported to date. Most studies have relied on the use of cell lines of alveolar epithelial origin, e.g., A549 cells, for drug absorption studies with observations that are meaningless or hard to extend to humans (Sporty et al., 2008; Lieber et al., 1976; Foster et al., 1998; Elbert et al., 1999). The R3/1 cell line was established from pulmonary tissue of foetuses of Han-Wistar rats on day 20 of gestation by
445
explant-replica techniques (Knebel et al., 1994). It has been reported to display several phenotypical features of alveolar epithelial type I cells (Koslowski et al., 2004; Barth et al., 2005; Reynolds et al., 2008). In order to characterise the cell line as an in vitro model for drug disposition studies, R3/1 cells were cultured on filter inserts at different seeding densities, in various cell culture media, as well as under liquid-covered vs. air-interfaced conditions. The transepithelial electrical resistance (TEER) was measured as a parameter for the integrity of cell layers. Presence of cell junctional proteins (E-cadherin, occludin, ZO-1, ZO-2) in R3/1 cells was studied as well as the expression pattern of catabolic peptidases. The following peptidases were investigated: carboxypeptidase M (CPM); aminopeptidases (AP): A, B, N, P; ␥-glutamyl transpeptidase (GGT); angiotensin-converting enzyme (ACE); endopeptidases (EP): 24.11 (neprilysin), 24.15 (thimet oligopeptidase 1). Results were compared with data obtained from rat alveolar epithelial type I-like and type II cells in primary culture.
2.
Materials and methods
2.1.
Cell culture of AEC
2.1.1.
Continuous cell line
R3/1 cells of passage numbers 40–59 were grown in an 1:1 mixture of Dulbecco’s modified Eagle’s medium (DMEM) and Ham’s F-12 medium (Sigma, Dublin, Ireland) at 37 ◦ C in 5% CO2 atmosphere. The DMEM/Ham’s F-12 was supplemented with 10% (v/v) foetal bovine serum (FBS), 1% (v/v) non-essential amino acids, 100 U/ml penicillin, 100 g/ml streptomycin, and 10 mM HEPES. Moreover, RPMI 1640 supplemented with 10% FBS, 100 U/ml penicillin and 100 g/ml streptomycin was used as an alternative medium. The media were changed every other day. To study the influence of media composition on R3/1 cell monolayer integrity, cells were seeded on Transwell Clear permeable filter inserts (Fisher Scientific, Dublin, Ireland) at densities of 0.5–8 × 105 cells/cm2 and cultured under liquid-covered culture (LCC) or air-interfaced culture (AIC) conditions. The effect of dexamethasone (DEX, 0.1 M) and FBS (0–20%) in the culture medium on the cell function was assessed.
2.1.2.
Primary cells
The use of animals for these experiments was concordant with the Declaration of Helsinki and the protocol was approved by the local ethical committees. Specific pathogenfree adult Sprague–Dawley male rats weighing 120–150 g were euthanised with sodium pentobarbital (2.5 mg/kg, i.p.). Rat lungs were perfused in situ with 0.9% NaCl solution and alveolar type II (ATII) cells were isolated from the lungs following ex vivo elastase digestion (Kim et al., 1991). The crude cell mixture was filtered sequentially through 100, 40 and 10 m meshes, followed by plating onto IgG-coated bacteriological plates. After 1 h incubation, ATII cells were collected and centrifuged at 150 × g for 10 min for further enrichment. Purified rat type II pneumocytes were resuspended and either used directly or seeded onto Transwell filter inserts at 1.2 × 106 cells/cm2 . Culture medium consisted of DMEM/Ham’s F-12 1:1 sup-
446
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
plemented with 10% (v/v) newborn bovine serum, 100 U/ml penicillin and 100 g/ml streptomycin. Cells were fed on day 3 and every other day thereafter. These monolayers transdifferentiated into cells bearing type I cell-like morphology and phenotype (Borok et al., 1995). Total RNA was isolated from freshly isolated ATII cells or on day 8 of culture utilising type I cell-like monolayers (Danto et al., 1995).
2.1.3.
Bioelectric parameters
The transepithelial electrical resistance was measured daily as a parameter of the integrity of cell monolayers using a Millicell-ERS epithelial voltohmmetre (Millipore, Carrigtwohill, Ireland) fitted with chopstick electrodes. Obtained values were corrected for background resistance contributed by filter and medium.
2.1.4.
Table 1 – Primer sequences for RT-PCR. Primer Forward Reverse
GTCGTACCACTGGCATTGTG CTCTCAGCTGTGGTGGTGAA
181
E-cadherin
Forward Reverse
CCTAGCTGGAATCCTGTCCA CACCAACACACCCAGCATAG
164
Occludin
Forward Reverse
TCTCAGCCGGCATACTCTTT ATAGGCTCTGTCCCAAGCAA
162
ZO-1
Forward Reverse
CACCACAGACATCCAACCAG CACCAACCACTCTCCCTTGT
230
ZO-2
Forward Reverse
GGCCTGGACCATGAAGACTA GTTCATAGCGGGTCTCTGGA
232
CPM
Forward Reverse
GATTCGAAGCCGTCAAGAAG ATGGAGATTCGCAGAGAGGA
185
APA
Forward Reverse
AAACCAGGATCACCAAGCTG TGGTCAGCCGATAGACACTG
156
APB
Forward Reverse
CTTCGAGATCCTGCACCTG GAAGGGCTGTGTGTGGAAAG
247
APN
Forward Reverse
TTGTCAGACTGCCAGACACC TGTGCCCTGTTGATTCTTTG
199
APP
Forward Reverse
TCCTCTCCCCAACTGTGAAC TCAGAGTCTGCCCACACAAG
242
GGT
Forward Reverse
AAGACTCGGCACCACCATAC GTCCCACTCTCGTCTCTTGG
179
ACE
Forward Reverse
AGTGGGTGCTGCTCTTCCTA ATGGGACACTCCTCTGTTGG
188
DPP IV
Forward Reverse
GAGGCAGCTTGGAACATAGC TGCTAAATGACCAGGCAACA
225
EP 24.11
Forward Reverse
CATTGCCGCAAGAACTCATA TGTGAATTTCCCCCAAGAAG
171
EP 24.15
Forward Reverse
GGTCCTGCACACACAGACAG TTGAAGCGTGTGTGGAACAT
198
R3/1 cells were stained on day 6 in culture. Cells were fixed for 10 min with 2% (w/v) paraformaldehyde and blocked for 10 min in 50 mM NH4 Cl, followed by permeabilisation for 8 min with 0.1% (w/v) Triton X-100. After a 60 min incubation with 100 l of the diluted primary antibody, cell layers were washed three times with PBS before incubation with 100 l of a 1:100 dilution of an Alexa Fluor 488-labelled goat anti-mouse F(ab )2 fragment (BioSciences, Dun Laoghaire, Ireland) in PBS containing 1% (w/v) BSA. Propidium iodide (1 g/ml) was added to counterstain cell nuclei. After 30 min incubation, the specimens were washed three times with PBS and embedded in FluorSave anti-fade medium (Calbiochem, San Diego, CA). Images were studied using a fluorescence microscope (Zeiss Axiovert 200, Göttingen, Germany).
2.1.6. 2.1.5.
Immunofluorescence microscopy (IFM)
The mouse monoclonal anti-occludin antibody (Zymed, San Francisco, CA) was diluted 1:100 in PBS containing 1% (w/v) bovine serum albumin (BSA, Sigma). Mouse IgG1 (clone MOPC21, Sigma) was used as an isotypic control. Transwell-grown
Product size
-Actin
RNA isolation and polymerase chain reaction
To investigate the gene expression of tight junctional proteins and catabolic proteases in R3/1 cells, total mRNA was isolated using an RNeasy Mini kit (Qiagen, Crawley, UK) at day 6 after seeding according to the manufacturer’s instructions. Messenger RNA was quantified by UV absorption at 260 nm using a spectrophotometer (NanoDrop ND 1000, NanoDrop Technologies, Wilmington, DE) and possible contaminating DNA was digested with Turbo DNA-free (Ambion, Austin, TX) and transcribed by reverse transcriptase (Bioscript, Bioline, London, UK). Reverse transcriptase-polymerase chain reaction (RT-PCR) amplification was performed using a Primus 96 Advanced Gradient thermocycler (Peqlab, Erlangen, Germany). Messenger RNA primer sequences were aligned with BLAST 2 sequences (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi) to confirm their unique presence within target species. Exons present in all transcription variants and of suitable size were validated using Primer3 (http://frodo.wi.mit.edu/cgibin/primer3/primer3 www.cgi). Primer sequences used in this study are shown in Table 1. RT-PCR was performed with cells from at least three different passages/isolations. Each PCR reaction contained 40 ng of cDNA, 1.5 mM MgCl2 , 0.2 mM dNTPs, 1.25 l Taq buffer, 0.1 l Biotaq DNA polymerase (5 U/l, Bioline), 10 pmol of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany) and diethylpyrocarbonate-treated water (Sigma) up to the final volume of 12.5 l. The PCR programme started with 5 min at 95 ◦ C, followed by 35 amplification cycles (denaturation at 94 ◦ C for 30 s, annealing at optimal temperature for the respective primer pair for 45 s and extension at 72 ◦ C for 45 s. After the last cycle, the reaction was terminated with a final extension step for 10 min at 72 ◦ C. Negative and positive controls were run following the same procedure. DNA fragments were separated using gel electrophoresis (2% agarose) and were visualised using ethidium bromide staining. A HyperLadder IV size marker (Bioline) was run in parallel. Electrophoresis was carried out at 90 V for 45 min.
Sequence
Western blotting
Confluent cell monolayers were incubated with FBS free medium. Control monolayers were stimulated with phorbol myristate acetate (PMA) in concentration 1–50 M to increase protein expression. After 24 h, the culture medium was collected; cells were washed with PBS and homogenised in
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
cell extraction buffer (BioSciences) supplemented with proteinase inhibitors, leupeptin and aprotinin (Sigma). Protein concentrations were determined with a protein assay (BioRad, Hercules, CA), samples were normalised to equal protein concentrations and separated by SDS gel electrophoresis (5% polyacrylamide for aminopeptidase A; 8% polyacrylamide for endopeptidases 24.11 and 24.15). Rat lung and kidney tissue were homogenised in cell extraction buffer and used as positive controls. Dual colour marker (Bio-Rad) was used as a molecular weight marker. Gels were blotted onto PVDF membranes (Bio-Rad) at 25 V for 30 min. After incubation overnight in blocking buffer composed of PBS, 5% non-fat milk and 0.1% Tween 20, membranes were exposed for 2 h to mouse monoclonal anti-EP 24.11 antibody (dilution 1:100 in blocking buffer) or goat polyclonal anti-EP 24.15 and anti-APA antisera (both dilution 1:200 in blocking buffer). All antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). After four washes in PBS containing 0.1% Tween 20 (washing buffer), horse radish peroxidase (HRP)-conjugated anti-mouse or HRP-conjugated anti-goat immunoglobulins (Sigma) were employed as secondary antibodies at a dilution 1:4000 in wash buffer. Membranes were then washed again four times in wash buffer. A monoclonal anti--actin antibody (Sigma) diluted
447
with blocking buffer (1:1000) was used as a loading control. Bands were detected by chemiluminescence and quantified with a GelDoc documentation system (Bio-Rad).
2.1.7.
Statistical analysis
Results were expressed as mean ± S.D., compared using oneway analysis of variances (ANOVA), followed by Student– Newman–Keuls post hoc tests and p < 0.05 was considered as significant.
3.
Results
3.1.
R3/1 monolayer integrity
When cultured on Transwell Clear filters, R3/1 cells did not form monolayers with TEER values comparable to those of primary cultures of rat pneumocytes that typically reach epithelial resistances of >1000 cm2 (Cheek et al., 1989) (Fig. 1). The peak TEER value of R3/1 monolayers was 99 ± 17 cm2 , after 5 days in culture. The changes in the seeding density from 50,000 to 800,000 cells/cm2 as well as culturing under LCC vs. AIC conditions did not significantly affect TEER of R3/1 mono-
Fig. 1 – Barrier properties of R3/1 monolayers. (A) Variation of seeding densities from 50,000 to 200,000 cells/cm2 had no impact on TEER values of R3/1 cell monolayers. Cells were grown in RPMI 1640 medium under LCC conditions. (B) Shifting from LCC to AIC conditions (in RPMI 1640 culture medium, at different seeding densities) did not cause significant differences in TEER value, either. (C) TEER values of R3/1 cell monolayers grown under LCC conditions without FBS were reduced in comparison to cells cultured in the presence of FBS. (D) Double the concentration of FBS (i.e., 20%) in the presence of 0.1 M DEX increased TEER values of R3/1 monolayers under LCC conditions in DMEM/Ham’s F12 1:1 medium by 65%. When only the FBS concentration was increased or only DEX was added, no significant effect on TEER was observed. Each data point represents means ± S.D. (n ≥ 3) from three different passages.
448
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
Table 2 – Messenger RNA expression profiles of catabolic peptidases in R3/1 cell monolayers, rat alveolar type I-like monolayers in primary culture (ATI) and freshly isolated rat alveolar type II (ATII) cells.
Fig. 2 – Representative agarose gel of the RT-PCR analysis of tight junctional components in R3/1 cell monolayers and rat lung tissue. Lane 2, ZO-1 in R3/1 cell monolayers; Lane 3, ZO-1 in lung tissue; Lane 4, ZO-2 in R3/1 cell monolayers; Lane 5, ZO-2 in lung tissue; Lane 6, E-cadherin in R3/1 cell monolayers; Lane 7, E-cadherin in lung tissue; Lane 8, occludin in R3/1 cell monolayers; Lane 9, occludin in lung tissue. Lanes 10 and 11 show the internal standard, -actin in R3/1 cell monolayer and rat lung tissue, respectively. Lane 1 contains the DNA band size (bp).
layers (Fig. 1A and B). Withdrawal of FBS from the medium reduced TEER to 52 ± 11 cm2 (Fig. 1C). In contrast, addition of FBS (20%) and dexamethasone resulted in an increase in TEER by 65% (Fig. 1D). However, addition of FBS or DEX alone caused no significant changes in TEER values (Fig. 1D). No detectable transcripts or the corresponding E-cadherin or occludin proteins were revealed by RT-PCR or immunofluorescence microscopy (data not shown), respectively. However, mRNA transcripts for intracellular components of the tight junctional complex, ZO-1 and ZO-2, were found (Fig. 2).
CPM APA APB APN APP GGT ACE DPP IV EP 24.11 EP 24.15
R3/1
ATI
ATII
− + + − − − − − + +
+ + + + − + − − + +
+ + − + + + (+) − + +
+, mRNA transcript positively identified. −, no detectable mRNA transcript. (+), very week expression (probably caused by contamination with lung capillary endothelial cells).
3.2.
Presence of proteolytic enzymes
The results obtained using RT-PCR of catabolic peptidases in R3/1 and primary rat pneumocytes are summarised in Table 2. From the range of investigated proteases, mRNA transcripts encoding APA and APB as well as EP 24.11 and EP 24.15 were detected in R3/1 cell monolayers. These transcripts in addition to mRNA encoding APN, CPM and GGT were also present in rat alveolar epithelial type I-like cells in primary culture. In ATII primary cells genes encoding APA, APN and APP, CPM, GGT, and EP 24.11 and EP 24.15 were identified by RT-PCR. A faint signal was also obtained for ACE. Western blotting confirmed the presence of EP 24.11 and EP 24.15, but not APA proteins in R3/1 cells (Fig. 3).
Fig. 3 – Representative Western blots for APA (1), EP 24.11 (2) and EP 24.15 (3) using R3/1 monolayers. Homogenates of monolayers or serum free culture fluid were investigated. FBS and tissue extracts from rat kidney and lung were used on the same gels as controls. Treatment with PMA (1–50 M) did not influence expression of investigated enzymes.
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
4.
Discussion
We have shown that, R3/1 cells express some markers typical for type I pneumocytes (22) including T1␣, ICAM-1, connexin43, caveolins-1 and -2. In contrast to primary rat pneumocytes, these cells do not form electrically tight monolayers. Therefore, R3/1 cells cannot be considered as a reliable in vitro model for alveolar absorption studies. However, our data indicate that R3/1 cells may be suitable for stability assays of inhaled proteins. Pulmonary delivery of macromolecule aerosols has been considered an attractive non-invasive way to overcome frequent injections. The recent termination of development of inhaled insulin by Nektar, Pfizer, Novo Nordisk and Eli Lilly might be a drawback for research in the area of insulin delivery, but other protein drugs may have a brighter future. However, due to their high molecular mass and large size, proteins may have severe difficulties to cross epithelial barriers. Moreover, they might be degraded by proteases and/or removed by alveolar macrophages, as soon as they reach the alveoli (Patton, 1996; Yamahara et al., 1994). To address these issues, in vitro models of alveolar epithelium can be useful in predicting the fate of peptides and proteins administered to the lung (Bur et al., 2006; Yamahara et al., 1994). Hence, it was important and relevant to compare the protease expression pattern of R3/1 cells with primary rat pneumocytes in vitro as this continuous cell line potentially could enable in vitro screening of enzymatic stability of proteins and peptides. From the range of proteolytic enzymes investigated in our study APN, CPM and GGT were differently expressed in R3/1 cells compared to ATIlike cells in primary culture, whereas CPM, APB, APN, APP, GGT and ACE were differently expressed in R3/1 compared to ATII cells. The distribution of proteolytic enzymes in ATI vs. ATII cells in vivo as well as in vitro in different cell types/cell lines of lung epithelial origin has not been extensively investigated. The transdifferentiation from ATII to ATI-like cells in vitro has been reported to go along with increased CPM activity and a decrease of DPP IV expression (Williams, 2003; Nagae et al., 1993; Forbes et al., 1999). In contrast, presence of GGT has been controversial. Some reports describe the enzyme as a typical feature of ATI cells (Ingbar et al., 1995), while others suggest GGT to be characteristic for the ATII phenotype (JoyceBrady et al., 1994). In our study, we found CPM and GGT in both ATI-like cells and freshly isolated ATII cells by RT-PCR, while DPP IV was not detectable at all. The activity of ACE was first reported by Forbes and co-workers to be associated with the ATII phenotype and this was confirmed in our study. However, it cannot be completely ruled out that this signal might have been generated by contaminating endothelial cells in the isolated ATII population in both studies (Forbes et al., 1999). Investigations of catabolic peptidases in the A549 cell line have confirmed the presence of CPM, APN, DPP IV and EP 24.11 (Forbes et al., 1999). This expression pattern resembles neither ATI nor ATII cells. In contrast, the pattern of proteolytic enzymes found in the R3/1 cell line showed more similarities to ATI than to ATII pneumocytes. Since ATI cells cover the vast majority of the pulmonary epithelial surface, it can be sug-
449
gested that this cell type might be of most interest when it comes to protein absorption and degradation. It can be concluded that R3/1 cells are unlikely to be used as an in vitro screening model for alveolar absorption. However, the cells are suitable as an in vitro screening model for protein and peptide stability studies.
Acknowledgements This study was funded by grants from the EU (Lenka Horálková and Sibylle Endter, personal GALENOS Marie-Curie Early Stage Research Training Fellowships, MEST CT-2004-504992), DFG (Roland Koslowski, KO 2219/4-1) and the National Development Plan co-funded by EU Structural Funds and Science Foundation Ireland (Carsten Ehrhardt, Strategic Research Cluster grant 07/SRC/B1154; Marek W. Radomski and Aneta Radziwon are supported by Science Foundation Ireland). We appreciate the critical reading of the manuscript and helpful suggestions by Kwang-Jin Kim (University of Southern California, Los Angeles, CA).
references
Barth, K., Gentsch, M., Bläsche, R., Pfüller, A., Parshyna, I., Koslowski, R., Barth, G., Kasper, M., 2005. Distribution of caveolin-1 and connexin43 in normal and injured alveolar epithelial R3/1 cells. Histochem. Cell Biol. 123, 239–247. Borok, Z., Hami, A., Danto, S.I., Zabski, S.M., Crandall, E.D., 1995. Rat serum inhibits progression of alveolar epithelial cells toward the type I cell phenotype in vitro. Am. J. Respir. Cell Mol. Biol. 12, 50–55. Borok, Z., Liebler, J.M., Lubman, R.L., Foster, M.J., Zhou, B., Li, X., Zabski, S.M., Kim, K.J., Crandall, E.D., 2002. Alveolar epithelial ion and fluid transport: Na transport proteins are expressed by rat alveolar epithelial type I cells. Am. J. Physiol. 282, L599–L608. Bur, M., Huwer, H., Lehr, C.M., Hagen, N., Guldbrandt, M., Kim, K.J., Ehrhardt, C., 2006. Assessment of protein transport rates across primary human alveolar epithelial cell monolayers. Eur. J. Pharm. Sci. 28, 196–203. Cheek, J.M., Kim, K.J., Crandall, E.D., 1989. Tight monolayers of rat alveolar epithelial cells: bioelectric properties and active sodium transport. Am. J. Physiol. 256, C688–C693. Chen, J., Chen, Z., Narasaraju, T., Jin, N., Liu, L., 2004. Isolation of highly pure alveolar epithelial type I and type II cells from rat lungs. Lab. Invest. 84, 727–735. Corti, M., Brody, A.R., Harrison, J.H., 1996. Isolation and primary culture of murine alveolar type II cells. Am. J. Respir. Cell Mol. Biol. 14, 309–315. Danto, S.I., Shannon, J.M., Borok, Z., Zabski, S.M., Crandall, E.D., 1995. Reversible transdifferentiation of alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol. 12, 497–502. Demling, N., Ehrhardt, C., Kasper, M., Laue, M., Knels, L., Rieber, E., 2006. Promotion of cell adherence and spreading: a novel function of RAGE, the highly selective differentiation marker of human alveolar epithelial type I cells. Cell Tissue Res. 323, 475–488. Ehrhardt, C., Kim, K.J., Lehr, C.M., 2005. Isolation and culture of human alveolar epithelial cells. Methods Mol. Med. 107, 207–216. Elbert, K.J., Schäfer, U.F., Schäfers, H.J., Kim, K.J., Lee, V.H., Lehr, C.M., 1999. Monolayers of human alveolar epithelial cells in primary culture for pulmonary absorption and transport studies. Pharm. Res. 16, 601–608.
450
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
Forbes, B., Ehrhardt, C., 2005. Human respiratory epithelial cell culture for drug delivery applications. Eur. J. Pharm. Biopharm. 60, 193–205. Forbes, B., Wilson, C.G., Gumbleton, M., 1999. Temporal dependence of ectopeptidase expression in alveolar epithelial cell culture: implications for study of peptide absorption. Int. J. Pharm. 180, 225–234. Foster, K.A., Oster, C.G., Mayer, M.M., Avery, M.L., Audus, K.L., 1998. Characterization of the A549 cell line as a type II pulmonary epithelial cell model for drug metabolism. Exp. Cell Res. 243, 359–366. Fuchs, S., Hollins, A., Laue, M., Schaefer, U., Roemer, K., Gumbleton, M., Lehr, C.M., 2003. Differentiation of human alveolar epithelial cells in primary culture: morphological characterization and synthesis of caveolin-1 and surfactant protein-C. Cell Tissue Res. 311, 31–45. Goodman, B.E., Crandall, E.D., 1982. Dome formation in primary cultured monolayers of alveolar epithelial cells. Am. J. Physiol. 243, C96–C100. Ingbar, D.H., Hepler, K., Dowin, R., Jacobsen, E., Dunitz, J.M., Nici, L., Jamieson, J.D., 1995. Gamma-glutamyl transpeptidase is a polarized alveolar epithelial membrane protein. Am. J. Physiol. 269, L261–L271. Johnson, M.D., Widdicombe, J.H., Allen, L., Barbry, P., Dobbs, L.G., 2002. Alveolar epithelial type I cells contain transport proteins and transport sodium, supporting an active role for type I cells in regulation of lung liquid homeostasis. Proc. Natl. Acad. Sci. U.S.A. 99, 1966–1971. Joyce-Brady, M., Takahashi, Y., Oakes, S.M., Rishi, A.K., Levine, R.A., Kinlough, C.L., Hughey, R.P., 1994. Synthesis and release of amphipathic gamma-glutamyl transferase by the pulmonary alveolar type 2 cell. Its redistribution throughout the gas exchange portion of the lung indicates a new role for surfactant. J. Biol. Chem. 269, 14219–14226. Kemp, S.J., Thorley, A.J., Gorelik, J., Seckl, M.J., O’Hare, M.J., Arcaro, A., Korchev, Y., Goldstraw, P., Tetley, T.D., 2008. Immortalization of human alveolar epithelial cells to investigate nanoparticle uptake. Am. J. Respir. Cell Mol. Biol. 39, 591–597. Kim, K.J., Borok, Z., Crandall, E.D., 2001. A useful in vitro model for transport studies of alveolar epithelial barrier. Pharm. Res. 18, 253–255. Kim, K.J., Cheek, J.M., Crandall, E.D., 1991. Contribution of active Na+ and Cl− fluxes to net ion transport by alveolar epithelium. Respir. Physiol. 85, 245–256.
King, L.S., Agre, P., 2001. Man is not a rodent. Aquaporins in the airways. Am. J. Respir. Cell Mol. Biol. 24, 221–223. Knebel, J.W., Aufderheide, M., Emura, M., 1994. Comparison of biological effects of different polycyclic aromatic hydrocarbons in lung cells of hamster and rat in vitro. Toxicol. Lett. 72, 65–72. Koslowski, R., Barth, K., Augstein, A., Tschernig, T., Bargsten, G., Aufderheide, M., Kasper, M., 2004. A new rat type I-like alveolar epithelial cell line R3/1: bleomycin effects on caveolin expression. Histochem. Cell Biol. 121, 509–519. Lieber, M., Todaro, G., Smith, B., Szakal, A., Nelson-Rees, W., 1976. A continuous tumor-cell line from a human lung carcinoma with properties of type II alveolar epithelial cells. Int. J. Cancer 17, 62–70. Nagae, A., Abe, M., Becker, R., Deddish, P.A., Skidgel, R.A., Erdös, E.G., 1993. High concentration of carboxypeptidase M in lungs: presence of the enzyme in alveolar type I cells. Am. J. Respir. Cell Mol. Biol. 9, 221–229. Patton, J.S., 1996. Mechanisms of macromolecule absorption by the lungs. Adv. Drug Deliv. Rev. 19, 3–36. Reynolds, P.R., Kasteler, S.D., Cosio, M.G., Sturrock, A., Huecksteadt, T., Hoidal, J.R., 2008. RAGE: developmental expression and positive feedback regulation by Egr-1 during cigarette smoke exposure in pulmonary epithelial cells. Am. J. Physiol. 294, L1094–L1101. Shen, J., Elbert, K.J., Yamashita, F., Lehr, C.M., Kim, K.J., Lee, V.H., 1999. Organic cation transport in rabbit alveolar epithelial cell monolayers. Pharm. Res. 16, 1280–1287. Sporty, J.L., Horálková, L., Ehrhardt, C., 2008. In vitro cell culture models for the assessment of pulmonary drug disposition. Expert Opin. Drug Metab. Toxicol. 4, 333–345. Steimer, A., Franke, H., Haltner-Ukomado, E., Laue, M., Ehrhardt, C., Lehr, C.M., 2007. Monolayers of porcine alveolar epithelial cells in primary culture as an in vitro model for drug absorption studies. Eur. J. Pharm. Biopharm. 66,372–382. Wang, J., Edeen, K., Manzer, R., Chang, Y., Wang, S., Chen, X., Funk, C.J., Cosgrove, G.P., Fang, X., Mason, R.J., 2007. Differentiated human alveolar epithelial cells and reversibility of their phenotype in vitro. Am. J. Respir. Cell Mol. Biol. 36, 661–668. Williams, M.C., 2003. Alveolar type I cells: molecular phenotype and development. Ann. Rev. Physiol. 65, 669–695. Yamahara, H., Lehr, C.M., Lee, V.H., Kim, K.J., 1994. Fate of insulin during transit across rat alveolar epithelial cell monolayers. Eur. J. Pharm. Biopharm. 40, 294–298.
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/ejps
Characterisation of the R3/1 cell line as an alveolar epithelial cell model for drug disposition studies Lenka Horálková a,b , Aneta Radziwon a , Sibylle Endter a , Rikke Andersen c , ˇ b , Carsten Ehrhardt a,∗ Roland Koslowski d , Marek W. Radomski a , Pavel Dolezal a
Trinity College Dublin, School of Pharmacy and Pharmaceutical Sciences, Westland Row, Dublin 2, Ireland Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic c Department of ADME & Assay Technology, Novo Nordisk A/S, Måløv, Denmark d Dresden University of Technology, Institute of Physiological Chemistry, Medical Faculty Carl Gustav Carus, Dresden, Germany b
a r t i c l e
i n f o
a b s t r a c t
Article history:
The rat cell line R3/1 displays several phenotypical features of alveolar epithelial type I
Received 29 September 2008
cells. In order to evaluate this cell line as potential in vitro model for drug disposition
Received in revised form
studies, R3/1 cells were cultured on Transwell filters and the transepithelial electrical resis-
14 November 2008
tance (TEER) was measured to test the integrity of cell layers. The mRNA expression of cell
Accepted 26 November 2008
junctional components including E-cadherin, occludin, ZO-1 and ZO-2 was studied using
Published on line 3 December 2008
reverse transcriptase-polymerase chain reaction (RT-PCR) and the corresponding proteins by immunofluorescence microscopy (IFM). Moreover, the expression pattern of catabolic
Keywords:
peptidases, carboxypeptidase M, aminopeptidases (AP): A, B, N and P, ␥-glutamyltransferase
Drug disposition
(GGT), dipeptidylpeptidase IV, angiotensin-converting enzyme (ACE), and endopeptidases
Alveolar epithelial cells
(EP) 24.11 and 24.15 was analysed in R3/1 cells and compared to rat alveolar epithelial I-like
Tight junctions
cells in primary culture.
Peptidases Drug absorption
TEER peaked at 99 ± 17 cm2 after 5 days in culture. Addition of 0.1 M dexamethasone (DEX) with 20% foetal bovine serum further increased TEER by 65%. However, none of the culture conditions used in our study yielded monolayers with TEER values comparable to those of primary cultures of rat pneumocytes. No transcripts encoding for E-cadherin and occludin were detected by RT-PCR. However, ZO-1 and -2 mRNA transcripts were found. IFM using a monoclonal antibody against occludin confirmed the absence of the protein in R3/1 cells. Of the investigated proteolytic enzymes, mRNA transcripts encoding APA and APB as well as EP 24.11 and EP 24.15 were detected; a pattern similar to that of rat alveolar epithelial I-like cells in primary culture. Thus, although R3/1 cells express certain markers typical for type I pneumocytes (e.g., T1␣, ICAM-1, connexin-43, caveolins-1 and -2) they do not form electrically tight monolayers. This excludes R3/1 cells from being used as an in vitro model for alveolar absorption. However, the cell line may be suitable to study stability of inhaled and endogenous proteins. © 2008 Elsevier B.V. All rights reserved.
∗
Corresponding author. Tel.: +353 1 896 2441; fax: +353 1 896 2783. E-mail address: [email protected] (C. Ehrhardt). 0928-0987/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.ejps.2008.11.010
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
1.
Introduction
Drug delivery via the pulmonary route represents an attractive avenue for the non-invasive delivery of many clinically relevant compounds. However, limitations need to be acknowledged, among which are the potential impact of active transport mechanisms (e.g., membrane transporters and vesicular transport) upon the epithelial absorption. Moreover, the influence of metabolic enzymes and catabolic peptidases on the drug disposition process (particularly of biopharmaceuticals) is poorly understood (Patton, 1996). Cell-based in vitro models are useful tools for investigations of drug transport and stability at the various epithelia of the lung (Sporty et al., 2008; Forbes and Ehrhardt, 2005). Due to the lack of availability of human lung tissue and ethical constrains pertaining to use of human tissues, most studies have been based on isolation and culture of alveolar epithelial cells (AECs) from the lungs of animals including mouse (Corti et al., 1996), rat (Goodman and Crandall, 1982), rabbit (Shen et al., 1999) and pig (Steimer et al., 2007). Since species differences between human and rodents might be more significant than once assumed (King and Agre, 2001), confirmation of relevance of rodent data to human using human pneumocyte cultures is crucial (Wang et al., 2007; Bur et al., 2006; Ehrhardt et al., 2005). Primary culture techniques of AECs which involve isolation, purification, and culture of alveolar epithelial type II (ATII) cells from tissues obtained after lung resections or from isolated perfused lungs, are used for most in vitro studies of alveolar epithelial function due to the paucity of appropriate alveolar epithelial cell lines that form functional tight junctions (Kim et al., 2001). These ATII cells, when plated on permeable supports or plastic under appropriate culture conditions, acquire type I cell-like phenotypes and morphologies (Demling et al., 2006; Fuchs et al., 2003; Wang et al., 2007). Although isolation of alveolar epithelial type I (ATI) pneumocytes from rat lungs has recently been reported with some success (Borok et al., 2002; Johnson et al., 2002; Chen et al., 2004), development of confluent ATI cell monolayers with electrically tight characteristics has not been reported thus far. It should be noted that unlike many other cells in primary culture, AEC generally exhibit a very limited proliferation profile and are therefore not suitable for passaging (Sporty et al., 2008). Thus, a new preparation of cells must be generated and used for each data set which is tremendously costly and time consuming. While a number of immortalised cell lines emanating from different cell types of the airway (i.e., tracheo-bronchial) epithelium of lungs from various mammalian species are available (Sporty et al., 2008; Kemp et al., 2008), reliable and continuously growing cell lines that possess alveolar epithelial cell morphology and phenotype have not been reported to date. Most studies have relied on the use of cell lines of alveolar epithelial origin, e.g., A549 cells, for drug absorption studies with observations that are meaningless or hard to extend to humans (Sporty et al., 2008; Lieber et al., 1976; Foster et al., 1998; Elbert et al., 1999). The R3/1 cell line was established from pulmonary tissue of foetuses of Han-Wistar rats on day 20 of gestation by
445
explant-replica techniques (Knebel et al., 1994). It has been reported to display several phenotypical features of alveolar epithelial type I cells (Koslowski et al., 2004; Barth et al., 2005; Reynolds et al., 2008). In order to characterise the cell line as an in vitro model for drug disposition studies, R3/1 cells were cultured on filter inserts at different seeding densities, in various cell culture media, as well as under liquid-covered vs. air-interfaced conditions. The transepithelial electrical resistance (TEER) was measured as a parameter for the integrity of cell layers. Presence of cell junctional proteins (E-cadherin, occludin, ZO-1, ZO-2) in R3/1 cells was studied as well as the expression pattern of catabolic peptidases. The following peptidases were investigated: carboxypeptidase M (CPM); aminopeptidases (AP): A, B, N, P; ␥-glutamyl transpeptidase (GGT); angiotensin-converting enzyme (ACE); endopeptidases (EP): 24.11 (neprilysin), 24.15 (thimet oligopeptidase 1). Results were compared with data obtained from rat alveolar epithelial type I-like and type II cells in primary culture.
2.
Materials and methods
2.1.
Cell culture of AEC
2.1.1.
Continuous cell line
R3/1 cells of passage numbers 40–59 were grown in an 1:1 mixture of Dulbecco’s modified Eagle’s medium (DMEM) and Ham’s F-12 medium (Sigma, Dublin, Ireland) at 37 ◦ C in 5% CO2 atmosphere. The DMEM/Ham’s F-12 was supplemented with 10% (v/v) foetal bovine serum (FBS), 1% (v/v) non-essential amino acids, 100 U/ml penicillin, 100 g/ml streptomycin, and 10 mM HEPES. Moreover, RPMI 1640 supplemented with 10% FBS, 100 U/ml penicillin and 100 g/ml streptomycin was used as an alternative medium. The media were changed every other day. To study the influence of media composition on R3/1 cell monolayer integrity, cells were seeded on Transwell Clear permeable filter inserts (Fisher Scientific, Dublin, Ireland) at densities of 0.5–8 × 105 cells/cm2 and cultured under liquid-covered culture (LCC) or air-interfaced culture (AIC) conditions. The effect of dexamethasone (DEX, 0.1 M) and FBS (0–20%) in the culture medium on the cell function was assessed.
2.1.2.
Primary cells
The use of animals for these experiments was concordant with the Declaration of Helsinki and the protocol was approved by the local ethical committees. Specific pathogenfree adult Sprague–Dawley male rats weighing 120–150 g were euthanised with sodium pentobarbital (2.5 mg/kg, i.p.). Rat lungs were perfused in situ with 0.9% NaCl solution and alveolar type II (ATII) cells were isolated from the lungs following ex vivo elastase digestion (Kim et al., 1991). The crude cell mixture was filtered sequentially through 100, 40 and 10 m meshes, followed by plating onto IgG-coated bacteriological plates. After 1 h incubation, ATII cells were collected and centrifuged at 150 × g for 10 min for further enrichment. Purified rat type II pneumocytes were resuspended and either used directly or seeded onto Transwell filter inserts at 1.2 × 106 cells/cm2 . Culture medium consisted of DMEM/Ham’s F-12 1:1 sup-
446
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
plemented with 10% (v/v) newborn bovine serum, 100 U/ml penicillin and 100 g/ml streptomycin. Cells were fed on day 3 and every other day thereafter. These monolayers transdifferentiated into cells bearing type I cell-like morphology and phenotype (Borok et al., 1995). Total RNA was isolated from freshly isolated ATII cells or on day 8 of culture utilising type I cell-like monolayers (Danto et al., 1995).
2.1.3.
Bioelectric parameters
The transepithelial electrical resistance was measured daily as a parameter of the integrity of cell monolayers using a Millicell-ERS epithelial voltohmmetre (Millipore, Carrigtwohill, Ireland) fitted with chopstick electrodes. Obtained values were corrected for background resistance contributed by filter and medium.
2.1.4.
Table 1 – Primer sequences for RT-PCR. Primer Forward Reverse
GTCGTACCACTGGCATTGTG CTCTCAGCTGTGGTGGTGAA
181
E-cadherin
Forward Reverse
CCTAGCTGGAATCCTGTCCA CACCAACACACCCAGCATAG
164
Occludin
Forward Reverse
TCTCAGCCGGCATACTCTTT ATAGGCTCTGTCCCAAGCAA
162
ZO-1
Forward Reverse
CACCACAGACATCCAACCAG CACCAACCACTCTCCCTTGT
230
ZO-2
Forward Reverse
GGCCTGGACCATGAAGACTA GTTCATAGCGGGTCTCTGGA
232
CPM
Forward Reverse
GATTCGAAGCCGTCAAGAAG ATGGAGATTCGCAGAGAGGA
185
APA
Forward Reverse
AAACCAGGATCACCAAGCTG TGGTCAGCCGATAGACACTG
156
APB
Forward Reverse
CTTCGAGATCCTGCACCTG GAAGGGCTGTGTGTGGAAAG
247
APN
Forward Reverse
TTGTCAGACTGCCAGACACC TGTGCCCTGTTGATTCTTTG
199
APP
Forward Reverse
TCCTCTCCCCAACTGTGAAC TCAGAGTCTGCCCACACAAG
242
GGT
Forward Reverse
AAGACTCGGCACCACCATAC GTCCCACTCTCGTCTCTTGG
179
ACE
Forward Reverse
AGTGGGTGCTGCTCTTCCTA ATGGGACACTCCTCTGTTGG
188
DPP IV
Forward Reverse
GAGGCAGCTTGGAACATAGC TGCTAAATGACCAGGCAACA
225
EP 24.11
Forward Reverse
CATTGCCGCAAGAACTCATA TGTGAATTTCCCCCAAGAAG
171
EP 24.15
Forward Reverse
GGTCCTGCACACACAGACAG TTGAAGCGTGTGTGGAACAT
198
R3/1 cells were stained on day 6 in culture. Cells were fixed for 10 min with 2% (w/v) paraformaldehyde and blocked for 10 min in 50 mM NH4 Cl, followed by permeabilisation for 8 min with 0.1% (w/v) Triton X-100. After a 60 min incubation with 100 l of the diluted primary antibody, cell layers were washed three times with PBS before incubation with 100 l of a 1:100 dilution of an Alexa Fluor 488-labelled goat anti-mouse F(ab )2 fragment (BioSciences, Dun Laoghaire, Ireland) in PBS containing 1% (w/v) BSA. Propidium iodide (1 g/ml) was added to counterstain cell nuclei. After 30 min incubation, the specimens were washed three times with PBS and embedded in FluorSave anti-fade medium (Calbiochem, San Diego, CA). Images were studied using a fluorescence microscope (Zeiss Axiovert 200, Göttingen, Germany).
2.1.6. 2.1.5.
Immunofluorescence microscopy (IFM)
The mouse monoclonal anti-occludin antibody (Zymed, San Francisco, CA) was diluted 1:100 in PBS containing 1% (w/v) bovine serum albumin (BSA, Sigma). Mouse IgG1 (clone MOPC21, Sigma) was used as an isotypic control. Transwell-grown
Product size
-Actin
RNA isolation and polymerase chain reaction
To investigate the gene expression of tight junctional proteins and catabolic proteases in R3/1 cells, total mRNA was isolated using an RNeasy Mini kit (Qiagen, Crawley, UK) at day 6 after seeding according to the manufacturer’s instructions. Messenger RNA was quantified by UV absorption at 260 nm using a spectrophotometer (NanoDrop ND 1000, NanoDrop Technologies, Wilmington, DE) and possible contaminating DNA was digested with Turbo DNA-free (Ambion, Austin, TX) and transcribed by reverse transcriptase (Bioscript, Bioline, London, UK). Reverse transcriptase-polymerase chain reaction (RT-PCR) amplification was performed using a Primus 96 Advanced Gradient thermocycler (Peqlab, Erlangen, Germany). Messenger RNA primer sequences were aligned with BLAST 2 sequences (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi) to confirm their unique presence within target species. Exons present in all transcription variants and of suitable size were validated using Primer3 (http://frodo.wi.mit.edu/cgibin/primer3/primer3 www.cgi). Primer sequences used in this study are shown in Table 1. RT-PCR was performed with cells from at least three different passages/isolations. Each PCR reaction contained 40 ng of cDNA, 1.5 mM MgCl2 , 0.2 mM dNTPs, 1.25 l Taq buffer, 0.1 l Biotaq DNA polymerase (5 U/l, Bioline), 10 pmol of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany) and diethylpyrocarbonate-treated water (Sigma) up to the final volume of 12.5 l. The PCR programme started with 5 min at 95 ◦ C, followed by 35 amplification cycles (denaturation at 94 ◦ C for 30 s, annealing at optimal temperature for the respective primer pair for 45 s and extension at 72 ◦ C for 45 s. After the last cycle, the reaction was terminated with a final extension step for 10 min at 72 ◦ C. Negative and positive controls were run following the same procedure. DNA fragments were separated using gel electrophoresis (2% agarose) and were visualised using ethidium bromide staining. A HyperLadder IV size marker (Bioline) was run in parallel. Electrophoresis was carried out at 90 V for 45 min.
Sequence
Western blotting
Confluent cell monolayers were incubated with FBS free medium. Control monolayers were stimulated with phorbol myristate acetate (PMA) in concentration 1–50 M to increase protein expression. After 24 h, the culture medium was collected; cells were washed with PBS and homogenised in
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
cell extraction buffer (BioSciences) supplemented with proteinase inhibitors, leupeptin and aprotinin (Sigma). Protein concentrations were determined with a protein assay (BioRad, Hercules, CA), samples were normalised to equal protein concentrations and separated by SDS gel electrophoresis (5% polyacrylamide for aminopeptidase A; 8% polyacrylamide for endopeptidases 24.11 and 24.15). Rat lung and kidney tissue were homogenised in cell extraction buffer and used as positive controls. Dual colour marker (Bio-Rad) was used as a molecular weight marker. Gels were blotted onto PVDF membranes (Bio-Rad) at 25 V for 30 min. After incubation overnight in blocking buffer composed of PBS, 5% non-fat milk and 0.1% Tween 20, membranes were exposed for 2 h to mouse monoclonal anti-EP 24.11 antibody (dilution 1:100 in blocking buffer) or goat polyclonal anti-EP 24.15 and anti-APA antisera (both dilution 1:200 in blocking buffer). All antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). After four washes in PBS containing 0.1% Tween 20 (washing buffer), horse radish peroxidase (HRP)-conjugated anti-mouse or HRP-conjugated anti-goat immunoglobulins (Sigma) were employed as secondary antibodies at a dilution 1:4000 in wash buffer. Membranes were then washed again four times in wash buffer. A monoclonal anti--actin antibody (Sigma) diluted
447
with blocking buffer (1:1000) was used as a loading control. Bands were detected by chemiluminescence and quantified with a GelDoc documentation system (Bio-Rad).
2.1.7.
Statistical analysis
Results were expressed as mean ± S.D., compared using oneway analysis of variances (ANOVA), followed by Student– Newman–Keuls post hoc tests and p < 0.05 was considered as significant.
3.
Results
3.1.
R3/1 monolayer integrity
When cultured on Transwell Clear filters, R3/1 cells did not form monolayers with TEER values comparable to those of primary cultures of rat pneumocytes that typically reach epithelial resistances of >1000 cm2 (Cheek et al., 1989) (Fig. 1). The peak TEER value of R3/1 monolayers was 99 ± 17 cm2 , after 5 days in culture. The changes in the seeding density from 50,000 to 800,000 cells/cm2 as well as culturing under LCC vs. AIC conditions did not significantly affect TEER of R3/1 mono-
Fig. 1 – Barrier properties of R3/1 monolayers. (A) Variation of seeding densities from 50,000 to 200,000 cells/cm2 had no impact on TEER values of R3/1 cell monolayers. Cells were grown in RPMI 1640 medium under LCC conditions. (B) Shifting from LCC to AIC conditions (in RPMI 1640 culture medium, at different seeding densities) did not cause significant differences in TEER value, either. (C) TEER values of R3/1 cell monolayers grown under LCC conditions without FBS were reduced in comparison to cells cultured in the presence of FBS. (D) Double the concentration of FBS (i.e., 20%) in the presence of 0.1 M DEX increased TEER values of R3/1 monolayers under LCC conditions in DMEM/Ham’s F12 1:1 medium by 65%. When only the FBS concentration was increased or only DEX was added, no significant effect on TEER was observed. Each data point represents means ± S.D. (n ≥ 3) from three different passages.
448
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
Table 2 – Messenger RNA expression profiles of catabolic peptidases in R3/1 cell monolayers, rat alveolar type I-like monolayers in primary culture (ATI) and freshly isolated rat alveolar type II (ATII) cells.
Fig. 2 – Representative agarose gel of the RT-PCR analysis of tight junctional components in R3/1 cell monolayers and rat lung tissue. Lane 2, ZO-1 in R3/1 cell monolayers; Lane 3, ZO-1 in lung tissue; Lane 4, ZO-2 in R3/1 cell monolayers; Lane 5, ZO-2 in lung tissue; Lane 6, E-cadherin in R3/1 cell monolayers; Lane 7, E-cadherin in lung tissue; Lane 8, occludin in R3/1 cell monolayers; Lane 9, occludin in lung tissue. Lanes 10 and 11 show the internal standard, -actin in R3/1 cell monolayer and rat lung tissue, respectively. Lane 1 contains the DNA band size (bp).
layers (Fig. 1A and B). Withdrawal of FBS from the medium reduced TEER to 52 ± 11 cm2 (Fig. 1C). In contrast, addition of FBS (20%) and dexamethasone resulted in an increase in TEER by 65% (Fig. 1D). However, addition of FBS or DEX alone caused no significant changes in TEER values (Fig. 1D). No detectable transcripts or the corresponding E-cadherin or occludin proteins were revealed by RT-PCR or immunofluorescence microscopy (data not shown), respectively. However, mRNA transcripts for intracellular components of the tight junctional complex, ZO-1 and ZO-2, were found (Fig. 2).
CPM APA APB APN APP GGT ACE DPP IV EP 24.11 EP 24.15
R3/1
ATI
ATII
− + + − − − − − + +
+ + + + − + − − + +
+ + − + + + (+) − + +
+, mRNA transcript positively identified. −, no detectable mRNA transcript. (+), very week expression (probably caused by contamination with lung capillary endothelial cells).
3.2.
Presence of proteolytic enzymes
The results obtained using RT-PCR of catabolic peptidases in R3/1 and primary rat pneumocytes are summarised in Table 2. From the range of investigated proteases, mRNA transcripts encoding APA and APB as well as EP 24.11 and EP 24.15 were detected in R3/1 cell monolayers. These transcripts in addition to mRNA encoding APN, CPM and GGT were also present in rat alveolar epithelial type I-like cells in primary culture. In ATII primary cells genes encoding APA, APN and APP, CPM, GGT, and EP 24.11 and EP 24.15 were identified by RT-PCR. A faint signal was also obtained for ACE. Western blotting confirmed the presence of EP 24.11 and EP 24.15, but not APA proteins in R3/1 cells (Fig. 3).
Fig. 3 – Representative Western blots for APA (1), EP 24.11 (2) and EP 24.15 (3) using R3/1 monolayers. Homogenates of monolayers or serum free culture fluid were investigated. FBS and tissue extracts from rat kidney and lung were used on the same gels as controls. Treatment with PMA (1–50 M) did not influence expression of investigated enzymes.
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
4.
Discussion
We have shown that, R3/1 cells express some markers typical for type I pneumocytes (22) including T1␣, ICAM-1, connexin43, caveolins-1 and -2. In contrast to primary rat pneumocytes, these cells do not form electrically tight monolayers. Therefore, R3/1 cells cannot be considered as a reliable in vitro model for alveolar absorption studies. However, our data indicate that R3/1 cells may be suitable for stability assays of inhaled proteins. Pulmonary delivery of macromolecule aerosols has been considered an attractive non-invasive way to overcome frequent injections. The recent termination of development of inhaled insulin by Nektar, Pfizer, Novo Nordisk and Eli Lilly might be a drawback for research in the area of insulin delivery, but other protein drugs may have a brighter future. However, due to their high molecular mass and large size, proteins may have severe difficulties to cross epithelial barriers. Moreover, they might be degraded by proteases and/or removed by alveolar macrophages, as soon as they reach the alveoli (Patton, 1996; Yamahara et al., 1994). To address these issues, in vitro models of alveolar epithelium can be useful in predicting the fate of peptides and proteins administered to the lung (Bur et al., 2006; Yamahara et al., 1994). Hence, it was important and relevant to compare the protease expression pattern of R3/1 cells with primary rat pneumocytes in vitro as this continuous cell line potentially could enable in vitro screening of enzymatic stability of proteins and peptides. From the range of proteolytic enzymes investigated in our study APN, CPM and GGT were differently expressed in R3/1 cells compared to ATIlike cells in primary culture, whereas CPM, APB, APN, APP, GGT and ACE were differently expressed in R3/1 compared to ATII cells. The distribution of proteolytic enzymes in ATI vs. ATII cells in vivo as well as in vitro in different cell types/cell lines of lung epithelial origin has not been extensively investigated. The transdifferentiation from ATII to ATI-like cells in vitro has been reported to go along with increased CPM activity and a decrease of DPP IV expression (Williams, 2003; Nagae et al., 1993; Forbes et al., 1999). In contrast, presence of GGT has been controversial. Some reports describe the enzyme as a typical feature of ATI cells (Ingbar et al., 1995), while others suggest GGT to be characteristic for the ATII phenotype (JoyceBrady et al., 1994). In our study, we found CPM and GGT in both ATI-like cells and freshly isolated ATII cells by RT-PCR, while DPP IV was not detectable at all. The activity of ACE was first reported by Forbes and co-workers to be associated with the ATII phenotype and this was confirmed in our study. However, it cannot be completely ruled out that this signal might have been generated by contaminating endothelial cells in the isolated ATII population in both studies (Forbes et al., 1999). Investigations of catabolic peptidases in the A549 cell line have confirmed the presence of CPM, APN, DPP IV and EP 24.11 (Forbes et al., 1999). This expression pattern resembles neither ATI nor ATII cells. In contrast, the pattern of proteolytic enzymes found in the R3/1 cell line showed more similarities to ATI than to ATII pneumocytes. Since ATI cells cover the vast majority of the pulmonary epithelial surface, it can be sug-
449
gested that this cell type might be of most interest when it comes to protein absorption and degradation. It can be concluded that R3/1 cells are unlikely to be used as an in vitro screening model for alveolar absorption. However, the cells are suitable as an in vitro screening model for protein and peptide stability studies.
Acknowledgements This study was funded by grants from the EU (Lenka Horálková and Sibylle Endter, personal GALENOS Marie-Curie Early Stage Research Training Fellowships, MEST CT-2004-504992), DFG (Roland Koslowski, KO 2219/4-1) and the National Development Plan co-funded by EU Structural Funds and Science Foundation Ireland (Carsten Ehrhardt, Strategic Research Cluster grant 07/SRC/B1154; Marek W. Radomski and Aneta Radziwon are supported by Science Foundation Ireland). We appreciate the critical reading of the manuscript and helpful suggestions by Kwang-Jin Kim (University of Southern California, Los Angeles, CA).
references
Barth, K., Gentsch, M., Bläsche, R., Pfüller, A., Parshyna, I., Koslowski, R., Barth, G., Kasper, M., 2005. Distribution of caveolin-1 and connexin43 in normal and injured alveolar epithelial R3/1 cells. Histochem. Cell Biol. 123, 239–247. Borok, Z., Hami, A., Danto, S.I., Zabski, S.M., Crandall, E.D., 1995. Rat serum inhibits progression of alveolar epithelial cells toward the type I cell phenotype in vitro. Am. J. Respir. Cell Mol. Biol. 12, 50–55. Borok, Z., Liebler, J.M., Lubman, R.L., Foster, M.J., Zhou, B., Li, X., Zabski, S.M., Kim, K.J., Crandall, E.D., 2002. Alveolar epithelial ion and fluid transport: Na transport proteins are expressed by rat alveolar epithelial type I cells. Am. J. Physiol. 282, L599–L608. Bur, M., Huwer, H., Lehr, C.M., Hagen, N., Guldbrandt, M., Kim, K.J., Ehrhardt, C., 2006. Assessment of protein transport rates across primary human alveolar epithelial cell monolayers. Eur. J. Pharm. Sci. 28, 196–203. Cheek, J.M., Kim, K.J., Crandall, E.D., 1989. Tight monolayers of rat alveolar epithelial cells: bioelectric properties and active sodium transport. Am. J. Physiol. 256, C688–C693. Chen, J., Chen, Z., Narasaraju, T., Jin, N., Liu, L., 2004. Isolation of highly pure alveolar epithelial type I and type II cells from rat lungs. Lab. Invest. 84, 727–735. Corti, M., Brody, A.R., Harrison, J.H., 1996. Isolation and primary culture of murine alveolar type II cells. Am. J. Respir. Cell Mol. Biol. 14, 309–315. Danto, S.I., Shannon, J.M., Borok, Z., Zabski, S.M., Crandall, E.D., 1995. Reversible transdifferentiation of alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol. 12, 497–502. Demling, N., Ehrhardt, C., Kasper, M., Laue, M., Knels, L., Rieber, E., 2006. Promotion of cell adherence and spreading: a novel function of RAGE, the highly selective differentiation marker of human alveolar epithelial type I cells. Cell Tissue Res. 323, 475–488. Ehrhardt, C., Kim, K.J., Lehr, C.M., 2005. Isolation and culture of human alveolar epithelial cells. Methods Mol. Med. 107, 207–216. Elbert, K.J., Schäfer, U.F., Schäfers, H.J., Kim, K.J., Lee, V.H., Lehr, C.M., 1999. Monolayers of human alveolar epithelial cells in primary culture for pulmonary absorption and transport studies. Pharm. Res. 16, 601–608.
450
e u r o p e a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 3 6 ( 2 0 0 9 ) 444–450
Forbes, B., Ehrhardt, C., 2005. Human respiratory epithelial cell culture for drug delivery applications. Eur. J. Pharm. Biopharm. 60, 193–205. Forbes, B., Wilson, C.G., Gumbleton, M., 1999. Temporal dependence of ectopeptidase expression in alveolar epithelial cell culture: implications for study of peptide absorption. Int. J. Pharm. 180, 225–234. Foster, K.A., Oster, C.G., Mayer, M.M., Avery, M.L., Audus, K.L., 1998. Characterization of the A549 cell line as a type II pulmonary epithelial cell model for drug metabolism. Exp. Cell Res. 243, 359–366. Fuchs, S., Hollins, A., Laue, M., Schaefer, U., Roemer, K., Gumbleton, M., Lehr, C.M., 2003. Differentiation of human alveolar epithelial cells in primary culture: morphological characterization and synthesis of caveolin-1 and surfactant protein-C. Cell Tissue Res. 311, 31–45. Goodman, B.E., Crandall, E.D., 1982. Dome formation in primary cultured monolayers of alveolar epithelial cells. Am. J. Physiol. 243, C96–C100. Ingbar, D.H., Hepler, K., Dowin, R., Jacobsen, E., Dunitz, J.M., Nici, L., Jamieson, J.D., 1995. Gamma-glutamyl transpeptidase is a polarized alveolar epithelial membrane protein. Am. J. Physiol. 269, L261–L271. Johnson, M.D., Widdicombe, J.H., Allen, L., Barbry, P., Dobbs, L.G., 2002. Alveolar epithelial type I cells contain transport proteins and transport sodium, supporting an active role for type I cells in regulation of lung liquid homeostasis. Proc. Natl. Acad. Sci. U.S.A. 99, 1966–1971. Joyce-Brady, M., Takahashi, Y., Oakes, S.M., Rishi, A.K., Levine, R.A., Kinlough, C.L., Hughey, R.P., 1994. Synthesis and release of amphipathic gamma-glutamyl transferase by the pulmonary alveolar type 2 cell. Its redistribution throughout the gas exchange portion of the lung indicates a new role for surfactant. J. Biol. Chem. 269, 14219–14226. Kemp, S.J., Thorley, A.J., Gorelik, J., Seckl, M.J., O’Hare, M.J., Arcaro, A., Korchev, Y., Goldstraw, P., Tetley, T.D., 2008. Immortalization of human alveolar epithelial cells to investigate nanoparticle uptake. Am. J. Respir. Cell Mol. Biol. 39, 591–597. Kim, K.J., Borok, Z., Crandall, E.D., 2001. A useful in vitro model for transport studies of alveolar epithelial barrier. Pharm. Res. 18, 253–255. Kim, K.J., Cheek, J.M., Crandall, E.D., 1991. Contribution of active Na+ and Cl− fluxes to net ion transport by alveolar epithelium. Respir. Physiol. 85, 245–256.
King, L.S., Agre, P., 2001. Man is not a rodent. Aquaporins in the airways. Am. J. Respir. Cell Mol. Biol. 24, 221–223. Knebel, J.W., Aufderheide, M., Emura, M., 1994. Comparison of biological effects of different polycyclic aromatic hydrocarbons in lung cells of hamster and rat in vitro. Toxicol. Lett. 72, 65–72. Koslowski, R., Barth, K., Augstein, A., Tschernig, T., Bargsten, G., Aufderheide, M., Kasper, M., 2004. A new rat type I-like alveolar epithelial cell line R3/1: bleomycin effects on caveolin expression. Histochem. Cell Biol. 121, 509–519. Lieber, M., Todaro, G., Smith, B., Szakal, A., Nelson-Rees, W., 1976. A continuous tumor-cell line from a human lung carcinoma with properties of type II alveolar epithelial cells. Int. J. Cancer 17, 62–70. Nagae, A., Abe, M., Becker, R., Deddish, P.A., Skidgel, R.A., Erdös, E.G., 1993. High concentration of carboxypeptidase M in lungs: presence of the enzyme in alveolar type I cells. Am. J. Respir. Cell Mol. Biol. 9, 221–229. Patton, J.S., 1996. Mechanisms of macromolecule absorption by the lungs. Adv. Drug Deliv. Rev. 19, 3–36. Reynolds, P.R., Kasteler, S.D., Cosio, M.G., Sturrock, A., Huecksteadt, T., Hoidal, J.R., 2008. RAGE: developmental expression and positive feedback regulation by Egr-1 during cigarette smoke exposure in pulmonary epithelial cells. Am. J. Physiol. 294, L1094–L1101. Shen, J., Elbert, K.J., Yamashita, F., Lehr, C.M., Kim, K.J., Lee, V.H., 1999. Organic cation transport in rabbit alveolar epithelial cell monolayers. Pharm. Res. 16, 1280–1287. Sporty, J.L., Horálková, L., Ehrhardt, C., 2008. In vitro cell culture models for the assessment of pulmonary drug disposition. Expert Opin. Drug Metab. Toxicol. 4, 333–345. Steimer, A., Franke, H., Haltner-Ukomado, E., Laue, M., Ehrhardt, C., Lehr, C.M., 2007. Monolayers of porcine alveolar epithelial cells in primary culture as an in vitro model for drug absorption studies. Eur. J. Pharm. Biopharm. 66,372–382. Wang, J., Edeen, K., Manzer, R., Chang, Y., Wang, S., Chen, X., Funk, C.J., Cosgrove, G.P., Fang, X., Mason, R.J., 2007. Differentiated human alveolar epithelial cells and reversibility of their phenotype in vitro. Am. J. Respir. Cell Mol. Biol. 36, 661–668. Williams, M.C., 2003. Alveolar type I cells: molecular phenotype and development. Ann. Rev. Physiol. 65, 669–695. Yamahara, H., Lehr, C.M., Lee, V.H., Kim, K.J., 1994. Fate of insulin during transit across rat alveolar epithelial cell monolayers. Eur. J. Pharm. Biopharm. 40, 294–298.