Characterization and chromosomal mapping of a human steroid 5α-reductase gene and pseudogene and mapping of the mouse homologue

GENOMICS

11,1102-1112

(19%)

Characterization and Chromosomal Mapping of a Human Steroid Sar-Reductase Gene and Pseudogene and Mapping of the Mouse Homologue ELIZABETH P. JENKINS,* CHIH-LIN tiSIEH,t ATHENA MILATOVICH,$ KARL NORMINGTON,* DAVID M. BERMAN,* UTA FRANcIcE, t,$ AND DAVID W. RUSSELL* *Departments of Molecular Genetics and Internal Medicine, University of Texas Southwestern Medical Dallas, Texas 75235; and t Howard Hughes Medical Institute and *Department of Genetics, Stanford University Medical Center, Stanford, California 94305-5428 Received

May

28, 1991;

revised

INTRODUCTION

Steroid 5a-reductase (EC 1.3.99.5) is responsible for the formation of dihydrotestosterone, a potent steroid hormone that mediates a majority of the actions typically ascribed to androgens (Wilson, 1975). Dihydrotestosterone promotes the differentiation of the male external genitalia and the prostate during fetal sexual development (Wilson, 1978) and in postnatal life influences a variety of processesincluding virilization at puberty, male sexual behavior, and growth of the prostate in elderly men (Wilson, 1980). The role of steroid 5a-reductase and dihydrotestosterone in androgen physiology has been elucidated by the measurement of enzyme activity (Bruchovsky data

from this article have Data Libraries under

o&38-7543/91 $3.00 Copyright 0 1991 by Academic Press, All rights of reproduction in any form

been deposited with the Accession Nos. M6882-

1102 Inc. reserved.

1, 1991

and Wilson, 1968), by the discovery and use of specific inhibitors of the enzyme (Liang and Heiss, 1981), and by the analysis of naturally occurring mutations in the steroid 5a-reductase gene that disrupt male sexual development (Griffin and Wilson, 1989). These mutations are found in subjects with the genetic disease steroid 5ar-reductase deficiency, which is characterized by a form of male pseudohermaphroditism in which the external genitalia and prostate fail to develop normally (Griffin and Wilson, 1989). Recently, cDNA clones encoding rat and human steroid 5a-reductases have been isolated and used to characterize further the structure, regulation, and pharmacology of the enzyme (Andersson et sZ., 1989; Andersson and Russell,. 1990). The rat steroid 5a-reductase is a small protein of 255 amino acids encoded by a single gene that is expressed in both androgen target tissues, such as the prostate, and in nontarget tissues, such as the liver (Andersson et aZ., 1989). The expression of the gene in the prostate is regulated by androgens (Andersson et aL, 1989), and more specifically by dihydrotestosterone via an unusual feed-forward control mechanism (George et aZ., 1991). Transfection of an expression vector containing the rat cDNA into cultured mammalian cells results in the synthesis of a steroid 5a-reductase enzyme that demonstrates the expected substrate specificities and competitive inhibition by 4-aza steroids (Andersson and Russell, 1990). A human steroid 5cY-reductase cDNA was isolated from a prostate cDNA library by cross-hybridization with a rat probe (Andersson and Russell, 1990). The protein encoded by this cDNA is 259 amino acids in length and shares approximately 60% sequence identity with the rat. Blot hybridization analysis of prostate RNA revealed a single species of steroid 5cw-reductase mRNA with a size of about 2.1 kb. Expression

The enzyme steroid 5a-reductase catalyzes the conversion of testosterone into the more powerful androgen, dihydrotestosterone. We previously described the cloning of rat and human cDNAs that encode steroid Ba-reductase and their expression in oocytes and cultured cells. Here, we report the isolation, characterization, and chromosomal mapping of two human steroid Ba-reductase genes. One gene (symbol SRDSAl) is functional, contains five exons separated by four introits, and maps to the distal short arm of chromosome 5. Two informative restriction fragment length polymorphisms are present in exons 1 and 2 of this gene. A second gene (symbol SRDSAPI) has all of the hallmarks of a processed pseudogene and was mapped to the q24-qter region of the X chromosome. In the mouse, a single steroid 6a-reductase gene (Srd5a-1) is linked to Xmv13 on chromosome 13. 0 1991 AcademicPress, Inc.

Sequence EMBL/GenBank M6887.

August

Center,

STEROID

Ba-REDUCTASE

of a full-length cDNA in mammalian cells produced a steroid 5ar-reductase enzyme that actively reduced a spectrum of substrates and that was inhibited by some, but not all, 4-aza steroids (Andersson and Russell, 1990). Molecular genetic, biochemical, and pharmacological experiments showed that the cDNA-encoded enzyme is different from the major isozyme in the prostate and that mutations in the cloned gene do not underlie steroid Sa-reductase deficiency (Jenkins et al., 1991). These results strongly suggest the existence of more than one steroid 5cY-reductase enzyme and gene in humans. The proteins encoded by the rat and human cDNAs represent a class of NADPH-dependent, membranebound steroid-metabolizing enzymes (Andersson et al., 1989). They are small hydrophobic proteins that lack a cleavable signal sequence and have the capacity to traverse the endoplasmic reticulum or nuclear membrane multiple times (Andersson et al., 1989). The locations of functional domains in these enzymes, such as those that bind the steroid substrate or NADPH cofactor are presently unknown. Computerassisted comparisons of their sequences to other proteins in multiple databases, including several steroid dehydrogenases (Agarwal et al., 1989), have so far not revealed any overt homologies (Andersson and Russell, 1990). To gain further insight into the structure of the enzyme and the molecular genetics of steroid 5cu-reductase, we report here the isolation, characterization, and chromosomal mapping of the gene from which the cloned cDNA was derived. The data indicate that a functional human steroid 5a-reductase gene contains five exons, maps to chromosome 5, and contains polymorphic Hi&I and NspI restriction endonuclease sites. A pseudogene lacking introns and containing a premature translation termination codon is located on the X chromosome. In the mouse, a single steroid 5a-reductase gene is closely linked to the Xmv-13 locus on chromosome 13.

with an Applied Biosystems Model 340A Nucleic Acid Extractor. A cell line with a 49,XXXXY karyotype was purchased from the American Type Culture Collection (CCL28) and grown according to the supplier’s recommendations.

Genomic Library

AND

METHODS

Materials Enzymes for DNA cloning, DNA sequencing, and polymerase chain reactions were obtained from New England Biolabs, Amersham, U.S. Biochemicals, and Perkin-Elmer-Cetus. DNA sequencing was carried out as described by Sanger et al. (1977) using radiolabeled primers or deoxynucleoside triphosphates (DuPont-New England Nuclear) or on an Applied Biosystems Model 370A DNA sequencer with fluorescently labeled primers or dideoxynucleoside triphosphates (Smith et uZ., 1986). Genomic DNA was purified from peripheral blood cells of normal subjects

Screening

Three human genomic DNA libraries in bacteriophage X vectors were purchased from Stratagene Corp. (catalogue No. 946204 and No. 943202) and from Clontech Corp. (HL1067J). Screening in 50% formamide-containing buffers was carried out following standard procedures (Sambrook et al., 1989) with 32P-labeledprobes (Feinbergandvogelstein, 1983) derived from the full-length human steroid 5a-reductase cDNA (Andersson and Russell, 1990).

Trunsfection

of Cultured

Cells

A line of human hepatoma cells (HepG2) was grown in monolayer in Dulbecco’s minimal essential medium containing 10% fetal calf serum and transfected at subconfluency using a calcium phosphate protocol (Sambrook et al., 1989). Two plasmids were introduced simultaneously into the cells, a test plasmid containing a bacterial chloramphenicol acyltransferase gene (pBLCAT3, Luckow and Schutz, 1987) and a normalization plasmidcontaining a bacterial P-galactosidase gene linked to the Simian virus 40 early region promoter and enhancer (pCH110, Searle et al., 1985). Forty-eight to 72 h after transfection, cells were lysed by freeze-thawing and assayed for the presence of fl-galactosidase activity (Sambrook et al., 1989). Aliquots of cell lysates containing equal amounts of /3-galactosidase activity were then assayed for CAT enzyme activity (Sambrook et al., 1989). Results were expressed as percentage conversion of starting [ 14C]chloramphenicol substrate into acylated products.

Southern MATERLQLS

1103

GENE

Blotting

Human, mouse, and somatic cell hybrid genomic DNA (5-20 pg) was analyzed by Southern blotting as described previously (Lehrman et al., 1985; Hsieh et al., 1990). Radiolabeled probes (32P) were prepared from human and rat steroid 5cu-reductase cDNAs as described by Feinberg and Vogelstein (1983) and by Church and Gilbert (1983).

Hybrid Mapping Panels and Recombinant Mouse Strains

Inbred

Chromosomal assignment of the functional steroid 5cY-reductase (SRDSAl) locus and pseudogene (SRDSAPI) in human DNA was carried out with 18 somatic cell hybrid clones derived from eight indepen-

1104

JENKINS

dent fusion experiments between established rodent cell lines and human diploid cells (reviewed in Francke et al., 1986). The localization of SRDSAPl on the human X chromosome was determined with 10 rodent X human hybrids that contain different regions of the human X chromosome (DeMartinville et al., 1985; Wieacker et al., 1984). Radiolabeled hybridization probes prepared as described above consisted of the full-length human steroid 5cu-reductase cDNA. Initial chromosome mapping in the mouse was carried out with 12 Chinese hamster X mouse hybrids and one rat X mouse hybrid clone derived from four different series of hybrids (Yang-Feng et al., 1986). Regional mapping was accomplished with DNA from five inbred mouse strains, AKR/J, C3H/HeJ, C57BL/6J, C57L/J, and DBA/BJ, and DNA from the BXD and AKXL sets of recombinant inbred (RI) mice (all purchased from the Jackson Laboratory, Bar Harbor, ME). The hybridization probe in these studies consisted of a 630-bp EcoRI/SacI fragment corresponding to the 5’ end of the full-length rat steroid 5a-reductase cDNA. RFLP’

AL.

al. (1989). Washed filters were exposed to X-ray film (Kodak XRP-1) for l-10 min at room temperature. An Nsp 7524 I (NspI) polymorphism in exon 2 of the steroid 5a-reductase gene was detected by amplification of genomic DNA (1 fig) using two oligonucleotides, h5a14 (5’-CCCAAATCATTTAAGATAGGATTAC-3’) and h5a8 (5’-ATGATGTGAACAAGGCGGAGTTCAC-3’) that are complementary to sequences in intron 1 and intron 2, respectively. The samples, in a buffer containing 10 mMTris-HCl, pH 8.3,50 mM KCl, 1.5 n-&f MgCl,, 0.01% (w/v) gelatin, were initially denatured at 94°C for 1 min, and then subjected to 35 cycles of annealing at 55°C for 30 s and extension at 72°C for 2 min. The amplified DNA was then digested with 10 units of Nap1 for 3 h at 37°C. DNA was fractionated by electrophoresis and subjected to Southern blotting and autoradiography as described above, except that radiolabeled probes were prepared from oligonucleotides h5a14 and h5a8 by end-labeling with [T-~~P]ATP.

RESULTS

Analysis

To detect a HinfI polymorphism present in exon 1 of the steroid 5a-reductase gene, genomic DNA (1 pg) was amplified using two oligonucleotides, h5a35 (5’CAGGATCCGAGGCCTCTGGCATGGGGAGCACGCTGCCCAGCCCTG-3’) and h5a36 (5’-CGAAGCTTCAGGCACTCGGAGCCTGTGGCTGGGCA3’). The polymerase chain reaction was carried out in a buffer containing 10 mM Tris-HCl, pH 8.3,50 mM KCl, 1.5 mMMgCl,, 0.01% (w/v) gelatin for 35 cycles of 95°C denaturation (1 min), and 68°C annealing and extension (3 min) in an automated thermocycler (Perkin-Elmer-Cetus). Initial denaturation was at 95°C for 10 min and a final extension was at 68°C for 10 min. After amplification, the DNA was digested with 10 units of HinfI for 3 h at 37°C. DNA was fractionated on a 5% (w/v) polyacrylamide gel in a buffer containing 50 mA4 Tris-borate, pH 8.3, and 1 mM EDTA, transferred to Zeta-Probe membranes by electrophoresis at 30 V for 3 h in 0.5~ electrophoresis buffer, and covalently linked to the filter by treatment with UV light (UV Stratalinker, Stratagene Corp., La Jolla, CA). Radiolabeled probes were prepared by 5’-end labeling of oligonucleotide h5a35 with [T-~~P]ATP using bacteriophage T4 polynucleotide kinase (Sambrook et al., 1989). Hybridization in aqueous solution and washing were carried out as described by Sambrook et

1 Abbreviations used: RFLP, restriction fragment length morphism; LI,NE, long interspersed nncleotide element; chloramphenicol acetyltransferase.

ET

polyCAT,

To isolate genomic DNA sequences homologous to the cloned human steroid 5cu-reductase cDNA, several commercially available bacteriophage X libraries were screened at high stringency. Thirty-two hybridization-positive clones were identified among 2 X lo6 plaques, and each of these was initially divided into one of several classesbased on their abilities to hybridize with 5’- and 3’-radiolabeled cDNA fragments. Further characterization of selected members from these classes by plasmid subcloning, restriction mapping, Southern blotting, and DNA sequence analysis revealed the existence of two nonidentical genes. Figure 1 shows the partial sequence and organization of one steroid 5cu-reductase gene. This gene spanned over 35-kb of DNA and contained five exons separated by four introns. With the exception of polymorphisms (seebelow), the DNA sequence of the five exons exactly matched the sequence of the previously cloned cDNA. The lengths of the exons varied from 0.102 to 1.359 kb, while those of the introns varied from 4.1 to over 14 kb. The 5’-flanking region of the gene contained a TATA sequence and several consensus sequences for the Spl transcription factor (Kadonaga et al., 1986). The 5’ end of the mRNA transcribed from the gene shown in Fig. 1 has not yet been formally determined. However, the longest cDNA isolated (Andersson and Russell, 1990) extended 5’ to nucleotide -30 (Fig. l), and the 5’end of mRNA transcribed from the rat gene has been mapped to a position equivalent to -26 in Fig. 1 (Andersson et al., 1989). The near identical location of the TATA sequences of the rat and human genes suggest that the 5’

-729 -609 -489 -369 -249 -129 -9

98 rgLeuArgSerAlaProAsnCyslleLeuLeuAlaMetPheLeuValHisTyffilyHisAr GTCTCCGCAGCGCGCCCAACTGCATCCTCCTGGCCATGTTCCTCGTCCACTACGGGCATCG---------GT~CGTCCCCGGCCCCCGCCCClACCCTACTCCCGGCCCGGCGTCCTCT CCGACCCTCCCCTCACTGCCCGGTGCCCTCTCCCCGAAGCCTCCCCCACC---~-- >14 kb ---CAAGAAAGTAAGATTTAAAACCCAAATCATTTAAGATAGGATTACAG~ATGA gCysLeulleTyrProPheLeuMetArgGlyGlyLysProMetProLeuteuAlaCysThrMet TTATCTTTAATTTTTTAAAAAATTGTGCCTGTTTCTTGTTTCCT~G~~-------GTGCTTAATTTACCCGTTTCTGATGCGAGGAGGAAAGCCTATGCCACTGTTGG~GTACAATG 154 AlalleMetPheCysThrCysAsnGlyTyrLeuGlnSerArgTyrLeuSerHisCysAlaValTyrAlaAspAspTrpValThrAspProArgPheLeuIleG GCGATTATGTTCTGTACCTGTAACGGCTATTTGCAAAGCAGATACTTGAGCCATTGTGCAGTGTATGCTGATGACTGGGTAACAGATCCCCGTTTTCTAATAG-.--.-----GTGAGTG TCCACAGCAGTGAACTCCGCCTTGTTCACATCATTGCTTTTATATTGATGTCCCAGTGGTT-..... 3.9 kb ----AATCTGAAGGGTTGCAATAATACTAGTTCAGTCAGGCTGGG lyPheGlyLeuTrpLeuThrGlyMetLeulleAsnIleHisSerAspHisll GCTCGTAGTGAAATTTTACGGTTTATTAGCCATRATCATCTTGC~TTTTTTTCCTTTAG--------GTTTTGGCTTGTGGTTAACAGGCATGTTGATAAACATCCATTCAGATCATAT 188 eLeuArgAsnLeuArgLysProGlyAspThrGlyTyrLysIleProArgG CCTAAGWU\TCTCAGAAAACCAGGAGATACTGGATACAAAGTTGCTTGCCATGGTTCCTGGCTATTTTGT GTTGCCAGCTCTAAGAAGTAGTAGCGTAGTAGTTATTA----6.6

Lb ------TCTTGAATTTATGTCTCCAGGTAAGTATTCACTAGCATCTCTG~GTCCGTATTTCATTTTGT

238 erTrpSerValGlnGlyAlaAlaPheAlaPhePheThrPheCysPheLeuSerGlyArgAlaLysGluHisHisGl GCTGGTCTGTCCAAGGCGCGGCTTTTGCTTTCTTCACGTTTTGTTT~TATCTGGTAGAGC~~GCATCAT~~--------GTAAGTTTTAAAACACTTTTACCATTTGTARTTTG TTCTTTGACTATATTATTACCATTTTTCAGGCTAGATTTTTG~GTGTT~TTT~TCGCTG~~----->7.0

kb ----ACTGAGTACTCTTTTGTAATGAAAAATATGTCATTT

uTrpTyrLeuArgLysPheGluGluTyrProLysPheArgLysIleI TGTTAGCATTGGTTAAATGTCT~GCGACAGI\ATTATTTCCTTTTTT~TTTTTTTTTCTTAG----------GTGGTACCTCCGcAAATTTGARGAGTATCCAAACTTCAG~TTA 259 leIleProPheLeuPhe"* TAATTCCATTTTTGTTTTAAGTGCGTTTTTCATGAAATTATCTTC~CTTG~GCTTT-----~xan 5 (1.3kb).

FIG. 1. Structure of functional human steroid 5cu-reductase gene. The DNA sequence of the 5’-flanking region, the exons, and the intron regions immediately adjacent to the exons is shown. Only a portion of the DNA sequence of exon 5 corresponding to the 3’-untranslated region of the mRNA is shown. The remainder of this sequence is described in Andersson and Russell (3). Two polymorphic nucleotides in exon 1 and exon 2 are circled. A TATA sequence in the 5’-flanking region of the gene is overlined. Amino acids in the coding region are indicated and numbered above the DNA sequence. Nucleotides in the 5’-flanking region are assigned negative numbers beginning with the base immediately upstream of the A of the ATG initiation codon.

end of the above cDNA may well represent the cap site of the gene. A second steroid 5areductase gene with a different structure (Fig. 2) was similarly isolated by hybridization to the cDNA. This gene did not contain introns and is 95% identical to the cDNA in the coding region. The predicted protein sequence encoded by this second gene is two amino acids longer than the cDNAencoded steroid 5a-reductase as a consequence of a duplication of 6 bp (GCGACG) encoding an AlaThr pair at the amino terminus. The second gene contains a termination codon in place of that specifying amino acid 147 of steroid 5a-reductase (Fig. 2). The presence of the stop codon was independently confirmed in the genomes of six unrelated individuals by amplifying and sequencing this region of DNA (data not shown),

suggesting that this alteration does not represent a cloning artifact. The 5’ and 3’ ends of the gene shown in Fig. 2 have unusual structures. The 5’ boundary is homologous with the intron-containing gene of Fig. 1 to a point that is just upstream of the TATA sequence, whereupon a sequence corresponding to the 3’ end of a human long interspersed nucleotide element (LINE sequence) is encountered (Fig. 2). Similarly, the 3’ end of this gene is homologous to the cDNA and gene of Fig. 1 to a point corresponding to nucleotide 1990 in the 3’-untranslated region of the cDNA (Andersson and Russell, 1990). The second gene then terminates in a series of eight adenine residues and is thereafter not homologous to the cDNA (Fig. 2). Finally, at the 5’ and 3’ boundaries of this gene are located 12-bp per-

1106

JENKINS

ET

AL. 100

TCTAGAACTGGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCrAT~AGACACATGCACACGTATG TTTATTGTGGCACTATTCACAATAGCAAAGACTTGGAAACAACCCAAATGTCCAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGTCATAAllA

220

AATGATGAGTTCATGTCCTTTGTAGGGACATGGATGAAATTGGAAATCATCATTCTCAGCAAACTATCACAAGGACAAAAAAACCAAACACCGCATGTTCTCACTCATAGATGGGAACTG

340

AACAATGAGAACACATGGACACAGGAAGGGGAACATCACACTCTGGGGACTGTTGTGGGGTGGGGGGAGGGGGGAGGGTTAGCATTAGGAGATATACCTAATGCTAAATGACGAGTTAAT

460

GGGTGCAGCACACCAGCATGGCACATGTATACATATATAACTAACCTGCACATTGTGCACATGTACCCTAAAACTTAAAGTATAATAATAATTAAAAAAAGAAAAAAAAAGAATAAAGAA

580

.A

”

”

1 10 20 30 MetAlaThrAlaThrAlaThrAlaValValGluGluArgLeuLeuAlaAlaPheAlaTyrLeuGlnCysAlaValGlyCysAlaValPheAlaArgAsnArgGlnThrAsnSerValTyr ATGGCGACGGCGACGGCGACGGCGGTGGTGGAGGAGCGCCTGCTGGCTGCGTTCGCCTACCTTCAGTGCGCCGTGGGCTGCGCGGTCTTCGCTCGG~TCGTCAGACGAACTCAGTGTAC

40

70 11 50 60 SerArgHisAlaProProSerArgArgLeuArgValProAlaArgAlaThrArgValValGlnLysLeuProSerLeuAlaLeuProLeuTyrGlnTyrThrSerGluSerThrProArg AGCCGCCACGCGCCACCCAGCCGCAGGCTCCGAGTGCCGGCGCGGGCCACCCGGGTGGTGCAG~GCTGCCCTCACTGGCCCTGCCGCTCTACCAGTACACCAGTGAG7CCACCCCGCGC

80

81 90 100 110 LeuArgSerAlaProSerCysIleLeuLeuAlaMetPheLeuValHisTyrTrpHisArgCysLeuIleTyrProPheLeuMetArgGlyGlyLysProValProLeuLeuAlaCysThr CTCCGCAGCGCGCCCAGCTGCATCCTCCTGGCCATGTTCCTCGTCCACTACTGGCATCGGTGCTT~TTTACCCATTTCTGATGCGAGGAGGAAAGCCTGTGCCACTGTTGGCGTGCACA

121 130 140 MetAlaIleMetPheCysThrCysAsnGlyTyrLeuGlnSerArgTyrLeuSerHisCysAlaValTyrAlaAspAs ATGGCGATTATGTTCTGTACCTGTAATGGCTATTTGCAAAGCAGATACTTGAGCCATTGTGCAGTGTATGCTGATGA

820

940 120 1060

150 160 alLysAspProArgPheLeuIleAsnPheGlyLeuTrp TAAAAGATCCCCGTTTTCTAATAAATTTTGGCTTGTGG

190 170 180 LeuThrGlyMetLeuIleAsnIleHisSerAspHisIleLeuArgAsnLeuArgLysAlaGlyAspThrGlyTyrLysIleProArgGlyGlyLeuPheGluTyrIleThrAlaGlyAsn TTAACGGGCATGTTGATAAACATCCATTCAGATCATATCCTAAGG~TCTCAGAAAAGCAGGAGATACTGGATACAAAATACCAAGGGGAGGCTTATTTG~TACATAACTGCAGGC~C

200

201 210 220 230 TyrPheGlyGluIleMetG1uTrpArgGlyTyrAlaLeuAlaSerTrySerValGlnGlyAlaThrPheAlaPhePheThrPheCysPheLeuSerGlyArgAlaLysGluHisHisGlu TATTTTGGAGAAATCATGGAGTGGCGTGGCTATGCCCTGGCCAGCTGGTCTGTCCAAGGCGCGACTTTTGCTTTCTTCACATTTTGTTTTTTATCTGGTAGAGC~AGAGCATCATGAG

240

161

241 250 ArgTyrLeuArgLysPheGluGluTyrProLysPheArgLysIleIleIleProPheLeuPh CGGTACCTCCGGAAATTTGAGAGTATCC~GTTCAGAA~TTAT~TTCCATTTTTGTT

1180

1300

1420

260 * a

TGCATTTTTCACGAAATTACCTTCAACTTGAAGCTT.....-I.l4kb.....

1523

.W'. . . . . . . TGCTTTAAAAAAAAGATTCAGATCACAGCTTCTTTCTTCATTGGGAG~CGGGCACTCAGTCTGCTCTGCATGGAAACCAACGTCTTTGCTCATTCACATGTGCATTCTTGGGCATCTTT

FIG. 2. Structure of human steroid 5a-reductase pseudogene. The DNA sequence of a second genomic DNA hybridizing with the steroid 5ol-reductase cDNA is shown. Nucleotides are numbered on the right beginning with the most 5’ base sequenced and amino acids are numbered above the protein sequence. The sequence similarity between the functional gene and pseudogene begins at a 5’-boundary demarked by the 3’-end of a LINE sequence (arrow in sequence) and includes the TATA sequence (overline). The 12-bp sequences that are directly repeated at the 5’- and 3’-ends of the pseudogene are indicated by arrows above the sequence. A translation termination codon at amino acid residue 147 is boxed as is the termination codon at the end of the coding region. An oligoadenylate tract at the 3’-end of the gene is underlined.

feet direct repeats (GATTCAGATCAC, Fig. 2). These features of the second gene suggest that it is a nonfunctional processed pseudogene (Vanin, 1984). To obtain evidence that the intron-containing gene of Fig. 1 was functional, the S-flanking region was assayed for its ability to drive transcription of a marker gene. A 0.528-kb fragment (nucleotides -556 to -28, Fig. 1) from the 5’ end of the gene was fused to the bacterial chloramphenicol acetyltransferase (CAT) gene, and the resulting chimeric construct was transfected into cultured liver cells. The data of Fig. 3 indicate that inclusion of this fragment in the CAT plasmid resulted in the transient expression of CAT enzyme activity. A similar experiment was not carried out with a DNA fragment from the 5’ end of the pseudogene; however, the 3’ end of the LINE sequence

does not contain the promoter of this family of repetitive DNAs (Swergold, 1990), making it unlikely that the steroid 5a-reductase pseudogene is expressed. To determine the chromosomal localization of the human steroid 5a-reductase genes, a 32P-labeled cDNA probe was hybridized to PstI- and BamHI-digested genomic DNA from a panel of 11 Chinese hamster X human somatic cell hybrids. Of the five human PstI fragments that were detected by the probe, three hybridized strongly (4.2,1.2, and 0.9 kb), and two hybridized weakly (3.6 and 3.0 kb) (Fig. 4, lane 2). Of the two weakly cross-hybridizing Chinese hamster PstI fragments, the 6.6-kb band was consistently detected (lanes 1 and 3-8), while the 3.3-kb band was variably detected (Fig. 4, lanes 3-8). In these experiments, the human 4.2-kb PstI fragment cosegregated with the

STEROID

PLASMID

% Conversion

1

CAT

1.8

1

2.0

5a-CAT

21

5u-REDUCTASE

1

23

1 TATAT 1

5’ -558

3’ CAT

FIG. 3. Transfection of steroid Ba-reductase-CAT chimeric genes into cultured mammalian cells. Human HepG2 cells were transfected as described under Experimental Procedures with a plasmid containing the bacterial CAT gene alone (CAT) or a fragment of the steroid 5a-reductase gene linked to the CAT gene (5~ CAT). Forty-eight h after transfection, cells were harvested and cell extracts corresponding to 25 p-galactosidase units (Ref. (14)) were assayed in duplicate under standard conditions (2 h, 37°C) prior to determining CAT enzyme activity by thin layer chromatography. An autoradiogram of the results is shown. The percentage of the starting [i4C]chloramphenicol substrate converted into acetylated product was determined by scintillation counting of the appropriate zones from the chromatogram. A schematic of the steroid 5cu-reductase-CAT gene is shown at the bottom of the figure.

human X chromosome. For example, the hybrids in lanes 3,6, and 7 (Fig. 4) are positive for the 4.2-kb P&I band and contain the human X chromosome, but not chromosome 5. In a hybrid containing human chromosome 5 in the absence of the X chromosome, the 3.6-, 3.0-, 1.2-, and 0.9-kb human PstI fragments are present (Fig. 4, lane 5). All human PstI fragments are present in a hybrid containing both human chromosomes 5 and X (Fig. 4, lane 8). No signals corresponding to human steroid 5a-reductase gene fragments were detected in hybrids without human chromosomes 5 or X (e.g., hybrid in Fig. 4, lane 4). The presence of the 4.2-kb human PstI fragment, representing the pseudogene, is concordant with the presence of an intact X or the presence of the long arm of this chromosome, while all other human chromosomes were excluded by at least six discordant hybrids (Table 1). The other four human PstI fragments, presumably derived from the functional gene, segregate with human chromosome 5, and all other human chromosomes were excluded by at least three discordant hybrids (Table 1). To confirm the assignment of the pseudogene to the X chromosome, EcoRI fragments harboring indi-

1107

GENE

vidual exons of the functional gene and the pseudogene were first identified by Southern blotting analysis of cloned and genomic DNA with exon-specific probes (Fig. 5). When the hybridization patterns obtained with a full-length cDNA probe and DNA from individuals with a normal 46,XY or a 49,XXXXY karyotype were then compared, only the EcoRI fragment corresponding to the pseudogene was seen to vary in intensity between these two DNA samples (Fig. 5). Densitometric scanning of a shorter exposure of the autoradiogram indicated that the intensity of the signal arising from the pseudogene-containing EcoRI fragment was 3.7-fold more intense in the 49,XXXXY sample than that of the 46,XY sample. This result confirms the somatic cell hybrid panel assignment of the pseudogene to the X chromosome and the functional gene to an autosome. Regional mapping of the steroid 5cu-reductase pseudogene was carried out with BarnHI- or BglII-digested DNA from 10 somatic cell hybrids containing different regions of the human X chromosome. The restriction fragments that were previously identified as Xspecific were scored in these hybrids, and the SRDSAPl locus was assigned to the smallest overlap-

12345678

Pstl FIG. 4. Mapping of human SRDMl and SRD5APl. Hybridization of a2P-labeled human cDNA probe to a Southern blot of PstIdigested DNA from Chinese hamster x human hybrid cell lines and controls. Lane 1, Chinese hamster control; lane 2, human control; lanes 3-8, Chinese hamster X ‘human hybrid cell lines. Lanes 3 and 6-8 are positive for the 4.2-kb human SRD5APl fragment and lanes 5 and 8 contain the 3.6-, 3.0-, 1.2-, and 0.9-kb human SRDMl bands. The 3.6- and 3.0-kb fragments that hybridize weakly were clearly visible on the original autoradiogram.

1108

JENKINS

ET

TABLE Discordancy

Analysis

1

of Human SRD5Al and SRDSAPl Sequences with in Rodent X Human Somatic Hybrid Cell Lines Human

1

2

3

AL.

4

5

6

7

8

9

10

Human

Chromosomes

chromosome

11

12

13

14

15

16

17

18

19

20

21

22

X

SRDMl Discordant Informative

7 17

6 16

6 16

3 14

0 17

5 16

8 15

6 18

5 15

8 18

5 15

6 18

7 17

7 16

10 18

6 17

4 17

8 16

5 16

4 18

9 17

7 17

6 7

% Discordant

41

38

38

21

0

43

53

33

33

44

33

33

41

44

56

35

24

50

31

22

53

41

86

SRDM PI Discordant Informative

9 17

8 16

8 16

8 14

12 17

7 16

10 15

11 18

9 15

11 18

8 15

10 18

9 17

6 16

11 18

9 17

13 17

6 16

8 16

11 18

9 17

7 17

0 7

%Discordant

53

50

50

57

71

44

67

61

60

61

53

56

53

38

61

53

76

38

50

61

65

41

0

Note. The numbers of hybrids that were concordant and discordant with the human each chromosome. Since hybrids in which a particular chromosome was structurally excluded, the number of informative hybrids differs among chromosomes.

ping region of the X chromosome present in the positive hybrids, region q24-qter on the distal long arm (data not shown). To localize SDRSAl more precisely, two genomic clones with large inserts were labeled with biotindUTP and hybridized to human metaphase chromosomes. Hybridization sites were detected by avidinFITC binding visualized in a fluorescent microscope. Sites of specific hybridization were identified by the presence of signal side-by-side on both chromatids. Of the 31 metaphase spreads analyzed 10 had signal on both chromatids of one chromosome 5 at a subtelomerit location of the short arm corresponding to band ~15, and 6 had signals at this site on both chromosomes 5 (data not shown). No signal was detected on the X chromosome, as expected given the short stretch of DNA available for hybridization at the site of the integrated pseudogene. The mouse steroid So-reductase gene (Srd&z-1) was positioned on the murine chromosomal complement by Southern blotting analysis of a panel of 13 mouse X rodent somatic cell hybrids having reduced numbers of mouse chromosomes. After hybridization of a 32P-labeled rat steroid 5cY-reductase cDNA probe to P&I-digested genomic DNA, two fragments of 7.8 and 5.8 kb were detected in control mouse DNA (Fig. 6, lane l), a single 6.8-kb fragment in Chinese hamster DNA (lane 2), and three fragments of 6.2,4.6, and 1.8 kb in control rat DNA (lane 7). In hybrids that contained mouse chromosome 13, the signals corresponding to SrdsSu-1 were present as well as the Chinese hamster or rat fragments (Fig. 6, lanes 4-6). No signal from the mouse gene was detected in hybrids

SRDMl rearranged

or

SRDMPl or present

sequences were determined for in fewer than 10% of cells were

that did not contain mouse chromosome 13 (lane 3). The positive rat X mouse hybrid in lane 6 (RTMS) contains only a single mouse chromosome, an Rb(11;13) fusion (Miinke et al., 1986). Since mouse chromosome 11 is not retained in any of the Chinese hamster X mouse hybrids analyzed in Fig. 6, the finding of a positive signal in the RTM9 hybrid suggests that Srd5a-1 is on chromosome 13. Both murine hybridizing fragments were perfectly concordant with chromosome 13 in all hybrid cell lines, and all other mouse chromosomes, including the X, were discordant in three to eight hybrid lines. Southern blot analysis of DNA from several inbred mouse strains using the rat cDNA probe revealed two distinct fragment patterns in autoradiograms for each of eight different restriction enzyme digests (data not shown). In addition to two or more constant bands, there was at least one fragment that migrated in AKR/J, C3H/HeJ, and DBA/BJ DNAs about 2 kb farther than in C57BL/6J and C57L/J DNAs. These results were consistent with an insertion/deletion polymorphism. The polymorphism was studied in two sets of recombinant inbred strains: BXD (progenitors: C57BL/6J and DBA/2J) and AKXL (progenitors AKR/J and C57L/J). The strain distribution patterns are summarized in Table 2 and are compared with those of Xmu-13 (Frankel et al., 1989), As-l, LthI (Elliott et al., 1985), and Rasa (Hsieh et al., 1989). Close linkage between SrdSa-1 andXmv-13 is evident with one recombinant among the 26 BXD strains and no recombinants in the 18 AKXL strains analyzed. We conclude that the SrdSa-1 gene is located near Xmu-13, most likely on the proximal side of this

STEROID

5~REDUCTASE

KARYOTYPE kb

23-

+ Exon 1 N-- Exon 2 f- Exon 5 c Exon 3 Ic- Pseudogene

1109

GENE

DNA from a small family was analyzed, the HinfI site was in fact polymorphic and segregated as a codominant marker in the offspring. Analysis of 52 chromosomes from 26 unrelated individuals indicated that the allele containing the site was present at a frequency of 0.58, while the allele lacking the site was present at a frequency of 0.42. Similar results were obtained for the NspI site in exon 2. The right panel of Fig. 7 shows an analysis of amplified DNA from a four-member family in which the presence or absence of the site is seen to segregate in a codominant fashion. Analysis of 56 chromosomes indicated that the frequency of the allele containing the site was 0.45 and was 0.55 for the allele lacking the site. DISCUSSION

FIG. 6. Gene dosage studies. Southern blot analysis of EcoRIdigested DNA from cells with the indicated karyotype was carried out, as described under Materials and Methods, using the fulllength human steroid Ba-reductase cDNA as a probe and stringent washing conditions (2 h, 65”C, in 0.1X SSC, 1% SDS). Fragments containing exons 1 through 5 of the functional gene and the pseudogene are labeled on the right of the autoradiogram. The positions to which DNAs of known size migrated to in an adjacent well are shown on the left.

marker on mouse chromosome 13. The order of genes on the distal half of this chromosome would thus be: centromere - Srd5a - 1 -Xmv-13,fs-Dhfr-Hexb-Lth-1, Rasa-As-l -telomere. DNA sequence analysis of the exons of the human SRD5Al gene revealed two discrepancies between the sequence of the cDNA and those of exons 1 and 2. As indicated by the circled nucleotides in Fig. 1, both alterations occurred in the third position of a codon and would not result in a change of the amino acid sequence of the enzyme. However, each nucleotide change did have the potential to disrupt the recognition sequence of a restriction enzyme. The G to C change in exon 1 was present in the first position of a HinfI site (GANTC), while the A to G change in exon 2 was present in the third position of an NspI site (A/GCATGC/T). To determine if the observed changes represented potentially useful RFLPs, DNA corresponding to exon 1 or exon 2 was amplified from genomic DNA using the polymerase chain reaction as described under Materials and Methods and then assayed for the presence or absence of the HinfI or NspI sites, respectively. As shown in the left panel of Fig. 7, when

We describe the characterization and chromosomal mapping of two human steroid 5a-reductase genes that hybridize to a previously cloned cDNA and the mapping of a mouse homologue. One human gene (SRDSAI) matched the sequence of the cDNA and contained five exons, four introns, and a 5’-flanking sequence capable of expressing a reporter gene upon transfection in cultured mammalian cells. Chromosome mapping studies indicated that the gene was located on chromosome 5 band p15 in humans and chromosome 13 in mice. A second hybridizing sequence was mapped to the long arm of the X chromosome (q24-qter) and was tentatively identified as a steroid 5cu-reductase pseudogene (SRDSAPI) based

1234567

Pstl FIG. 6. Mapping of Srd5w1 in mouse. Hybridization of “P-labeled rat steroid 5cy-reductase cDNA probe to a Southern blot of PstI-digested DNA from rodent X mouse hybrid cell lines and controls. Lanes 1,2, and 7 contain mouse, Chinese hamster, and rat control DNA, respectively. Lanes 3-5, DNA from Chinese hamster X mouse hybrid cell lines; lane 6, rat X mouse hybrid cell line.

1110

JENKINS

ET

TABLE Strain

Distribution

Pattern

of Chromosome

13 Loci BXD

000000111111112 1 2 5

Loci

6

8

9

Srd5a-1

BDBDBDDDDDDDBBDDBDDDDDBDBD

Xmv-13”

~DBDBDDDDDDDBBDD

Ra.sab

DDBiBDDDDDDDBBD-BDD;DDBD:D

Lth-1”

DDBBBDDDDDDDBBD

As-l a

DDBBBDDDDDDDBBi-BDDBDDB--D

1

2

3

4

5

6

AL.

2 in Recombinant strain

8

Inbred

BXD

and AKXL

Strains

number

9

0

222222223 1 2

3

4

5

7

8

9

0

33 1

2

BDDDDDBDBD

-BDDBDDB--D

AKXL

strain

number

000001111112222233 567892346791458978

Srd5a-1

AALLLALLAAALALLLLA

Xmv-13”

AALLLALLAAALALLLLA

As-l’

AAL:L:L:AA;:ALLL

Lth-1’

LALALLLAAALAA~LLAA

’ Data b Data ’ Data

from from from

:

A

Ref. (11). Ref. (15). Ref. (8).

on the observations that this gene had no introns, an unusual 5’-flanking region, rearrangements and stop codons in the coding region, an oligo-A track at its 3 end, and 12-bp perfect direct repeats at its 5’ and 3’ ends. The functional steroid 5a-reductase gene on chromosome 5 spans at least 35 kb of DNA. Despite numerous screenings of multiple genomic DNA libraries, we have not yet succeeded in obtaining clones that span intron 1 or intron 4 of the gene. For this reason, only a minimum estimate for the sizes of these two introns (>14 and >7.0 kb, respectively), and of the gene itself, can be made. The sequences at the intronexon boundaries of the gene match those of the consensus mammalian splice donor and acceptor sites (Padgett et aZ., 1986), and the sizes of the five exons agree well with those predicted by the exon-scanning model of splicing (Robberson et al., 1990), with exon 1 and exon 5 being the largest of the gene. The DNA sequence of the steroid 5a-reductase pseudogene in the coding region is 95% identical (39 mismatches out of 780 nucleotides) to that of the functional gene. By using a calculated mutation rate for pseudogenes of 4.6 X lo-’ per nucleotide site per year (Li et al., 1981), it is possible to estimate that the

event leading to the formation of the pseudogene occurred approximately 10 million years ago. This estimate predicts that members of the primate superfamily Hominoidea that diverged from humans less than 10 million years ago, such as the gorilla and chimpanzee (Pilbeam, 1984), would contain the steroid 5a-reductase pseudogene, whereas those that diverged prior to this event, such as the orangutan and gibbon (Pilbeam, 1984), would lack the pseudogene. The apparent absence of a second hybridizing sequence in the mouse is consistent with the predicted pseudogene formation time frame. Several different approaches were used to assign the functional steroid 5a-reductase gene to human chromosome 5 band p15 and mouse chromosome 13 and to assign the human pseudogene to the X chromosome in the q24-qter region. The strain distribution patterns of an SrdSa-1 polymorphism among different recombinant inbred strains of mice demonstrate close linkage of the SrdSa-1 gene with Xmu-13 on the distal half of chromosome 13 (Table 2). These genes are part of a conserved region that is well-defined and includes six other loci on chromosome 13 in the mouse, Arsb, Dhfr, Hexb, Htrlu, Hmgcr, and Rasa, whose human homologues have been assigned to the

STEROID

5~REDUCTASE

1111

GENE

Nsp I I

EXONHinfI

h5a35 w

h5al4 288 bp

I

EXON 1

137 bp

I

-I 151 bp

-I

h5a36 I I

210 bp 136 bp

, 72bp

I ,

FIG. 7. Restriction fragment length polymorphisms in human steroid 5cu-reductase gene. Left: HinfI polymorphism in exon 1. Genomic DNAs derived from members of a small family were amplified with the oligonucleotides h5a35 and h5a36 to produce a ZlO-bp fragment corresponding to a region of exon 1. A portion (10%) of the amplification reaction was digested with Hi&I, electrophoresed on a neutral polyacrylamide gel, transferred to a nylon filter by electroblotting, and probed with 32P-labeled h5a35. If the Hid site is present, then the 210-bp fragment is cleaved into 138- and 72-bp fragments. Only the 138-bp fragment hybridizes with the h5a35 probe and is thus visualized in the autoradiogram shown at the bottom. Right: NspI polymorphism in exon 2. Genomic DNAs from the same family members were amplified with the oligonucleotides h5a8 and h5a14 to produce a 288-bp fragment corresponding to exon 2 of the gene. Detection of the polymorphic NspI site was carried out as described above, except that two 32P-labeled oligonucleotides (h5a8, h5a14) were hybridized to the filter. The presence of the NspI site results in the cleavage of the amplified DNA into 151- and 137-bp fragments.

proximal long arm of chromosome 5 (ten-q14). On mouse chromosome 13, this region appears to involve the distal band 13D or l3C-D and spans the genetic map between 52 and 69 CM from the centromere (Davisson et al., 1990; Lyon and Kirby, 1990). Genes on other regions of human chromosome 5 have been mapped to conserved clusters on mouse chromosomes 11, 15, and 18. As summarized in Davisson et al. (1990), genes on the proximal short arm of human chromosome 5 (including the growth hormone receptor) have been mapped to mouse chromosome 15, and genes on the distal long arm of chromosome 5 have been assigned to mouse chromosomes 11 and 18. On the basis of these considerations, we would have predicted that the human SRDSAl locus was located on the proximal long arm of chromosome 5. However, fluorescent in situ hybridization indicated that SRDSAl is located in the subtelomeric band 5~15. Thus, a group of linked genes on mouse chromosome 13 has been disrupted on human chromosome 5. In a separate study (Jenkins et al., 1991), we have used the knowledge of the SRDSAl gene structure and RFLPs to exclude mutations at this locus in classic steroid 5a-reductase deficiency (Griffin and Wilson, 1989). These results suggest the presence of multiple steroid 5a-reductase genes in humans. Future genetic analyses should allow a characterization of the role of the SRD5Al gene in other endocrine dis-

orders in which steroid 5a-reductase is implicated, such as benign prostatic hyperplasia, male pattern baldness, acne, and cancer of the prostate. ACKNOWLEDGMENTS We thank Jeffry Cormier, Daphne Davis, Kathy Schueler, and Edith Womack for excellent technical assistance; Carla Leffert and Helen Hobbs for DNA samples; and Mike Brown, Joe Goldstein, and Jean Wilson for critical reading of the manuscript. This research was supported by Grants GM-43753 (to D.W.R.) and HG00298 (to U.F.) from the National Institutes of Health and by the Howard Hughes Medical Institute of which U.F. is an investigator and C-L.H. was an associate. E.P.J. is supported by a training grant (DK-07307) from the National Institutes of Health. K.N. is the recipient of Postdoctoral Fellowship HD 07411 from the National Institutes of Health. D.M.B. is supported by the Perot Family Foundation and Medical Scientist Training Grant GM08014 from the National Institutes of Health.

REFERENCES 1.

2.

3.

AGARWAL, A. K., MONDER, C., ECKSTEIN, B., AND WHITE, P. C. (1989). Cloning and expression of rat cDNA encoding corticosteroid ll&dehydrogenase. J. Bid. Chem. 264: 18,939-18,943. ANDERSSON, S., BISHOP, R. W., AND RUSSELL, D. W. (1989). Expression cloning and regulation of steroid 5a-reductase, an enzyme essential for male sexual differentiation. J. Biol. Chem. 264: 16,249-16,255. ANDER~ISON, S., AND RUSSELL, D. W. (1990). Structural and

1112

4.

JENKINS

biochemical properties of cloned and expressed human and rat steroid 5cu-reductases. Proc. Natl. Acad. Sci. USA 87: 3640-3644. BRUCHOVSKY, N., AND WILSON, J. D. (1968). The conversion of testosterone to 5u-androstan-17P-ol-3-one by rat prostate in uivo and in vitro. J. Biol. Chem. 243: 2012-2021.

5.

CHURCH, G. M., AND GILBERT, W. (1983). Genomic ing. Proc. Natl. Acud. Sci. USA 81: 1991-1995.

6.

DAVISSON, M. T., LALLEY, P. A., PETERS, J., DOOLITTLE, D. P., HILLYARD, A. L., AND SEARLE, A. G. (1990). Report of the comparative subcommittee for human and mouse homologies. Cytogenet. Cell. Genet. 55: 434-456. DEMARTINVILLE, B., KUNKEL, L. M., BRUNS, G., MORLE, F., KOENIG, M., MANDEL, J. L., HORWICH, A., LATT, S. A., GuSELLA, J. F., HOUSMAN, D., AND FRANCKE, U. (1985). Localization of DNA sequences in region Xp21 of the human X chromosome: Search for molecular markers close to the Duchenne muscular dystrophy locus. Am. J. Hum. Genet. 37: 235-249. ELLIOTT, R. W., DANIEL, W. L., TAYLOR, B. A., AND NOVAK, E. K. (1985). Linkage of loci affecting a murine liver protein and arylsufatase B. to chromosome 13. J. Hered. 76: 243-246. FEINBERG, A., AND VOGELSTEIN, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

ET 21.

HSIEH, C.-L., VOGEL, U. S., DIXON, R. A. F., AND FRANCKE, U. (1989). Chromosome localization and cDNA sequence of murine and human genes for ras p21 GTPase activating protein (GAP). Somat. Cell Mol. Genet. 15: 579-590. HSIEH, C.-L., STURM, R., HERR, W., AND FRANCKE, U. (1990). The gene for the ubiquitous octamer-binding protein Ott-1 is on human chromosome 1, region ten-q32, and near Ly-22 and Ltw-4 on mouse chromosome 1. Genomics 6: 666672. JENKINS, E. P., ANDERSSON, S., IMPERATO-MCGINLEY, J., WILSON, J. D., AND RUSSELL, D. W. (1991). Genetic andpharmacological evidence for more than one human steroid 5ol-reductase. J. Clin. Invest., in press. KADONAGA, J. T., JONES, K. A., AND TJIAN, R. (1986). Promoter-specific activation of RNA polymerase II transcription by Spl. Trends Biochem. Sci. 11: 20-23. LEHRMAN, M. A., SCHNEIDER, W. J., S~?DHOF, T. C., BROWN, M. S.. GOLDSTEIN. J. L.. AND RUSSELL. D. W. (1985). Mutation in LDL receptor: Alu-Alu recombination helet& exons encoding transmembrane and cytoplasmic domains. Science 227: 140-146. LI, W-H., GOJOBORI, T., AND NEI, M. (1981). Pseudogenes as a paradigm of neutral evolution. Nature 292: 237-239.

LIANG, T., AND HEISS, C. E. (1981). tase, receptor binding, and nuclear prostate by a 4-methyl-4-aza-steroid. 7998-8005.

Inhibition of 5cu-reducuptake of androgens in the J. Biol. Chem. 266:

22.

LICHTER, P., TANG, C-J. C., CALL, K., HERMANSON, G., EVANS, G. A., HOUSMAN, D., AND WARD, D. C. (1990). Highresolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247: 64-69.

23.

LUCKOW, B., AND SCHUTZ, G. (1987). CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res. 15: 5490.

24.

LYON, M. F., AND KIRBY, M. C. (1990). atlas. Mouse Genome 87: 28-54.

25.

M~~NKE, M., HARBERS, K., JAENISCH, R., AND FRANCKE, U. (1986). Chromosomal mapping of four different integration sites of Moloney murine leukemia virus including the locus for alpha l(1) collagen in mouse. Cytogenet. Cell Genet. 43: 140149.

26.

PADGE~, R. A., GRABOWSKI, P. J., KONARSKA, M. M., SEILER, S., AND SHARP, P. A. (1986). Splicing of messenger RNA precursors. Annu. Reu. Biuchem. 65: 1119-1150.

27.

PILBEAM, D. (1984). The descent Sci. Am. 250: 84-96.

28.

ROBBERSON, B. L., COTE, G. J., AND BERGET, S. Exon definition may facilitate splice site selection with multiple exons. Mol. Cell. Biol. 10: 84-94.

sequent-

FRANCKE, U., YANG-FENG, T. L., BRISSENDEN, J. E., AND ULLRICH, A. (1986). Chromosomal mapping of genes involved in growth control. Cold Spring Harbor Symp. Quant. Biol. 51: 855-866. FRANKEL,~. N., STOYE, J. P., TAYMR, B.A., AND COFFIN, J. M. (1989). Genetic analysis of endogenous xenotropic murine leukemia viruses: Association with two common mouse mutations and the viral restriction locus Fv-1. J. Virol. 63: 1763-1774. GEORGE, F. W., RUSSELL, D. W., AND WILSON, J. D. (1991). Feed-forward control of prostate growth. Dihydrotestosterone induces expression of its own biosynthetic enzyme, steroid 5ol-reductase. Proc. Natl. Acad. Sci. USA, in press. GRIFFIN, J. E., AND WILSON, J. D. (1989). “The Metabolic Basis of Inherited Disease,” 6th ed., pp. 1919-1944, McGrawHill, New York. HERBOMEL, P., BOURACHOT, B., AND YANIV, M. (1984). Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell 39: 653-662.

AL.

Mouse

of hominoids

chromosome

and hominids.

M. (1990). in RNAs

29.

SAMBROOK, J., FRITSCH, E. F., AND MANIATIS, T. (1989). “Molecular Cloning: A Laboratory Manual,” pp. 1-18.8, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

30.

SANGER, F., NICKLEN, S., AND COULSON, A. R. (1977). sequencing with chain-terminating inhibitors. Proc. Acad. Sci. USA 74: 5463-5467.

31.

SEARLE, P. F., STUART, G. W., AND PALMITER, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Mol. Cell. Biol. 5: 1480-1489.

32.

SMITH,

L. M.,

DNA Natl.

SANDERS,

J. Z., KAISER, R. J., HUGHES, P., C., KENT, S. B. H., AND HOOD, L. E. (1986). Fluorescence detection in automated DNA sequence analysis. Nature 321: 674-679.

DODD, C., CONNELL, C. R., HEINER,

33.

SWERGOLD, G. D. (1990). Identification, and cell specificity of a human LINE-l Biol. 10: 6718-6729.

34.

VANIN, E. F. (1984). Processed pseudogenes. and evolution. Biochim. Biophys. Acta 782:

35.

WIEACKER, P., DAVIES, K. E., COOKE, H. J., PEARSON, P. L., WILLIAMSON, R., BHA’ITACHARYA, S., ZIMMER, J., AND ROPERS, H-H. (1984). Toward a complete linkage map of the human X chromosome: Regional assignment of 16 cloned single-copy DNA sequences employing a panel of somatic cell hybrids. Am. J. Hum. Genet. 36: 265-276.

36.

WILSON, J. D. (1975). Metabolism of testicular androgens. In “Handbook of Physiology” (R. 0. Greep and E. B. Astwood, Eds.), Vol. 5, pp. 491-508, American Physiological Society, Washington, DC.

37.

WILSON, Physiol.

38.

WILSON, J. D. (1980). The pathogenesis hyperplasia. Am. J. Med. 68: 745-756.

39.

YANG-FENG, T. L., DEGENNARO, L. J., AND FRANCKE, U. (1986). Genes for synapsin 1, a neuronal phosphoprotein, map to conserved regions of human and murine X chromosomes. Proc. Natl. Acad. Sci. 83: 8679-8683.

J. D. (1978). 40: 279-306.

Sexual

characterization, promoter. Mol. Cell.

differentiation.

Characteristics 231-241.

Annu.

of benign

Rev.

prostatic