- Email: [email protected]
Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS Acta Histochemica xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep Shanshan Yang, Junzhen Zhang, Kaiyuan Ji, Dingxing Jiao, Ruiwen Fan ∗ , Changsheng Dong College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu 030801, PR China
a r t i c l e
i n f o
Article history: Received 10 September 2015 Received in revised form 16 December 2015 Accepted 11 January 2016 Available online xxx Keywords: cAMP cGMP Skin Sheep Soluble guanylate cyclase (sGC)
a b s t r a c t The study reported the characterization of soluble guanylate cyclase (sGC) with the size of CDS of 1860 bp, encoding a protein of 620 amino acids and containing several conserved functional domains including HNOB, HNOBA, and CHD. Quantitative real time PCR analysis of sGC showed that the expression of sGC mRNA is higher (∼5 fold) in white sheep skin relative to black sheep skin with significant difference (P < 0.01). Using a rabbit polyclonal anti-sGC antibody, an immune reactive band corresponding to sheep sGC protein was detected in the skin samples by Western blotting analysis, and the expression of sGC protein was significantly higher in white sheep skin compared to black sheep skin (P < 0.01). Immunohistochemical analysis revealed that sGC protein was localized in cytoplasm and intercellular substance of upper hair papilla in hair follicles of white sheep skin, but the protein was localized in cytoplasm and intercellular substance of lower hair bulb and outer root sheath cells in hair follicles of black sheep skin. The immunocytochemical analysis revealed that sGC was expressed in melanocytes in vitro of sheep skin. Over expression of sGC in melanocytes resulted in decreased expression of key melanogenic genes including microphthalmia transcription factor (MITF), tyrosinase (TYR), tyrosinase related protein 1(TYRTP1), and tyrosinase related protein 2(TYRP2) both at mRNA and protein level. Moreover, the melanocytes was capable of producing cGMP and cAMP. The observed differential expression and localization of sGC in sheep skins and melanocytes and the capability of producing cGMP and cAMP, which suggested a potential role for this gene in hair color regulation. © 2016 Elsevier GmbH. All rights reserved.
1. Introduction Sheep is one of the most important fiber-producing animals, and the diameter, length and color of fiber are the key traits contributing to the economic value. Currently, different colors of fibers in commercial production are produced by dying white fiber, which affects human health and environment. Thus, natural coat colors in sheep or other fiber-producing species such as alpacas are becoming of increasing interest due to the green revolution and consumer preference for natural products. Coat colors are determined by both genetics and environment, especially genetics. The phenotype of coat color of animals depends on two types of melanin, black to brown eumelanin and yellow to
∗ Corresponding author at: College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Shanxi, Taigu 030801, PR China. E-mail address: [email protected] (R. Fan).
reddish brown pheomelanin produced in mammalian melanocyte (Ito et al., 2000; Ito and Wakamatsu 2008). The genetic basis for coat color is well understood in rodents (Slominski et al., 2004; Steingrímsson et al., 2006). Some common genes implicated in the regulation of coat color are also well documented in other species including sheep. For example, MC1R and ASIP loci are functionally linked to undesirable coat color phenotypes in sheep (Våge et al., 1999; Norris and Whan 2008), and TYRP1 is a strong positional candidate gene for color variation in Soay sheep (Gratten et al., 2007). In a previous study, we characterized the transcriptome profiles of sheep skins with white and black coat color, and identified differentially expressed genes (Fan et al., 2013) including known coat color genes (e.g., DCT, MATP, TYR and TYRP1). One of the differentially expressed genes is soluble guanylate cyclase (sGC), which showed significantly higher expression in white vs. black sheep skin. Guanylate cyclases are a family of enzymes that catalyze the conversion of GTP to cGMP. The family comprises both membranebound (particulate guanylate cyclase, pGC) and soluble (soluble
http://dx.doi.org/10.1016/j.acthis.2016.01.002 0065-1281/© 2016 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
2
guanylate cyclase, sGC) isoforms that are expressed in nearly all cell types (Fan et al., 2013). sGC is involved in many signal transduction pathways, most notably in the cardiovascular system and the nervous system (Denninger and Marletta 1999). The present study reports the characterization of sGC expression in sheep skins with white and black coat color, providing evidence to suggest that sGC might be related to coat color formation. 2. Materials and methods 2.1. Sheep and tissue collection Housing and care of sheep and collection of skin samples for use in the described experiments were conducted in accordance with the International Guiding Principles for Biomedical Research Involving Animals (http://www.cioms.ch/index.php/ 12-newsflash/365-announcement) and approved by the Animal Experimentation Ethics Committee of Shanxi Agricultural University, Taigu, China. Six healthy 2-year-old male sheep with white and black coat color phenotype (3 sheep per color) were used in the study, which were from the sheep farm in Sunite, Inner Mongolia, China. Skin samples of 8 mm diameter from the back of sheep were collected. For each sample, part of the tissue was flash frozen in liquid nitrogen and stored at −80 ◦ C until RNA and protein extraction, and the remaining part was fixed in 4% formaldehyde for paraffin sections. 2.2. Construction of plasmids The coding sequence of sheep sGC was obtained by PCR using sheep skin cDNA as a template with primers containing ScaI and XhoI sites (Table 1). The PCR product of sGC and the pmirGLO vector (Promega, Fitchburg, WI) were digested with ScaI and XhoI and then ligated together to obtain the pmirGLO-sGC construction. 2.3. Cell culture and transfection All melanocyte cell cultures of sheep used in this study were established by our lab. Skin samples used for established the melanocyte lines were obtained from the sheep which were from the sheep farm in Sunite,Inner Mongolia, China. Cell were transfected with the pmirGLO-sGC plasmid using lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Three days after transfection, melanocytes were collected. Total RNA and Cell lysates were prepared and subjected to real-time PCR and Western blot analyses, respectively. 2.4. Quantitative real time PCR analysis Total RNA was isolated from sheep skin samples using Trizol reagent (Invitrogen). The concentration of total RNA was determined using NanoDrop 1000 spectrophotometer (NanoDrop Technology). Prior to reverse transcription, total RNA was treated with DNaseI (Ambion) to eliminate genomic DNA contamination. Two microgram of treated total RNA from each sample were converted to cDNA using Prime ScriptTM RT reagent kit Table 1 Primers used in this study. Primer name
Primer sequence 5 -3
Application
sGC-F1 sGC-R1 sGC-F2 sGC-R2 -actin-F -actin-R
GGTCAAGGAAGAGGTCGACG GATGACTGGTGTCTCCCGGT CGAGCTCCAGATGATCTACTTGCCTGAA GCTCTAGATATCTGAACAGATTCACCGTCTACT CCTGACCGGGAAGAGGAATC AAAAACAGGGGGTTGAACTC
Real time PCR Real time PCR RT-PCR RT-PCR Real time PCR Real time PCR
(TaKaRa). Negative control RT reactions were also performed at the same time. Real-time PCR primers for sGC, MITF, TYR, TYRP1, and TYRP2 gene and the endogenous control gene (-actin) were designed using primer3plus software (http://www.biowebdb.org/ primer3plus/, see Table 1). Quantitative real time PCR was performed using SYRB Premix Ex TaqTM II (TaKaRa) in triplicate for each sample on a 7500 Fast Real-Time PCR System (Applied Biosystems). Quantification of sGC, MITF, TYR, TYRP1 and TYRP2 transcript abundance was performed using the comparative threshold cycle (CT) method (Livak and Schmittgen 2001). The relative amount of mRNA was normalized to the amount of -actin mRNA. 2.5. Immunohistochemistry Paraffin sections were dehydrated with increasing concentrations of ethanol (80–100%), followed by incubation in 3% hydrogen peroxide for 10 min at room temperature to block the action of any endogenous peroxidase. After washing with 0.1 M PBS three times for 15 min, the sections were boiled for 10 min in 0.01 M citric acid. This was followed by a 20-min immersion in PBS containing 5% BSA at 37 ◦ C. Sections were then incubated at 4 ◦ C overnight in 1:100 diluted rabbit anti-sGC primary antibody (Abcam, ab53084, USA, used for WB, IHC-P). Following three times of washing in PBS, sections were incubated in 1:500 diluted HRP conjugated goat anti-rabbit IgG (CWBIO, Beijing, China) for 30 min at 37 ◦ C. After washing with PBS three times, sections were developed with DAB and the positive signal was observed using a Leica microscope (Leica Microsystems). PBS was substituted for the primary antibody for the negative control. 2.6. Western blotting Total protein extraction from sheep skins was performed using WB/IP lysis buffer following the manufacturer’s instruction (Beyotime, Beijing, China). Protein concentrations were measured by the BCA method using bovine serum albumin as the standard. Protein extracts were denatured at 95 ◦ C for 5 min, and the same amount of protein (150 g) from each sample was separated by 10% SDS-PAGE and electroblotted onto a nitrocellulose membrane. Immunoblotting was carried out with 1:200 diluted rabbit anti-sGC antibody(Abcam, ab53084, USA, used for WB, IHC-P), 1:500 diluted rabbit anti-MITF antibody (Abcam, ab20663, USA, used for ICC/IF, WB), 1:500 diluted rabbit anti-TYR antibody (Abcam, ab180753, USA, used for ICC/IF, WB, IHC-P), 1:500 diluted rabbit anti-TYRP1 antibody (Abcam, ab73873, USA, used for WB, IHC-P), 1:500 diluted rabbit anti-TYRP2 antibody (Abcam, ab74073, used for IHC-P, WB, ELISA) and 1:1000 diluted rabbit anti--actin antibody (CWBIO, CW0097, Beijing, China,used for WB, ELISA) in 5% milk blocking buffer at 4 ◦ C overnight. After washing in TBST, the membrane was incubated with HRP conjugated goat anti-rabbit IgG (CWBIO, Beijing, China) for 1 h at room temperature (1:2000 diluted in 3% blocking buffer). Following several washings with TBST, the signals were detected using an ECL kit (CWBIO, Beijing, China). The intensity of the signals for sGC and -actin was qualified using Image-Pro Plus Software (Olympus). 2.7. Immunocytochemistry In order to investigate the sGC expression in melanocytes, melanocytes were washed three times in 0.1 M PBS for 3 min each, fixed in 4% paraformaldehyde, and then incubated at room temperature in 3% hydrogen peroxide for 15 min to block the action of any endogenous peroxidase. After washing with 0.1 M PBS three times for 5 min each, cells were immersed in BSA at 37 ◦ C for 40 min. Cells were then incubated at 4 ◦ C overnight in anti-sGC antibody(Abcam, ab53084, USA, used for WB, IHC-P) solution. Following washing
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
3
Fig. 1. Alignment of deduced amino acids sequence of sheep and other animals. It showed high similarity among those animals. The domains of deduced amino acids of sheep were highlighted with different colors.
three times in 0.1 M PBS for 5 min each, cells were incubated with HRP-conjugated anti-rabbit IgG (CWBIO, Beijing, China) for 30 min at 37 ◦ C. Immunostaining of the cells was then observed under a microscope (Leica). For negative controls, PBS was substituted for the primary antibody.
2.8. cGMP and cAMP assays To investigate the capability of producing cGMP and cAMP in sheep melanocytes (stored by our lab), the production of cGMP and cAMP was measured. Following the collected cells (1 × 106 ) was treated with 0.1 M HCl, incubated for 10 min and visually inspected
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
4
Fig. 2. Real time PCR analysis of sGC mRNA expression in sheep skins with white and black coat color. sGC mRNA was normalized relative to abundance of -actin and the experiment was replicated three times (n = 3). Bars represent the mean ± standard error. ** P < 0.01.
to verify cell lysis, the cell lysates were centrifuged at 600 × g for 10 min at room temperature, and the supernatants were collected and used directly in the assays. Concentrations of cGMP and cAMP were determined by enzyme-linked immunosorbent assay (ELISA) after acetylation of the samples according to the manufacturer’s instructions (NewEast Biosciences, PA, USA).
Fig. 3. Western blot analysis of sGC protein expression in sheep skins with white and black coat color. (A) Western blot showing differential expression of sGC protein between white and black sheep skin. (B) Quantitative analysis of sGC protein bands (n = 3) using the Image-Pro Plus software. Data were normalized to -actin and expressed as relative fold change. Bars represent the mean ± standard error. ** P < 0.01.
2.9. Statistical analysis The differences in abundance mRNA and protein were determined by analysis of variance using SPSS 16. 0 software. A one-way analysis of variance (ANOVA) testing was used to determine statistical differences. The data was expressed as mean ± standard error. 3. Results and discussion From the skin transcriptome profile of sheep with different hair color, we found that sGC was expressed differently, which suggested that sGC may be related to the coat color (Fan et al., 2013). Here sGC was isolated and characterized and then anylyzed the expression to support the possibility. The full length of CDS is 1860 bp, encoding a protein of 620 amino acids. The deduced amino acid sequence shares ∼99% sequence similarity with sGC proteins from other species including human, rat, pig, dog, cattle and sheep. The protein is predicted to contain several conserved functional domains including HNOB (Heme NO Binding), HNOBA (Heme NO Binding Associated), and CHD (Cyclase Homology Domain) (Fig. 1). Quantitative expression of sGC mRNA in white and black sheep skin was analyzed by real time PCR. As shown in Fig. 2, the expression of sGC mRNA is significantly higher (5 fold) in white than black sheep skin (P < 0.01). Western blot analysis showed that the size of the sheep sGC protein is around 70 kDa and that the expression of sGC protein in white sheep skin is higher compared to black sheep skin (Fig. 3A). Quantitative analysis showed that the average intensity of the sGC protein bands is ∼2.5 times stronger in white sheep skin than black sheep skin with significant difference (P < 0.01) (Fig. 3B). As shown in Fig. 4A, the expression of sGC is significantly higher (7 fold) in cells transfected than untransfected (P < 0.05). The expression of sGC protein in transfected cells is higher compared to untransfected cells(Fig. 4B). Quantitative analysis showed that the average intensity of the sGC protein bands is ∼2.7 times stronger in transfected cells than untransfected cells with significant difference (P < 0.01) (Fig. 4C). The abundance of both mRNA and protein for MITF, TYR, TYRP1 and TYRP2 were examined in melanocytes transfected by the pmirGLO-sGC, compared to untransfected melanocytes. The over expression of pmirGLO-sGC in menlanocytes resulted in a decrease in the mRNA abundance for TYR, TYRP1 and TYRP2 (Fig. 5A). Western blot analysis showed that the protein expression of MITF, TYR,
Fig. 4. Effect of pmirGLO-sGC on mRNA and protein abundance of sGC. (A) Real time PCR analysis of sheep sGC expression in melanocytes transfected with the pmriGLO-sGC expression plasmid. Data are expressed by mean ± standard error. from 3 replicates. (B) Western blot showing differential expression of sGC protein in melanocytes transfected and untransfected. (C) Analysis of sGC protein expression in melanocytes transfected by the pmriGLO-sGC expression plasmid using western blot detection, *P < 0.05, *** P < 0.001.
TYRP1 and TYRP2 was significantly reduced in melanocytes overexpressed by pmirGLO-sGC (Fig. 5B and C). Immunohistochemical analysis of sheep skin sections showed that sGC prtotein is expressed in the hair follicles with
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
5
Fig. 6. Localization of sGC protein in sheep skins with white and black coat color. (A) Immunohistochemical analysis of sGC protein expression in white sheep skin (20×). (B) Negative control for white sheep skin (20×). (C) Immunohistochemical analysis of sGC protein expression in black sheep skin (20×). (D) Negative control for black sheep skin (20×).
Fig. 5. Effect of pmriGLO-sGC on the expression of coat color genes in melanocytes. (A) Real time PCR analysis of MITF, TYR, TYRP1 and TYRP2 mRNA expression in melanocytes transfected with the pmriGLO-sGC expression plasmid. Data are expressed as mean ± SD from 3 replicates. (B) Western blot analysis of MITF, TYR, TYRP1 and TYRP2 protein expression in melanocytes transfected by the pmriGLOsGC expression plasmid. (C) Densitometric analysis of MITF, TYR, TYRP1 and TYRP2 protein expression using the Image-Pro Plus software (Olympus, Tokyo, Japan). Data were normalized to -actin and expressed as relative fold change (mean ± SE, n = 3). *P < 0.05, **P < 0.01, ***P < 0.001.
different location and abundance between white and black sheep skin (Fig. 6). In white sheep skin, Strong sGC positive signal was detected in the upper hair dermal papilla but no positive signals were found in the lower bulb and outer root sheath. While in black sheep skin, sGC immunostaining was detected in the lower bulb and weak positive signal was also found in the outer root sheath. It has been verified that melanocytes located in the matrix of hair follicle and outer root sheath contributed to color formation. But there are significantly fewer melanocytes in the outer root sheath than in the hair matrix (Slominski et al., 2004). The further immunocytochemical analysis of melanocytes showed that sGC was expressed in melanocytes with positive signal (Fig. 7). Moreover, cGMP and cAMP was present with the
sensitivity (Acetylated) of 3.8 fmol/ml and 42 fmol/ml, respectively, in the melanocytes in vitro by the ELASA method, which suggested that melanocytes of alpaca were capable of producing cGMP and cAMP. sGC catalyzes the conversion of GTP to cGMP in response to various extracellular stimuli. Regardless of species, all signal transduction through sGC takes place through an increased concentration of cGMP, which is capable of modulating cAMP levels through cGTP-regulated phosphodiesterases (PDEs) (Stangherlin et al., 2011). Phosphodiesterases allow crosstalk between cGMP and cAMP signaling pathways because they cause the concentration of one cyclic nucleotide to influence the degradation of the other (Denninger and Marletta. Denninger and Marletta. 1999). Here, the result suggested that cGMP would make melanins decreased by degradation of cAMP. The molecular mechanisms involved in the cAMP regulation of cellular functions in melanocytes have been well studied (Costin and Hearing 2007) and the important role of cAMP as a key messenger in the regulation of skin pigmentation has been well established (Buscà and Ballotti, 2000). cAMP activates protein kinase A (PKA), and PKA phosphorylates the CREB (cAMP responsive element binding protein) family of transcription factors. Once phosphorylated, CREB proteins bind to the cAMP responsive element (CRE) domain present in the MITF promoter, thereby up-regulating its transcription (Buscà and Ballotti, 2000). As a transcription factor, MITF can specifically up-regulate the promoter activities of TYR, TYRP1 and TYRP2 genes (Park and Gilchrest 2002), which encode melanosomal glycoproteins known to be essential for melanin systhesis (Orlow et al., 1994). Given the role of sGC in the conversion of GTP to cGMP, which in turn can modulate cAMP levels, a potential function of sGC in the regulation of
Fig. 7. Localization of sGC protein in sheep melanocytes in vitro by Immunocytochemical analysis. (A) Negative control sis of sGC protein expression (40×). (B) Positive analysis of sGC protein expression (arrow) (40×).
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
6
melanogenesis is speculated. As so, it is possible that sGC maybe a potential gene to transform the coat color of animals producing wool by the transgenic method. 4. Conclusions To conclude, our present study demonstrates that the expression of sGC is significantly higher in white vs. black sheep skin both at the mRNA and protein levels. Further, melanocytes of alpaca in vitro were capable of producing cGMP and cAMP. The results provided a new evidence to suggest an additional role for sGC participating in coat color formation in sheep. Acknowledgements This work was supported by funding from NSFC(31201868), grants from Chinese National “863”Projects (Grant No. 2013AA102506), and Science and technology key project (20120311024-2). References Buscà, R., Ballotti, R., 2000. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigm. Cell Res. 13 (2), 60–69. Costin, G.E., Hearing, V.J., 2007. Human skin pigmentation: melanocytes modulate skin color in response to stress. FASEB J. 21 (4), 976–994. Denninger, J.W., Marletta, M.A., 1999. Guanylate cyclase and the NO/cGMP signaling pathway. Biochim. Biophys. Acta (BBA)-Bioenerg. 1411 (2), 334–350.
Fan, R., Xie, J., Bai, J., Yao, J., Smith, G., Chang, C., 2013. Skin transcriptome profiles associated with coat color in sheep. BMC Genom. 14 (1), 389–401. Gratten, J., Beraldi, D., Lowder, B., Mcrae, A.F., Visscher, P.M., Pemberton, J.M., et al., 2007. Compelling evidence that a single nucleotide substitution in TYRP1 is responsible for coat-colour polymorphism in a free-living population of soay sheep. Proc. R. Soc. B: Biol. Sci. 274 (1610), 619–626. Ito, S., Wakamatsu, K., 2008. Chemistry of mixed melanogenesis-pivotal roles of dopaquinone. Photochem. Photobiol. 84 (3), 582–592. Ito, S., Wakamatsu, K., Ozeki, H., 2000. Chemical analysis of melanins and its application to the study of the regulation of melanogenesis. Pigm. Cell Res. 13 (s8), 103–109. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25 (4), 402–408. Norris, B.J., Whan, V.A., 2008. A gene duplication affecting expression of the ovine ASIP gene is responsible for white and black sheep. Genome Res. 18 (8), 1282–1293. Park, H.Y., Gilchrest, B.A., 2002. More on MITF. J. Invest. Dermatol. 119 (6), 1218–1219. Slominski, A., Tobin, D.J., Shibahara, S., Wortsman, J., 2004. Melanin pigmentation in mammalian skin and its hormonal regulation. Physiol. Rev. 84 (4), 1155–1228. Stangherlin, A., Gesellchen, F., Zoccarato, A., Terrin, A., Fields, L.A., Berrera, M., et al., 2011. cGMP signals modulate cAMP levels in a compartment-specific manner to regulate catecholamine-dependent signaling in cardiac myocytes novelty and significance. Circ. Res. 108 (8), 929–939. Steingrímsson, E., Copeland, N.G., Jenkins, N.A., 2006. Mouse coat color mutations: from fancy mice to functional genomics. Dev. Dyn. 235 (9), 2401–2411. Våge, D.I., Klungland, H., Lu, D., Cone, R.D., 1999. Molecular and pharmacological characterization of dominant black coat color in sheep. Mamm. Genome 10 (1), 39–43. Orlow, S.J., Zhou, B.K., Chakraborty, A.K., Drucker, M., Pifko-Hirst, S., Pawelek, J.M., 1994. High-molecular-weight forms of tyrosinase and the tyrosinase-related proteins: evidence for a melanogenic complex. J. Invest. Dermatol. 103 (2), 196–201.
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
ARTICLE IN PRESS Acta Histochemica xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep Shanshan Yang, Junzhen Zhang, Kaiyuan Ji, Dingxing Jiao, Ruiwen Fan ∗ , Changsheng Dong College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu 030801, PR China
a r t i c l e
i n f o
Article history: Received 10 September 2015 Received in revised form 16 December 2015 Accepted 11 January 2016 Available online xxx Keywords: cAMP cGMP Skin Sheep Soluble guanylate cyclase (sGC)
a b s t r a c t The study reported the characterization of soluble guanylate cyclase (sGC) with the size of CDS of 1860 bp, encoding a protein of 620 amino acids and containing several conserved functional domains including HNOB, HNOBA, and CHD. Quantitative real time PCR analysis of sGC showed that the expression of sGC mRNA is higher (∼5 fold) in white sheep skin relative to black sheep skin with significant difference (P < 0.01). Using a rabbit polyclonal anti-sGC antibody, an immune reactive band corresponding to sheep sGC protein was detected in the skin samples by Western blotting analysis, and the expression of sGC protein was significantly higher in white sheep skin compared to black sheep skin (P < 0.01). Immunohistochemical analysis revealed that sGC protein was localized in cytoplasm and intercellular substance of upper hair papilla in hair follicles of white sheep skin, but the protein was localized in cytoplasm and intercellular substance of lower hair bulb and outer root sheath cells in hair follicles of black sheep skin. The immunocytochemical analysis revealed that sGC was expressed in melanocytes in vitro of sheep skin. Over expression of sGC in melanocytes resulted in decreased expression of key melanogenic genes including microphthalmia transcription factor (MITF), tyrosinase (TYR), tyrosinase related protein 1(TYRTP1), and tyrosinase related protein 2(TYRP2) both at mRNA and protein level. Moreover, the melanocytes was capable of producing cGMP and cAMP. The observed differential expression and localization of sGC in sheep skins and melanocytes and the capability of producing cGMP and cAMP, which suggested a potential role for this gene in hair color regulation. © 2016 Elsevier GmbH. All rights reserved.
1. Introduction Sheep is one of the most important fiber-producing animals, and the diameter, length and color of fiber are the key traits contributing to the economic value. Currently, different colors of fibers in commercial production are produced by dying white fiber, which affects human health and environment. Thus, natural coat colors in sheep or other fiber-producing species such as alpacas are becoming of increasing interest due to the green revolution and consumer preference for natural products. Coat colors are determined by both genetics and environment, especially genetics. The phenotype of coat color of animals depends on two types of melanin, black to brown eumelanin and yellow to
∗ Corresponding author at: College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Shanxi, Taigu 030801, PR China. E-mail address: [email protected] (R. Fan).
reddish brown pheomelanin produced in mammalian melanocyte (Ito et al., 2000; Ito and Wakamatsu 2008). The genetic basis for coat color is well understood in rodents (Slominski et al., 2004; Steingrímsson et al., 2006). Some common genes implicated in the regulation of coat color are also well documented in other species including sheep. For example, MC1R and ASIP loci are functionally linked to undesirable coat color phenotypes in sheep (Våge et al., 1999; Norris and Whan 2008), and TYRP1 is a strong positional candidate gene for color variation in Soay sheep (Gratten et al., 2007). In a previous study, we characterized the transcriptome profiles of sheep skins with white and black coat color, and identified differentially expressed genes (Fan et al., 2013) including known coat color genes (e.g., DCT, MATP, TYR and TYRP1). One of the differentially expressed genes is soluble guanylate cyclase (sGC), which showed significantly higher expression in white vs. black sheep skin. Guanylate cyclases are a family of enzymes that catalyze the conversion of GTP to cGMP. The family comprises both membranebound (particulate guanylate cyclase, pGC) and soluble (soluble
http://dx.doi.org/10.1016/j.acthis.2016.01.002 0065-1281/© 2016 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
2
guanylate cyclase, sGC) isoforms that are expressed in nearly all cell types (Fan et al., 2013). sGC is involved in many signal transduction pathways, most notably in the cardiovascular system and the nervous system (Denninger and Marletta 1999). The present study reports the characterization of sGC expression in sheep skins with white and black coat color, providing evidence to suggest that sGC might be related to coat color formation. 2. Materials and methods 2.1. Sheep and tissue collection Housing and care of sheep and collection of skin samples for use in the described experiments were conducted in accordance with the International Guiding Principles for Biomedical Research Involving Animals (http://www.cioms.ch/index.php/ 12-newsflash/365-announcement) and approved by the Animal Experimentation Ethics Committee of Shanxi Agricultural University, Taigu, China. Six healthy 2-year-old male sheep with white and black coat color phenotype (3 sheep per color) were used in the study, which were from the sheep farm in Sunite, Inner Mongolia, China. Skin samples of 8 mm diameter from the back of sheep were collected. For each sample, part of the tissue was flash frozen in liquid nitrogen and stored at −80 ◦ C until RNA and protein extraction, and the remaining part was fixed in 4% formaldehyde for paraffin sections. 2.2. Construction of plasmids The coding sequence of sheep sGC was obtained by PCR using sheep skin cDNA as a template with primers containing ScaI and XhoI sites (Table 1). The PCR product of sGC and the pmirGLO vector (Promega, Fitchburg, WI) were digested with ScaI and XhoI and then ligated together to obtain the pmirGLO-sGC construction. 2.3. Cell culture and transfection All melanocyte cell cultures of sheep used in this study were established by our lab. Skin samples used for established the melanocyte lines were obtained from the sheep which were from the sheep farm in Sunite,Inner Mongolia, China. Cell were transfected with the pmirGLO-sGC plasmid using lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Three days after transfection, melanocytes were collected. Total RNA and Cell lysates were prepared and subjected to real-time PCR and Western blot analyses, respectively. 2.4. Quantitative real time PCR analysis Total RNA was isolated from sheep skin samples using Trizol reagent (Invitrogen). The concentration of total RNA was determined using NanoDrop 1000 spectrophotometer (NanoDrop Technology). Prior to reverse transcription, total RNA was treated with DNaseI (Ambion) to eliminate genomic DNA contamination. Two microgram of treated total RNA from each sample were converted to cDNA using Prime ScriptTM RT reagent kit Table 1 Primers used in this study. Primer name
Primer sequence 5 -3
Application
sGC-F1 sGC-R1 sGC-F2 sGC-R2 -actin-F -actin-R
GGTCAAGGAAGAGGTCGACG GATGACTGGTGTCTCCCGGT CGAGCTCCAGATGATCTACTTGCCTGAA GCTCTAGATATCTGAACAGATTCACCGTCTACT CCTGACCGGGAAGAGGAATC AAAAACAGGGGGTTGAACTC
Real time PCR Real time PCR RT-PCR RT-PCR Real time PCR Real time PCR
(TaKaRa). Negative control RT reactions were also performed at the same time. Real-time PCR primers for sGC, MITF, TYR, TYRP1, and TYRP2 gene and the endogenous control gene (-actin) were designed using primer3plus software (http://www.biowebdb.org/ primer3plus/, see Table 1). Quantitative real time PCR was performed using SYRB Premix Ex TaqTM II (TaKaRa) in triplicate for each sample on a 7500 Fast Real-Time PCR System (Applied Biosystems). Quantification of sGC, MITF, TYR, TYRP1 and TYRP2 transcript abundance was performed using the comparative threshold cycle (CT) method (Livak and Schmittgen 2001). The relative amount of mRNA was normalized to the amount of -actin mRNA. 2.5. Immunohistochemistry Paraffin sections were dehydrated with increasing concentrations of ethanol (80–100%), followed by incubation in 3% hydrogen peroxide for 10 min at room temperature to block the action of any endogenous peroxidase. After washing with 0.1 M PBS three times for 15 min, the sections were boiled for 10 min in 0.01 M citric acid. This was followed by a 20-min immersion in PBS containing 5% BSA at 37 ◦ C. Sections were then incubated at 4 ◦ C overnight in 1:100 diluted rabbit anti-sGC primary antibody (Abcam, ab53084, USA, used for WB, IHC-P). Following three times of washing in PBS, sections were incubated in 1:500 diluted HRP conjugated goat anti-rabbit IgG (CWBIO, Beijing, China) for 30 min at 37 ◦ C. After washing with PBS three times, sections were developed with DAB and the positive signal was observed using a Leica microscope (Leica Microsystems). PBS was substituted for the primary antibody for the negative control. 2.6. Western blotting Total protein extraction from sheep skins was performed using WB/IP lysis buffer following the manufacturer’s instruction (Beyotime, Beijing, China). Protein concentrations were measured by the BCA method using bovine serum albumin as the standard. Protein extracts were denatured at 95 ◦ C for 5 min, and the same amount of protein (150 g) from each sample was separated by 10% SDS-PAGE and electroblotted onto a nitrocellulose membrane. Immunoblotting was carried out with 1:200 diluted rabbit anti-sGC antibody(Abcam, ab53084, USA, used for WB, IHC-P), 1:500 diluted rabbit anti-MITF antibody (Abcam, ab20663, USA, used for ICC/IF, WB), 1:500 diluted rabbit anti-TYR antibody (Abcam, ab180753, USA, used for ICC/IF, WB, IHC-P), 1:500 diluted rabbit anti-TYRP1 antibody (Abcam, ab73873, USA, used for WB, IHC-P), 1:500 diluted rabbit anti-TYRP2 antibody (Abcam, ab74073, used for IHC-P, WB, ELISA) and 1:1000 diluted rabbit anti--actin antibody (CWBIO, CW0097, Beijing, China,used for WB, ELISA) in 5% milk blocking buffer at 4 ◦ C overnight. After washing in TBST, the membrane was incubated with HRP conjugated goat anti-rabbit IgG (CWBIO, Beijing, China) for 1 h at room temperature (1:2000 diluted in 3% blocking buffer). Following several washings with TBST, the signals were detected using an ECL kit (CWBIO, Beijing, China). The intensity of the signals for sGC and -actin was qualified using Image-Pro Plus Software (Olympus). 2.7. Immunocytochemistry In order to investigate the sGC expression in melanocytes, melanocytes were washed three times in 0.1 M PBS for 3 min each, fixed in 4% paraformaldehyde, and then incubated at room temperature in 3% hydrogen peroxide for 15 min to block the action of any endogenous peroxidase. After washing with 0.1 M PBS three times for 5 min each, cells were immersed in BSA at 37 ◦ C for 40 min. Cells were then incubated at 4 ◦ C overnight in anti-sGC antibody(Abcam, ab53084, USA, used for WB, IHC-P) solution. Following washing
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
3
Fig. 1. Alignment of deduced amino acids sequence of sheep and other animals. It showed high similarity among those animals. The domains of deduced amino acids of sheep were highlighted with different colors.
three times in 0.1 M PBS for 5 min each, cells were incubated with HRP-conjugated anti-rabbit IgG (CWBIO, Beijing, China) for 30 min at 37 ◦ C. Immunostaining of the cells was then observed under a microscope (Leica). For negative controls, PBS was substituted for the primary antibody.
2.8. cGMP and cAMP assays To investigate the capability of producing cGMP and cAMP in sheep melanocytes (stored by our lab), the production of cGMP and cAMP was measured. Following the collected cells (1 × 106 ) was treated with 0.1 M HCl, incubated for 10 min and visually inspected
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
4
Fig. 2. Real time PCR analysis of sGC mRNA expression in sheep skins with white and black coat color. sGC mRNA was normalized relative to abundance of -actin and the experiment was replicated three times (n = 3). Bars represent the mean ± standard error. ** P < 0.01.
to verify cell lysis, the cell lysates were centrifuged at 600 × g for 10 min at room temperature, and the supernatants were collected and used directly in the assays. Concentrations of cGMP and cAMP were determined by enzyme-linked immunosorbent assay (ELISA) after acetylation of the samples according to the manufacturer’s instructions (NewEast Biosciences, PA, USA).
Fig. 3. Western blot analysis of sGC protein expression in sheep skins with white and black coat color. (A) Western blot showing differential expression of sGC protein between white and black sheep skin. (B) Quantitative analysis of sGC protein bands (n = 3) using the Image-Pro Plus software. Data were normalized to -actin and expressed as relative fold change. Bars represent the mean ± standard error. ** P < 0.01.
2.9. Statistical analysis The differences in abundance mRNA and protein were determined by analysis of variance using SPSS 16. 0 software. A one-way analysis of variance (ANOVA) testing was used to determine statistical differences. The data was expressed as mean ± standard error. 3. Results and discussion From the skin transcriptome profile of sheep with different hair color, we found that sGC was expressed differently, which suggested that sGC may be related to the coat color (Fan et al., 2013). Here sGC was isolated and characterized and then anylyzed the expression to support the possibility. The full length of CDS is 1860 bp, encoding a protein of 620 amino acids. The deduced amino acid sequence shares ∼99% sequence similarity with sGC proteins from other species including human, rat, pig, dog, cattle and sheep. The protein is predicted to contain several conserved functional domains including HNOB (Heme NO Binding), HNOBA (Heme NO Binding Associated), and CHD (Cyclase Homology Domain) (Fig. 1). Quantitative expression of sGC mRNA in white and black sheep skin was analyzed by real time PCR. As shown in Fig. 2, the expression of sGC mRNA is significantly higher (5 fold) in white than black sheep skin (P < 0.01). Western blot analysis showed that the size of the sheep sGC protein is around 70 kDa and that the expression of sGC protein in white sheep skin is higher compared to black sheep skin (Fig. 3A). Quantitative analysis showed that the average intensity of the sGC protein bands is ∼2.5 times stronger in white sheep skin than black sheep skin with significant difference (P < 0.01) (Fig. 3B). As shown in Fig. 4A, the expression of sGC is significantly higher (7 fold) in cells transfected than untransfected (P < 0.05). The expression of sGC protein in transfected cells is higher compared to untransfected cells(Fig. 4B). Quantitative analysis showed that the average intensity of the sGC protein bands is ∼2.7 times stronger in transfected cells than untransfected cells with significant difference (P < 0.01) (Fig. 4C). The abundance of both mRNA and protein for MITF, TYR, TYRP1 and TYRP2 were examined in melanocytes transfected by the pmirGLO-sGC, compared to untransfected melanocytes. The over expression of pmirGLO-sGC in menlanocytes resulted in a decrease in the mRNA abundance for TYR, TYRP1 and TYRP2 (Fig. 5A). Western blot analysis showed that the protein expression of MITF, TYR,
Fig. 4. Effect of pmirGLO-sGC on mRNA and protein abundance of sGC. (A) Real time PCR analysis of sheep sGC expression in melanocytes transfected with the pmriGLO-sGC expression plasmid. Data are expressed by mean ± standard error. from 3 replicates. (B) Western blot showing differential expression of sGC protein in melanocytes transfected and untransfected. (C) Analysis of sGC protein expression in melanocytes transfected by the pmriGLO-sGC expression plasmid using western blot detection, *P < 0.05, *** P < 0.001.
TYRP1 and TYRP2 was significantly reduced in melanocytes overexpressed by pmirGLO-sGC (Fig. 5B and C). Immunohistochemical analysis of sheep skin sections showed that sGC prtotein is expressed in the hair follicles with
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
5
Fig. 6. Localization of sGC protein in sheep skins with white and black coat color. (A) Immunohistochemical analysis of sGC protein expression in white sheep skin (20×). (B) Negative control for white sheep skin (20×). (C) Immunohistochemical analysis of sGC protein expression in black sheep skin (20×). (D) Negative control for black sheep skin (20×).
Fig. 5. Effect of pmriGLO-sGC on the expression of coat color genes in melanocytes. (A) Real time PCR analysis of MITF, TYR, TYRP1 and TYRP2 mRNA expression in melanocytes transfected with the pmriGLO-sGC expression plasmid. Data are expressed as mean ± SD from 3 replicates. (B) Western blot analysis of MITF, TYR, TYRP1 and TYRP2 protein expression in melanocytes transfected by the pmriGLOsGC expression plasmid. (C) Densitometric analysis of MITF, TYR, TYRP1 and TYRP2 protein expression using the Image-Pro Plus software (Olympus, Tokyo, Japan). Data were normalized to -actin and expressed as relative fold change (mean ± SE, n = 3). *P < 0.05, **P < 0.01, ***P < 0.001.
different location and abundance between white and black sheep skin (Fig. 6). In white sheep skin, Strong sGC positive signal was detected in the upper hair dermal papilla but no positive signals were found in the lower bulb and outer root sheath. While in black sheep skin, sGC immunostaining was detected in the lower bulb and weak positive signal was also found in the outer root sheath. It has been verified that melanocytes located in the matrix of hair follicle and outer root sheath contributed to color formation. But there are significantly fewer melanocytes in the outer root sheath than in the hair matrix (Slominski et al., 2004). The further immunocytochemical analysis of melanocytes showed that sGC was expressed in melanocytes with positive signal (Fig. 7). Moreover, cGMP and cAMP was present with the
sensitivity (Acetylated) of 3.8 fmol/ml and 42 fmol/ml, respectively, in the melanocytes in vitro by the ELASA method, which suggested that melanocytes of alpaca were capable of producing cGMP and cAMP. sGC catalyzes the conversion of GTP to cGMP in response to various extracellular stimuli. Regardless of species, all signal transduction through sGC takes place through an increased concentration of cGMP, which is capable of modulating cAMP levels through cGTP-regulated phosphodiesterases (PDEs) (Stangherlin et al., 2011). Phosphodiesterases allow crosstalk between cGMP and cAMP signaling pathways because they cause the concentration of one cyclic nucleotide to influence the degradation of the other (Denninger and Marletta. Denninger and Marletta. 1999). Here, the result suggested that cGMP would make melanins decreased by degradation of cAMP. The molecular mechanisms involved in the cAMP regulation of cellular functions in melanocytes have been well studied (Costin and Hearing 2007) and the important role of cAMP as a key messenger in the regulation of skin pigmentation has been well established (Buscà and Ballotti, 2000). cAMP activates protein kinase A (PKA), and PKA phosphorylates the CREB (cAMP responsive element binding protein) family of transcription factors. Once phosphorylated, CREB proteins bind to the cAMP responsive element (CRE) domain present in the MITF promoter, thereby up-regulating its transcription (Buscà and Ballotti, 2000). As a transcription factor, MITF can specifically up-regulate the promoter activities of TYR, TYRP1 and TYRP2 genes (Park and Gilchrest 2002), which encode melanosomal glycoproteins known to be essential for melanin systhesis (Orlow et al., 1994). Given the role of sGC in the conversion of GTP to cGMP, which in turn can modulate cAMP levels, a potential function of sGC in the regulation of
Fig. 7. Localization of sGC protein in sheep melanocytes in vitro by Immunocytochemical analysis. (A) Negative control sis of sGC protein expression (40×). (B) Positive analysis of sGC protein expression (arrow) (40×).
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002
G Model ACTHIS-51052; No. of Pages 6
ARTICLE IN PRESS S. Yang et al. / Acta Histochemica xxx (2016) xxx–xxx
6
melanogenesis is speculated. As so, it is possible that sGC maybe a potential gene to transform the coat color of animals producing wool by the transgenic method. 4. Conclusions To conclude, our present study demonstrates that the expression of sGC is significantly higher in white vs. black sheep skin both at the mRNA and protein levels. Further, melanocytes of alpaca in vitro were capable of producing cGMP and cAMP. The results provided a new evidence to suggest an additional role for sGC participating in coat color formation in sheep. Acknowledgements This work was supported by funding from NSFC(31201868), grants from Chinese National “863”Projects (Grant No. 2013AA102506), and Science and technology key project (20120311024-2). References Buscà, R., Ballotti, R., 2000. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigm. Cell Res. 13 (2), 60–69. Costin, G.E., Hearing, V.J., 2007. Human skin pigmentation: melanocytes modulate skin color in response to stress. FASEB J. 21 (4), 976–994. Denninger, J.W., Marletta, M.A., 1999. Guanylate cyclase and the NO/cGMP signaling pathway. Biochim. Biophys. Acta (BBA)-Bioenerg. 1411 (2), 334–350.
Fan, R., Xie, J., Bai, J., Yao, J., Smith, G., Chang, C., 2013. Skin transcriptome profiles associated with coat color in sheep. BMC Genom. 14 (1), 389–401. Gratten, J., Beraldi, D., Lowder, B., Mcrae, A.F., Visscher, P.M., Pemberton, J.M., et al., 2007. Compelling evidence that a single nucleotide substitution in TYRP1 is responsible for coat-colour polymorphism in a free-living population of soay sheep. Proc. R. Soc. B: Biol. Sci. 274 (1610), 619–626. Ito, S., Wakamatsu, K., 2008. Chemistry of mixed melanogenesis-pivotal roles of dopaquinone. Photochem. Photobiol. 84 (3), 582–592. Ito, S., Wakamatsu, K., Ozeki, H., 2000. Chemical analysis of melanins and its application to the study of the regulation of melanogenesis. Pigm. Cell Res. 13 (s8), 103–109. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25 (4), 402–408. Norris, B.J., Whan, V.A., 2008. A gene duplication affecting expression of the ovine ASIP gene is responsible for white and black sheep. Genome Res. 18 (8), 1282–1293. Park, H.Y., Gilchrest, B.A., 2002. More on MITF. J. Invest. Dermatol. 119 (6), 1218–1219. Slominski, A., Tobin, D.J., Shibahara, S., Wortsman, J., 2004. Melanin pigmentation in mammalian skin and its hormonal regulation. Physiol. Rev. 84 (4), 1155–1228. Stangherlin, A., Gesellchen, F., Zoccarato, A., Terrin, A., Fields, L.A., Berrera, M., et al., 2011. cGMP signals modulate cAMP levels in a compartment-specific manner to regulate catecholamine-dependent signaling in cardiac myocytes novelty and significance. Circ. Res. 108 (8), 929–939. Steingrímsson, E., Copeland, N.G., Jenkins, N.A., 2006. Mouse coat color mutations: from fancy mice to functional genomics. Dev. Dyn. 235 (9), 2401–2411. Våge, D.I., Klungland, H., Lu, D., Cone, R.D., 1999. Molecular and pharmacological characterization of dominant black coat color in sheep. Mamm. Genome 10 (1), 39–43. Orlow, S.J., Zhou, B.K., Chakraborty, A.K., Drucker, M., Pifko-Hirst, S., Pawelek, J.M., 1994. High-molecular-weight forms of tyrosinase and the tyrosinase-related proteins: evidence for a melanogenic complex. J. Invest. Dermatol. 103 (2), 196–201.
Please cite this article in press as: Yang, S., et al., Characterization and expression of soluble guanylate cyclase in skins and melanocytes of sheep. Acta Histochemica (2016), http://dx.doi.org/10.1016/j.acthis.2016.01.002