- Email: [email protected]
Characterization and expression of the mouse Hsc70 gene
Biochimica et Biophysica Acta 1444 (1999) 315^325
Characterization and expression of the mouse Hsc70 gene Clayton R. Hunt a
a;
*, Azemat J. Parsian a , Prabhat C. Goswami a , Christine A. Kozak
b
Washington University School of Medicine, Radiation Oncology Center, 4511 Forest Park Blvd., St. Louis, MO 63108, USA b National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892, USA Received 23 September 1998; received in revised form 18 December 1998; accepted 18 December 1998
Abstract A genomic clone encoding the mouse Hsc70 gene has been isolated and characterized by DNA sequence analysis. The gene is approximately 3.9 kb in length and contains eight introns, the fifth, sixth and eighth of which encode the three U14 snoRNAs. The gene has been located on Chr 9 in the order Fli1^Itm1^Olfr7^Hsc70(Rnu14)^Cbl by genetic analysis. Expression of Hsc70 is universal in all tissues of the mouse, but is slightly elevated in liver, skeletal muscle and kidney tissue, while being depressed in testes. In cultured mouse NIH 3T3 cells or human HeLa cells, Hsc70 mRNA levels are low under normal conditions, but can be induced 8-fold higher in both lines by treatment with the amino acid analog azetidine. A similar induction is seen in cells treated with the proteosome inhibitor MG132 suggesting that elevated Hsc70 expression may be coupled to protein degradation. Surprisingly, expression of the human Hsc70 gene is also regulated by cell-cycle position being 8^10-fold higher in late G1 /S-phase cells as opposed to the levels in early G1 -phase cells. ß 1999 Elsevier Science B.V. All rights reserved. Keywords: Hsc70 DNA sequence; Azetidine; MG132; Cell cycle; Gene mapping; Gene expression
1. Introduction When mammalian cells are subjected to a heat shock of 3^8³C above their normal growth temperature they respond by inducing the synthesis of a group of proteins known as heat-shock proteins (HSPs) which allow the cells to survive short periods of hyperthermia. The most prominently induced and most highly conserved member of the HSP family is the 70 000-Da HSP70 protein. However, the heat-inducible Hsp70 genes are only one part of a larger
* Corresponding author. Fax: +1 (314) 362-9790; E-mail: [email protected]
family of Hsp70-related genes that are expressed constitutively in most cells. The unifying features of the family are a high degree of sequence homology, at both the nucleotide or amino acid level and the ability to bind hydrophobic peptide domains. Normally these domains are internally located within proteins, but stress-induced conformational changes or normal cellular processes, such as protein synthesis or transmembrane transport, transiently expose them to an aqueous environment. HSP70 proteins bind the exposed hydrophobic domains to prevent the formation of insoluble aggregates until properly folding or re-folding can occur. In the mouse, seven members of the Hsp70 gene family have been identi¢ed. In addition to the major heat-inducible genes Hsp70-1 [1] and Hsp70-3 [2]; the family includes the developmentally regulated
0167-4781 / 99 / $ ^ see front matter ß 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 9 8 ) 0 0 2 8 5 - 1
BBAEXP 93241 9-3-99
316
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
Hsp70-2 [3] and Hsc70t [4] genes, which are constitutively expressed mainly in male germ cells; and three constitutively expressed genes whose products are localized to di¡erent cellular compartments [5^7]. The Grp78 gene product is an endoplasmic reticulum protein which binds to newly secreted proteins until they are properly modi¢ed and folded [5]. The mitochondrial form of HSP70 [6] is thought to carry out a similar folding function for proteins that are transported in from the cytoplasm. The last member of the Hsp70 gene family is Hsc70 whose product is a major cytoplasmic protein and the most abundant member of the HSP70-related proteins. HSC70 was identi¢ed initially as part of the complex which removes the clathrin protein covering coated vesicles [7], later it was found in association with newly synthesized proteins preventing premature folding of hydrophobic domains as they emerge from the ribosome [8]. HSC70 maintains the unfolded, extended conformation necessary for protein transport through membranes either from the cytoplasm into the mitochondria [9] or from the cytoplasm into the nucleus [10]. Finally, HSC70 has recently been shown to be a required component for ubiquitin-mediated degradation of some proteins of [11]. Despite the large amount of data available on the cellular and mechanistic aspects of HSC70 function, very little is known about the regulation of Hsc70 expression. To begin to examine the regulation of Hsc70, we have isolated the mouse Hsc70 gene, determined its nucleotide sequence and characterized its expression in both tissue and cultured cell lines. 2. Materials and methods 2.1. Cell culture conditions Mouse NIH 3T3 cells were grown in Dulbecco's modi¢ed Eagle's medium with 10% calf serum, 100 U/ml penicillin and 100 Wg/ml streptomycin. HeLa cells were grown in Ham's F10 medium supplemented with 10% calf serum and antibiotics as above. Both HeLa and mouse NIH 3T3 cells were treated with azetidine (L-azetidine-2-carboxylic acid, Sigma) at 5 mM. Treatment of NIH 3T3 cells with 10 WM MG132 (Calbiochem) was by addition from a 100U stock dissolved in DMSO. Synchronous HeLa
cell populations were obtained by selective detachment of mitotic cells as described earlier [12]. At di¡erent times post-selection, aliquots of cell samples were ¢xed with 70% ethanol followed by RNase A treatment and staining with propidium iodide (35 Wg/ ml) then analyzed by one-dimensional £ow cytometry on a FACS 440 (Becton Dickinson Immunocytometry Systems, San Jose, CA). 2.2. Isolation of Hsc70 gene and sequence determination The Hsc70 gene was isolated by PCR screening of a mouse 129/SvJ P1 genomic library (Genome Systems, St. Louis, MO) using an oligonucleotide primer pair based on the intron 6 nucleotide sequence described in a partial Hsc70 mouse gene sequence [13]. Three relevant subclones from the isolated phage P5957 were prepared by cloning BglII fragments into the pLit28 vector (New England Biolabs, Beverly, MA) and the fragments sequenced by the dideoxy chain termination method or by using an Applied Biosystems automated DNA sequencer. Both DNA strands of the Hsc70 gene were entirely sequenced and the resulting data deposited with GenBank as accession number U73744. 2.3. Gene mapping The Hsc70 gene was positioned on the mouse linkage map by Southern blot analysis of two multilocus crosses: (NFS/N or C58/JUM. m. musculus)UM. m. musculus [14], (NFS/NUM. spretus)UM. spretus or C58/J [15]. DNAs from the progeny of these crosses have been typed for over 1000 markers which map to all 19 autosomes and the X chromosome including the chromosome (Chr) 9 markers Fli1 (Friend leukemia virus integration site 1), Itm1 (integral membrane protein 1), Olfr7 (olfactory receptor 7), and Cb1 (Casistas b-lineage lymphoma) as described previously [16,17]. A 369-bp SmaI fragment from the 5Ppromoter region of the Hsc70 gene (nucleotides 10^ 379) was isolated and used to analyze the progeny of these crosses. Recombination was determined according to Green [18] and loci were ordered by minimizing the number of recombinants using the LOCUS program designed by C.E. Buckler (NIAID, Bethesda, MD).
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
317
Fig. 1. The nucleotide sequence of the mouse Hsc70 gene. The complete Hsc70 nucleotide sequence (GenBank accession number U73744) is shown with nucleotides in uppercase representing exon sequences. Uppercase letters above the nucleotide sequence are the corresponding single letter amino acid symbols. The U14 snoRNA sequences in introns 5, 6, and 8 are underlined. The polyadenylation signal at nucleotide 4175 is in bold, while the TATA box at nucleotide 223 in the promoter is in bold and underlined. The mouse transcription start point was calculated by comparison with the experimentally determined human Hsc70 start site [20], while the 3Pterminus is based on the published mouse cDNA sequence [19].
2.4. RNA analysis Total cellular RNA was isolated from cells using TriReagent (MRC Cincinnati, OH) and 10 Wg of each sample was fractionated on 1% agarose-formaldehyde gels, then transferred to GeneScreen Plus (DuPont, Boston, MA) by standard procedures. Radiolabeled probes were prepared by random priming of isolated DNA fragments and hybridized to the membranes under conditions as previously described [1]. Results were quantitated by scanning with a Mo-
lecular Dynamics PhosphoImager (Richmond, CA) and corrected for loading based on the glyceraldehyde phosphate dehydrogenase (GAPD) mRNA, actin mRNA or 18S rRNA level in each sample. Tissue speci¢c expression of mouse Hsc70 mRNA was determined by hybridization of the mouse Hsc70 cDNA probe to a multi-tissue polyA selected RNA Northern blot (Clontech, Palo Alto, CA) under the same conditions. Probes speci¢c for Hsc70 mRNA in mouse were a 590-bp ClaI^EcoRI fragment isolated from the 3P-end of a mouse Hsc70 cDNA clone [19]
BBAEXP 93241 9-3-99
318
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
and for the human Hsc70 mRNA a 381-bp PCR ampli¢ed fragment from the 3P-transcribed end of the human Hsc70 gene [20]. 2.5. Gel mobility shift analysis Cells were grown to 70% con£uence, collected, and resuspended in 10 mM HEPES (pH 7.9), 422 mM NaCl, 0.1 mM EGTA, 5.3% glycerol, 0.5 mM DTT and 0.5 mM PMSF, then incubated on ice for 15 min. The samples were centrifuged for 5 min and the supernatant collected. A heat shock element (HSE) oligonucleotide, derived from nucleotides 197^217 of the Hsc70 promoter sequence (CCCTTCTGGAAGGTTCTAAGA), was kinased with [Q-32 P]ATP, puri¢ed and annealed with the complimentary oligonucleotide. Approximately 10^20 000 cpm of this product was mixed with 10 Wg of protein extract in a total volume of 20 Wl and the mixture incubated for 15 min at room temperature then separated by electrophoresis on 4.5% non-denaturing acrylamide gels in 0.5UTris-borate bu¡er [21]. 3. Results 3.1. Characterization of the Hsc70 gene nucleotide sequence PCR screening of a mouse 129/SvJ P1 genomic
Fig. 2. The nucleotide alignment of the mouse and human Hsc70 gene promoter regions. The mouse and human Hsc70 gene promoter regions were aligned beginning with the common TATA element. Numbering of the nucleotide is based on the mouse Hsc70 sequence in Fig. 1. Upper sequence (Mo) is the mouse, lower sequence (Hu) is the human [20]. Identical nucleotides at a position are in bold, dashes (-) represent single gaps in the alignment. The tandem inverted HSE elements (NGAAN) and TATA box sequences are underlined and in bold due to their identity while the inverted CCAAT boxes are only underlined as they do not align.
Fig. 3. Expression of Hsc70/U14 snoRNA in response to heat shock. Total cellular RNA (10 Wg) extracted from control and heat-shocked mouse NIH 3T3 cells (45³C for 15 min) was analyzed by Northern blotting for Hsc70 mRNA (top panel), U14 snoRNA (second panel) and actin mRNA levels (third panel) as a function of time after the initial heat shock. Levels of Hsc70 and U14 snoRNAs were normalized by comparison to the actin mRNA levels in each sample and plotted as relative abundance (bottom graph). Light bars (left) are relative Hsc70 mRNA levels while dark bars (right) are U14 snoRNA levels.
library yielded a single clone, P5957, which was found to contain Hsc70 homologous sequences after Southern blot analysis with a mouse Hsc70 cDNA probe. Three BglII fragments which hybridized with the cDNA probe were subcloned from P5957 and subjected to DNA sequence analysis (Fig. 1). The entire gene was found within the isolated BglII fragments with the middle portion of the gene being located on a 2.8-kb fragment, while the 5P-region including the promoter and the 3P-region, including
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
319
a polyadenylation signal, were located on the adjacent 4.5- and 4.0-kb fragments, respectively. The primary transcript of the gene is predicted to be 3.9-kb and contain eight introns. The largest intron, 0.55kb, interrupts the 5P-untranslated leader sequence while introns 5, 6, and 8 contain the previously reported U14 snoRNA (small nucleolar RNA) encoding genes [13]. Comparison of the mouse Hsc70 promoter region sequence to that of human gene identi¢ed two regions of extended homology that could be of regulatory signi¢cance (Fig. 2). The upstream sequence beginning 216-bp 5P of the transcription initiation point is 54-bp in length and is 87% identical between the two genes. This is followed Fig. 5. Tissue-speci¢c expression of mouse Hsc70 mRNA. A Northern blot containing polyA selected mRNA isolated from various mouse tissues was hybridized with a radiolabeled mouse Hsc70 cDNA (upper panel) followed by an actin probe (lower panel). Tissues from which the RNA was isolated are indicated across the top while the size markers in kb are shown to the right.
Fig. 4. Chromosomal location of the mouse Hsc70 gene. To the right of the map are given recombination fractions between adjacent loci with the ¢rst fraction representing data from the M. m. musculus crosses and the second representing data from the M. spretus crosses. The numbers in parentheses represent percent recombination and standard error. The map locations for the human homologs of the underlined genes are given to the left of the map.
by a 90-bp region only 23% identical, an essentially random degree of relatedness, which does, however, contain an inverted CAAT box element in each promoter. A larger 65-bp region of homology begins 61bp 5P of the start site, includes the TATA element and is 89% identical between the two genes. Both the upstream and downstream homology regions contain three tandem inverted repeats of the 5-bp NGAAN heat shock element (HSE) sequence. Previous reports indicated expression of neither the human [20] nor the mouse Hsc70 gene [19] was signi¢cantly induced following a mild heat shock. Heat shock of mouse NIH 3T3 cells at 43³C for 30 min did only induce an approximately 2-fold increase in Hsc70 mRNA levels (data not shown). However, when the cells were heat shocked at 45³C for 15 min (Fig. 3), Hsc70 mRNA increased 4^5-fold by 4 h after treatment, while cellular levels of the internal U14 snoRNA increased 2fold. Close examination of the Northern blot reveals that a signi¢cant portion of the Hsc70 mRNA accumulating by 4 h post-heat shock is slightly larger than the ¢nal product. During the next 4 h, these presumed splicing intermediates disappear, while the level of mature mRNA increases, suggestive of a precursor^product relationship. In addition to
BBAEXP 93241 9-3-99
320
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
Fig. 6. Induction of Hsc70 mRNA expression by azetidine. Mouse NIH 3T3 cells (A) or human HeLa cells (B) were treated with 5 mM azetidine and total cellular RNA isolated from the cells at 2-h intervals up to 16 h total treatment time. Hsc70 mRNA levels were analyzed by Northern blotting using human or mouse 3P Hsc70 probes. The Hsc70 mRNA level was normalized to the 18S ribosomal RNA level (mouse) or the GAPD mRNA level (human) then plotted as a function of treatment time with azetidine (bottom panels).
these splicing intermediates, we also observed an Hsc70 related mRNA molecule migrating faster than the normal species (4^8 h post-heat shock). Interestingly, a similar mRNA was detected in HeLa cells when cell-cycle regulated Hsc70 expression was examined (see Fig. 9). It seems likely that both these mRNAs result from aberrant splicing that jumps over one or more of the nine exons present in the Hsc70 primary transcript. 3.2. Chromosomal localization of the Hsc70 gene Initial experiments identi¢ed speci¢c hybridization of digoxigenin-labeled P5957 DNA to mouse chromosome 9 based on the DAPI-stained banding pattern. This result was con¢rmed by hybridizing both P5957 and a biotinylated DNA probe speci¢c for the Chr 9 centromeric region (Genome Systems, St. Louis, MO) simultaneously to metaphase chromosomes (data not shown). A more detailed genetic mapping of the Hsc70 gene was carried using a SmaI fragment from the gene promoter which identi¢ed polymorphic HindIII fragments of 8.6-kb in
NFS/N and C58/J, and 9.1-kb in M. m. musculus. ScaI fragments of 9.5- and 11.8-kb were identi¢ed in M. spretus and NFS/N respectively. Inheritance of the variant fragments was followed in two sets of genetic crosses, and linkage was observed with markers on Chr 9 placing the gene in the order: Fli1^Itm1^Olfr7^Hsc70(Rnu14)^Cbl (Fig. 4). This position is syntenic with 11q23 in humans where the human Hsc70 gene was previously localized by in situ hybridization [22]. 3.3. Hsc70 expression Expression of Hsc70 was found in all tissues analyzed by Northern blotting; however, the mRNA levels were not uniform (Fig. 5). Elevated levels of Hsc70 expression occur in liver, skeletal muscle and kidney tissue as compared to heart, brain, spleen and lung tissue. Interestingly, Hsc70 mRNA levels are comparatively low in testis, a tissue that expresses very high levels of the Hsp70 gene family members Hsc70t and Hsp70-2 [3,4]. Treatment of either mouse NIH 3T3 or human
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
HeLa cells with the proline amino acid analog azetidine caused the level of Hsc70 mRNA to rise 8-fold (Fig. 6). In both cases, maximum accumulation of Hsc70 mRNA was a delayed process requiring 10 h of treatment in the 3T3 cells and 8 h in HeLa cells. Elevated expression of Hsc70 mRNA was also detected in cells treated with the proteosome inhibitor MG132 (Fig. 7). Hsc70 mRNA increased approximately 10-fold after 10 h of treatment, but a signi¢cant increase could be detected by 4 h, earlier than observed with azetidine treatment. Induction of Hsp70 expression by either azetidine [23] or MG132 [24] in human cells has been previously reported and is thought to occur through the same mechanism as by heat shock, i.e. the binding of the heat shock transcription factor (HSTF) to the HSE element of the Hsp70 gene promoter. The HSE elements in the mouse Hsc70 promoter consist of only three inverted tandem repeats of the core sequence NGAAN, whereas the Hsp70 HSE elements contain four repeats [1]. A gel mobility shift assay was carried out to determine if the Hsc70 ele-
Fig. 7. Induction of Hsc70 mRNA expression by MG132. Mouse NIH 3T3 cells were treated with 10 WM MG132 for increasing periods of time and the level of total cellular Hsc70 mRNA determined by Northern blot as in Fig. 6. Individual samples were normalized to the corresponding level of actin mRNA and the Hsc70 mRNA abundance plotted as a function of MG132 treatment period.
321
Fig. 8. Gel mobility shift analysis of the Hsc70 HSE element. Extracts from control and treated NIH 3T3 cells were analyzed for HSTF binding activity by the gel mobility shift assay using a radiolabeled HSE element (CCCTTCTGGAAGGTTCTAAGA) from the Hsc70 gene promoter. Extracts prepared from cells: Lane 1, untreated control; lane 2, 30 min after 15 min at 45³C; lane 3, 7 h after 15 min at 45³C; lane 4, 3-h incubation with 5 mM azetidine ; lane 5, 10-h incubation with 5 mM azetidine; lane 6, 2-h incubation with 10 WM MG132; lane 7, 8-h incubation with 10 WM MG132; lane 8, 8-h incubation with 10 WM MG132 with unlabeled HSE competitor; lane 9, 8-h 10 WM MG132 with unlabeled NF-KB oligonucleotide competitor.
ments bound the heat shock transcription factor following heat shock and if treatment with either azetidine or MG132 also induced binding (Fig. 8). A very low level of HSTF binding to the HSE element could be detected prior to heat shock in the mouse cells. Following heat shock at 45³C for 15 min, the binding level increased dramatically by 30 min then declined, but was still detectable 7 h later. Treatment with azetidine for 3 h also induced low level binding which increased following 10 h of treatment. Treatment with MG132 caused the appearance of an anomalously shifted band after 2 h treatment, but by 8 h, there was a substantial increase in HSTF binding activity which migrated at the same position as the heat shock-induced complex. Competition experiments with either cold HSE competitor oligonucleotide or a non-speci¢c oligonucleotide con¢rmed the speci¢city of the HSE binding reactions. These results indicate that heat shock, azetidine and MG132 all induce HSTF binding to the HSE element in the Hsc70 promoter. Heat shock transcription factor is encoded by two separate genes, HSTF1 and HSTF2, both of which bind the HSE element [25]. Attempts to identify whether the complexes contained exclusively HSTF1 or HSTF2 were unsuccessful. Supershifting of the heat-induced complex with HSTF1 antibody, but not HSTF2 antibody, was ob-
BBAEXP 93241 9-3-99
322
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
Fig. 9. Cell-cycle regulation of Hsc70 mRNA levels. A population of synchronized HeLa cells was prepared by mitotic detachment then re-plated and continued in culture until the times indicated when total cellular RNA was isolated from the cells. The RNA was analyzed for Hsc70 mRNA levels (A, top panel) by Northern blot analysis using a radiolabeled PCR probe spanning the last 381 nucleotides of the human Hsc70 gene. Quantitation was carried out by phosphoimager and the results corrected for loading by re-hybridizing the Northern blot with a GAPD cDNA probe (A, middle panel). The Hsc70 mRNA levels after normalization are plotted as a function of hours post-mitotic selection (A, bottom panel). As the cells were harvested for RNA isolation, selected aliquots were also analyzed for cell-cycle position (B) by one-dimensional £ow cytometry on a FACS 440 instrument. The horizontal axis measures DNA content, while the vertical axis represents cell number.
tained; however, both antibodies supershifted the azetidine and MG132 induced complexes (data not shown). Expression of Hsc70 also appears to be regulated in relation to cell-cycle position. HeLa cells were synchronized by mitotic shake-o¡ and the level of Hsc70 mRNA determined by Northern blot analysis as a function of post-mitotic collection time (Fig. 9A). Two hours after mitosis levels of Hsc70 mRNA were very low. At 4 h post-mitosis, the amount of Hsc70 mRNA levels had begun to increase and continued increasing, reaching 8-fold higher levels 8 h post-mitosis. The Hsc70 mRNA levels then decreased and generally continued to decline until the last measured time point at 18 h postmitosis. Concurrent cell-cycle analysis of the selected cells (Fig. 9B) indicated that from 2 until 10 h postmitotic selection, the majority of cells had a DNA
content characteristic of G1 -phase. DNA synthesis was well underway 15 h after selection indicating that S-phase had begun between 10 and 15 h after mitotic detachment, consistent with a previous synchronization experiment that utilized mitotic detachment to examine cell-cycle-coupled Hsp70 expression [26]. Accumulation of Hsc70 mRNA, therefore, begins in mid-G1 -phase peaks in late G1 -phase then declines during S-phase. 4. Discussion The product of the Hsc70 gene carries out a number of basic cellular functions critical to cell growth and survival. HSC70 is an abundant and stable protein; however, given its multitudinous functions, Hsc70 expression must be responsive to altered con-
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
ditions. Expression of Hsc70 mRNA has been demonstrated here to be regulated under at least three circumstances: tissue speci¢c expression; stress-induced expression, e.g. heat, amino acid analogs or proteosome inhibitors; and cell-cycle position. The mechanism regulating Hsc70 expression in response to cellular stress appears to be related to that of Hsp70 expression. The presence of the HSE elements at the appropriate position in the Hsc70 promoter region and the corresponding gel shift analysis suggests that HSTF is responsible for stress-induced transcription. The Hsp70 gene is activated by the same treatments, i.e. heat shock, azetidine [23] or MG132 treatment [24], supporting the idea that the two genes are regulated similarly. The former two agents are presumed to utilize HSTF1 [30], and HSTF1 is undoubtedly responsible for heat-induced expression. Both azetidine and MG132, however, cause HSTF2 protein levels to increase and gel mobility supershift analysis of HSE/HSTF complexes indicates both HSTF1 and HSTF2 are present ([29,30]; Hunt and Parsian, unpublished observations). The preponderance of HSTF1/HSE complexes following azetidine treatment was interpreted to indicate that factor was responsible for increased Hsp70 transcription. Conversely, the prevalence of HSTF2 in supershifted complexes was taken as evidence for a role in Hsp70 transcription following MG132 treatment [29]. However, embryonic carcinoma cells, as well as testis cells, contain high levels of HSTF2 protein yet express neither Hsp70 nor elevated levels of Hsc70 [28,31,32]. Furthermore, recent studies have demonstrated that the HSTF1 binding activity in hemin-treated human K562 cells, while present in low amounts with respect to HSTF2 binding activity, is responsible for the observed induction of Hsp70 transcription [35] not HSTF2 as originally proposed [36]. Interestingly, hemin, like MG132, is an inhibitor of ubiquitin-dependent proteolysis. Thus the evidence is not yet de¢nitive about the relative role of either HSTF1 or HSTF2 in Hsc70 or Hsp70 transcription following treatment with either azetidine or MG132. Fortunately it should be possible to directly answer this question now that a mouse cell line lacking HSTF1 has been produced by homologous recombination [33]. On the basis of the above results, we expect these cells will not express increased levels of either
323
Hsc70 or Hsp70 mRNA in response to MG132 or azetidine treatment. Finally, Hsc70 expression is coupled by an unknown mechanism to cell-cycle position in exponentially growing HeLa cells. Accumulation of Hsc70 mRNA begins in mid-G1 -phase, peaks in late G1 phase then declines during S-phase. This is signi¢cantly earlier in the cell-cycle than the previously reported mid-S-phase expression of Hsp70 mRNA in HeLa cells [26], a period when Hsc70 mRNA levels decline. Sainis et al. [27] have also observed that Hsc70 mRNA levels are regulated in serum stimulated CV1 monkey cells and increased Hsc70 mRNA in serum stimulated rat cells has been reported [37]. In the former case, Hsc70 mRNA levels also increased before Hsp70 mRNA expression, but were maximal in S-phase then declined during G2 , while Hsp70 mRNA levels peaked in late S/G2 phase. It is unclear why CV1 monkey cells should di¡er in the timing of Hsc70 and Hsp70 expression as compared to HeLa cells. It may be related to the method of cell synchronization, mitotic selection versus serum stimulation, or it may be a di¡erence in basic biology. But, while timing may di¡er, the results demonstrate that mammalian Hsc70 mRNA levels are cell-cycle regulated and that maximal mRNA levels occur before Hsp70 mRNA expression begins. The timing of Hsc70 expression during G1 and early S-phase coincides with the major period of protein synthesis which, given its role in new protein synthesis and transmembrane transport, would require increased levels of HSC70. How Hsc70 expression is coupled to cell-cycle position is unknown. Expression of Hsp70 in HeLa cells during S-phase is regulated by a serum response element unrelated to HSE/HSTF [34] and it is also unlikely Hsc70 cellcycle expression will be HSTF related. This problem, however, is more important than the response to stress as it represents a continuously reoccurring cellular problem of coupling HSC70 levels to protein synthesis levels. Acknowledgements This work was funded by NIH Grants R29 CA/ GM69593 (P.C.G.) and RO1 CA60757 (C.R.H.). The authors would like to thank Ms. Hamideh
BBAEXP 93241 9-3-99
324
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
Zakeri and Ms. Qun Li from the Department of Dermatology, Washington University for their help with DNA sequencing. References [1] C. Hunt, S. Calderwood, Characterization and sequence of a mouse Hsp70 gene and its expression in mouse cell lines, Gene 87 (1990) 199^204. [2] M.D. Perry, L. Aujame, S. Shtang, L.A. Moran, Structure and expression of an inducible HSP-70 encoding gene from Mus musculus, Gene 146 (1994) 273^278. [3] Z.F. Zakeri, D.J. Wolgemuth, C.R. Hunt, Identi¢cation and sequence analysis of a new member of the mouse HSP70 gene family and characterization of its unique cellular and developmental pattern of expression in the male germ line, Mol. Cell. Biol. 8 (1990) 2925^2932. [4] M. Matsumoto, H. Fujimoto, Cloning of hsp70-related gene expressed in mouse spermatids, Biochem. Biophys. Res. Commun. 166 (1990) 43^49. [5] D.G. Bole, L.M. Hendershot, J.F. Kearney, Post-translational association of immunoglobulin heavy chain binding protein with nascent heavy chains in nonsecreting and secreting hybridomas, J. Cell Biol. 102 (1986) 1558^1566. [6] Y. Michikawa, T. Baba, Y. Arai, R. Sakakura, M. Kusakabe, Structure and organization of the gene encoding a mouse mitochondrial stress-70 protein, FEBS Lett. 336 (1993) 27^33. [7] E. Ungewickell, The 70kd mammalian heat shock proteins are structurally and functionally related to the uncoating protein that releases clathrin triskelia from coated vesicles, EMBO J. 4 (1985) 3385^3391. [8] R.P. Beckmann, L.A. Mizzen, W.J. Welch, Interaction of hsp70 with newly synthesized proteins: implication for protein folding and assembly, Science 248 (1990) 850^853. [9] R.J. Deshaies, B.D. Koch, M. Werner-Washburne, E.A. Craig, R. Schekman, A subfamily of stress proteins facilitates translocation of secretory and mitochondrial precursor polypeptides, Nature 332 (1988) 800^805. [10] Y. Shei, J.O. Thomas, The transport of proteins into the nucleus requires the 70kDa heat shock protein or its cytosolic cognate, Mol. Cell. Biol. 12 (1992) 2186^2192. [11] B. Bercovich, I. Stancovski, A. Mayer, N. Blumenfeld, A. Laszlo, A.L. Schwartz, A. Ciechanover, Ubiquitin-dependent degradation of certain protein substrates in vitro requires the molecular chaperone Hsc70, J. Biol. Chem. 272 (1997) 9002^9010. [12] P.C. Goswami, J.L. Roti Roti, C.R. Hunt, The cell cyclecoupled expression of Topoisomerase IIK during S-phase is regulated by mRNA stability and is disrupted by heat shock or ionizing radiation, Mol. Cell. Biol. 16 (1996) 1500^1508. [13] J. Liu, E.S. Maxwell, Mouse U14 snRNA is encoded in an intron of the mouse cognate Hsc70 heat shock gene, Nucleic Acids Res. 18 (1990) 6565^6571.
[14] M. Adamson, J. Silver, C.A. Kozak, The mouse homolog of the gibon ape leukemia virus receptor: genetic mapping and a possible receptor function in rodents, Virology 183 (1991) 778^784. [15] C.A. Kozak, M. Peyser, M. Krall, T.M. Mariano, C.S. Kumar, S. Pestka, B.A. Mock, Molecular genetic markers spanning mouse chromosome 10, Genomics 8 (1990) 519^ 524. [16] G. Hong, W. Deleersnijder, C.A. Kozak, E. VanMarck, P. Tylzanowski, J. Meeregaert, Molecular cloning of a highly conserved mouse and human integral membrane protein (Itm1) and genetic mapping to mouse chromosome 9, Genomic 31 (1996) 295^300. [17] S.L. Sullivan, M.C. Adamson, K.J. Ressler, C.A. Kozak, L.B. Buck, The chromosomal distribution of mouse odorant receptor genes, Proc. Natl. Acad. Sci, USA 93 (1996) 884^ 888. [18] E.L. Green, Genetics and Probability in Animal Breeding Experiments, Oxford University Press, New York, 1981. [19] L.B. Giebel, B.P. Dworniczak, E.K.F. Bautz, Developmental regulation of a constitutively expressed mouse mRNA encoding a 72-kDa heat shock-like protein, Dev. Biol. 125 (1988) 200^207. [20] B. Dworniczak, M.-E. Mirault, Structure and expression of a human gene coding for a 71 kd heat shock `cognate' protein, Nucleic Acids Res. 15 (1987) 5181^5197. [21] J. Klug, Ku autoantigen is a potential major cause of nonspeci¢c bands in electrophoretic mobility shift assays, BioTechniques 22 (1997) 212^216. [22] M. Tavaria, T. Gabriele, R.L. Anderson, M.-E. Mirault, E. Baker, G. Sutherland, I. Kola, Localization of the gene encoding the human heat shock cognate protein, HSP73, to chromosome 11, Genomics 29 (1995) 266^268. [23] S.S. Watowich, R.I. Morimoto, Complex regulation of heat shock- and glucose-responsive genes in human cells, Mol. Cell. Biol. 8 (1988) 393^405. [24] K.T. Bush, A.L. Goldberg, S.K. Nigam, Proteasome inhibition leads to a heat-shock response, induction of endoplasmic reticulum chaperones, and thermotolerance, J. Biol. Chem. 272 (1997) 9086^9092. [25] K.D. Sarge, V. Zimarino, K. Holm, C. Wu, R.I. Morimoto, Cloning and characterization of two mouse heat shock factors with distinct inducible and constitutive DNA-binding ability, Genes Dev. 5 (1991) 1902^1911. [26] I.L. Milarski, R.I. Morimoto, Expression of human Hsp70 during the synthetic phase of the cell cycle, Proc. Natl. Acad. Sci. USA 83 (1986) 9517^9521. [27] I. Sainis, C. Angelidis, G. Pagoulatos, I. Lazaridis, The hsc70 gene which is slightly induced by heat is the main virus inducible member of the hsp70 gene family, FEBS Lett. 335 (1994) 282^286. [28] K.D. Sarge, O.K. Park-Sarge, J.D. Kirby, K.E. Mayo, R.I. Morimoto, Expression of heat shock factor 2 in mouse testis: potential role as a regulator of heat-shock protein gene expression during spermatogenesis, Biol. Reprod. 50 (1994) 1334^1343.
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325 [29] A. Mathew, S.K. Mathur, R.I. Morimoto, Heat shock response and protein degradation: regulation of HSF2 by the ubiquitin^proteasome pathway, Mol. Cell. Biol. 18 (1998) 5091^5098. [30] K.D. Sarge, S.P. Murphy, R.I. Morimoto, Activation of heat shock gene transcription by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity, and nuclear localization and can occur in the absence of stress, Mol. Cell. Biol. 13 (1993) 1392^1407. [31] S.P. Murphy, J.J. Gorzowski, K.D. Sarge, B. Phillips, Characterization of constitutive HSF2 DNA-binding activity in mouse embryonal carcinoma cells, Mol. Cell. Biol. 14 (1994) 5309^5317. [32] M.T. Fiorenza, T. Farkas, M. Dissing, D. Kolding, V. Zimarino, Complex expression of murine heat shock transcription factors, Nucleic Acids Res. 23 (1995) 467^474. [33] D.L. McMillan, X. Xiao, L. Shao, K. Graves, I.J. Benjamin,
[34]
[35]
[36]
[37]
325
Targeted disruption of heat shock transcription factor 1 abolishes thermotolerance and protection against heat-inducible apoptosis, J. Biol. Chem. 273 (1998) 7523^7528. B.J. Wu, G.T. Williams, R.I. Morimoto, Detection of three protein binding sites in the serum-regulated promoter of the human gene encoding the 70-kDa heat shock protein, Proc. Natl. Acad. Sci. USA 84 (1987) 2203^2207. T. Yoshima, T. Yura, H. Yanagi, Heat shock factor 1 mediates hemin-induced Hsp70 gene transcription in K562 erythroleukemia cells, J. Biol. Chem. 273 (1998) 25466^25471. L. Sistonen, K.D. Sarge, B. Phillips, K. Abravaya, R.I. Morimoto, Activation of heat shock factor 2 during hemin-induced di¡erentiation of human erythroleukemia cells, Mol. Cell. Biol. 12 (1992) 4104^4111. P.K. Sorger, H.R.B. Pelham, Cloning and expression of a gene encoding Hsc73, the major hsp70-like protein in unstressed rat cells, EMBO J. 6 (1987) 993^998.
BBAEXP 93241 9-3-99
Characterization and expression of the mouse Hsc70 gene Clayton R. Hunt a
a;
*, Azemat J. Parsian a , Prabhat C. Goswami a , Christine A. Kozak
b
Washington University School of Medicine, Radiation Oncology Center, 4511 Forest Park Blvd., St. Louis, MO 63108, USA b National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892, USA Received 23 September 1998; received in revised form 18 December 1998; accepted 18 December 1998
Abstract A genomic clone encoding the mouse Hsc70 gene has been isolated and characterized by DNA sequence analysis. The gene is approximately 3.9 kb in length and contains eight introns, the fifth, sixth and eighth of which encode the three U14 snoRNAs. The gene has been located on Chr 9 in the order Fli1^Itm1^Olfr7^Hsc70(Rnu14)^Cbl by genetic analysis. Expression of Hsc70 is universal in all tissues of the mouse, but is slightly elevated in liver, skeletal muscle and kidney tissue, while being depressed in testes. In cultured mouse NIH 3T3 cells or human HeLa cells, Hsc70 mRNA levels are low under normal conditions, but can be induced 8-fold higher in both lines by treatment with the amino acid analog azetidine. A similar induction is seen in cells treated with the proteosome inhibitor MG132 suggesting that elevated Hsc70 expression may be coupled to protein degradation. Surprisingly, expression of the human Hsc70 gene is also regulated by cell-cycle position being 8^10-fold higher in late G1 /S-phase cells as opposed to the levels in early G1 -phase cells. ß 1999 Elsevier Science B.V. All rights reserved. Keywords: Hsc70 DNA sequence; Azetidine; MG132; Cell cycle; Gene mapping; Gene expression
1. Introduction When mammalian cells are subjected to a heat shock of 3^8³C above their normal growth temperature they respond by inducing the synthesis of a group of proteins known as heat-shock proteins (HSPs) which allow the cells to survive short periods of hyperthermia. The most prominently induced and most highly conserved member of the HSP family is the 70 000-Da HSP70 protein. However, the heat-inducible Hsp70 genes are only one part of a larger
* Corresponding author. Fax: +1 (314) 362-9790; E-mail: [email protected]
family of Hsp70-related genes that are expressed constitutively in most cells. The unifying features of the family are a high degree of sequence homology, at both the nucleotide or amino acid level and the ability to bind hydrophobic peptide domains. Normally these domains are internally located within proteins, but stress-induced conformational changes or normal cellular processes, such as protein synthesis or transmembrane transport, transiently expose them to an aqueous environment. HSP70 proteins bind the exposed hydrophobic domains to prevent the formation of insoluble aggregates until properly folding or re-folding can occur. In the mouse, seven members of the Hsp70 gene family have been identi¢ed. In addition to the major heat-inducible genes Hsp70-1 [1] and Hsp70-3 [2]; the family includes the developmentally regulated
0167-4781 / 99 / $ ^ see front matter ß 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 9 8 ) 0 0 2 8 5 - 1
BBAEXP 93241 9-3-99
316
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
Hsp70-2 [3] and Hsc70t [4] genes, which are constitutively expressed mainly in male germ cells; and three constitutively expressed genes whose products are localized to di¡erent cellular compartments [5^7]. The Grp78 gene product is an endoplasmic reticulum protein which binds to newly secreted proteins until they are properly modi¢ed and folded [5]. The mitochondrial form of HSP70 [6] is thought to carry out a similar folding function for proteins that are transported in from the cytoplasm. The last member of the Hsp70 gene family is Hsc70 whose product is a major cytoplasmic protein and the most abundant member of the HSP70-related proteins. HSC70 was identi¢ed initially as part of the complex which removes the clathrin protein covering coated vesicles [7], later it was found in association with newly synthesized proteins preventing premature folding of hydrophobic domains as they emerge from the ribosome [8]. HSC70 maintains the unfolded, extended conformation necessary for protein transport through membranes either from the cytoplasm into the mitochondria [9] or from the cytoplasm into the nucleus [10]. Finally, HSC70 has recently been shown to be a required component for ubiquitin-mediated degradation of some proteins of [11]. Despite the large amount of data available on the cellular and mechanistic aspects of HSC70 function, very little is known about the regulation of Hsc70 expression. To begin to examine the regulation of Hsc70, we have isolated the mouse Hsc70 gene, determined its nucleotide sequence and characterized its expression in both tissue and cultured cell lines. 2. Materials and methods 2.1. Cell culture conditions Mouse NIH 3T3 cells were grown in Dulbecco's modi¢ed Eagle's medium with 10% calf serum, 100 U/ml penicillin and 100 Wg/ml streptomycin. HeLa cells were grown in Ham's F10 medium supplemented with 10% calf serum and antibiotics as above. Both HeLa and mouse NIH 3T3 cells were treated with azetidine (L-azetidine-2-carboxylic acid, Sigma) at 5 mM. Treatment of NIH 3T3 cells with 10 WM MG132 (Calbiochem) was by addition from a 100U stock dissolved in DMSO. Synchronous HeLa
cell populations were obtained by selective detachment of mitotic cells as described earlier [12]. At di¡erent times post-selection, aliquots of cell samples were ¢xed with 70% ethanol followed by RNase A treatment and staining with propidium iodide (35 Wg/ ml) then analyzed by one-dimensional £ow cytometry on a FACS 440 (Becton Dickinson Immunocytometry Systems, San Jose, CA). 2.2. Isolation of Hsc70 gene and sequence determination The Hsc70 gene was isolated by PCR screening of a mouse 129/SvJ P1 genomic library (Genome Systems, St. Louis, MO) using an oligonucleotide primer pair based on the intron 6 nucleotide sequence described in a partial Hsc70 mouse gene sequence [13]. Three relevant subclones from the isolated phage P5957 were prepared by cloning BglII fragments into the pLit28 vector (New England Biolabs, Beverly, MA) and the fragments sequenced by the dideoxy chain termination method or by using an Applied Biosystems automated DNA sequencer. Both DNA strands of the Hsc70 gene were entirely sequenced and the resulting data deposited with GenBank as accession number U73744. 2.3. Gene mapping The Hsc70 gene was positioned on the mouse linkage map by Southern blot analysis of two multilocus crosses: (NFS/N or C58/JUM. m. musculus)UM. m. musculus [14], (NFS/NUM. spretus)UM. spretus or C58/J [15]. DNAs from the progeny of these crosses have been typed for over 1000 markers which map to all 19 autosomes and the X chromosome including the chromosome (Chr) 9 markers Fli1 (Friend leukemia virus integration site 1), Itm1 (integral membrane protein 1), Olfr7 (olfactory receptor 7), and Cb1 (Casistas b-lineage lymphoma) as described previously [16,17]. A 369-bp SmaI fragment from the 5Ppromoter region of the Hsc70 gene (nucleotides 10^ 379) was isolated and used to analyze the progeny of these crosses. Recombination was determined according to Green [18] and loci were ordered by minimizing the number of recombinants using the LOCUS program designed by C.E. Buckler (NIAID, Bethesda, MD).
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
317
Fig. 1. The nucleotide sequence of the mouse Hsc70 gene. The complete Hsc70 nucleotide sequence (GenBank accession number U73744) is shown with nucleotides in uppercase representing exon sequences. Uppercase letters above the nucleotide sequence are the corresponding single letter amino acid symbols. The U14 snoRNA sequences in introns 5, 6, and 8 are underlined. The polyadenylation signal at nucleotide 4175 is in bold, while the TATA box at nucleotide 223 in the promoter is in bold and underlined. The mouse transcription start point was calculated by comparison with the experimentally determined human Hsc70 start site [20], while the 3Pterminus is based on the published mouse cDNA sequence [19].
2.4. RNA analysis Total cellular RNA was isolated from cells using TriReagent (MRC Cincinnati, OH) and 10 Wg of each sample was fractionated on 1% agarose-formaldehyde gels, then transferred to GeneScreen Plus (DuPont, Boston, MA) by standard procedures. Radiolabeled probes were prepared by random priming of isolated DNA fragments and hybridized to the membranes under conditions as previously described [1]. Results were quantitated by scanning with a Mo-
lecular Dynamics PhosphoImager (Richmond, CA) and corrected for loading based on the glyceraldehyde phosphate dehydrogenase (GAPD) mRNA, actin mRNA or 18S rRNA level in each sample. Tissue speci¢c expression of mouse Hsc70 mRNA was determined by hybridization of the mouse Hsc70 cDNA probe to a multi-tissue polyA selected RNA Northern blot (Clontech, Palo Alto, CA) under the same conditions. Probes speci¢c for Hsc70 mRNA in mouse were a 590-bp ClaI^EcoRI fragment isolated from the 3P-end of a mouse Hsc70 cDNA clone [19]
BBAEXP 93241 9-3-99
318
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
and for the human Hsc70 mRNA a 381-bp PCR ampli¢ed fragment from the 3P-transcribed end of the human Hsc70 gene [20]. 2.5. Gel mobility shift analysis Cells were grown to 70% con£uence, collected, and resuspended in 10 mM HEPES (pH 7.9), 422 mM NaCl, 0.1 mM EGTA, 5.3% glycerol, 0.5 mM DTT and 0.5 mM PMSF, then incubated on ice for 15 min. The samples were centrifuged for 5 min and the supernatant collected. A heat shock element (HSE) oligonucleotide, derived from nucleotides 197^217 of the Hsc70 promoter sequence (CCCTTCTGGAAGGTTCTAAGA), was kinased with [Q-32 P]ATP, puri¢ed and annealed with the complimentary oligonucleotide. Approximately 10^20 000 cpm of this product was mixed with 10 Wg of protein extract in a total volume of 20 Wl and the mixture incubated for 15 min at room temperature then separated by electrophoresis on 4.5% non-denaturing acrylamide gels in 0.5UTris-borate bu¡er [21]. 3. Results 3.1. Characterization of the Hsc70 gene nucleotide sequence PCR screening of a mouse 129/SvJ P1 genomic
Fig. 2. The nucleotide alignment of the mouse and human Hsc70 gene promoter regions. The mouse and human Hsc70 gene promoter regions were aligned beginning with the common TATA element. Numbering of the nucleotide is based on the mouse Hsc70 sequence in Fig. 1. Upper sequence (Mo) is the mouse, lower sequence (Hu) is the human [20]. Identical nucleotides at a position are in bold, dashes (-) represent single gaps in the alignment. The tandem inverted HSE elements (NGAAN) and TATA box sequences are underlined and in bold due to their identity while the inverted CCAAT boxes are only underlined as they do not align.
Fig. 3. Expression of Hsc70/U14 snoRNA in response to heat shock. Total cellular RNA (10 Wg) extracted from control and heat-shocked mouse NIH 3T3 cells (45³C for 15 min) was analyzed by Northern blotting for Hsc70 mRNA (top panel), U14 snoRNA (second panel) and actin mRNA levels (third panel) as a function of time after the initial heat shock. Levels of Hsc70 and U14 snoRNAs were normalized by comparison to the actin mRNA levels in each sample and plotted as relative abundance (bottom graph). Light bars (left) are relative Hsc70 mRNA levels while dark bars (right) are U14 snoRNA levels.
library yielded a single clone, P5957, which was found to contain Hsc70 homologous sequences after Southern blot analysis with a mouse Hsc70 cDNA probe. Three BglII fragments which hybridized with the cDNA probe were subcloned from P5957 and subjected to DNA sequence analysis (Fig. 1). The entire gene was found within the isolated BglII fragments with the middle portion of the gene being located on a 2.8-kb fragment, while the 5P-region including the promoter and the 3P-region, including
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
319
a polyadenylation signal, were located on the adjacent 4.5- and 4.0-kb fragments, respectively. The primary transcript of the gene is predicted to be 3.9-kb and contain eight introns. The largest intron, 0.55kb, interrupts the 5P-untranslated leader sequence while introns 5, 6, and 8 contain the previously reported U14 snoRNA (small nucleolar RNA) encoding genes [13]. Comparison of the mouse Hsc70 promoter region sequence to that of human gene identi¢ed two regions of extended homology that could be of regulatory signi¢cance (Fig. 2). The upstream sequence beginning 216-bp 5P of the transcription initiation point is 54-bp in length and is 87% identical between the two genes. This is followed Fig. 5. Tissue-speci¢c expression of mouse Hsc70 mRNA. A Northern blot containing polyA selected mRNA isolated from various mouse tissues was hybridized with a radiolabeled mouse Hsc70 cDNA (upper panel) followed by an actin probe (lower panel). Tissues from which the RNA was isolated are indicated across the top while the size markers in kb are shown to the right.
Fig. 4. Chromosomal location of the mouse Hsc70 gene. To the right of the map are given recombination fractions between adjacent loci with the ¢rst fraction representing data from the M. m. musculus crosses and the second representing data from the M. spretus crosses. The numbers in parentheses represent percent recombination and standard error. The map locations for the human homologs of the underlined genes are given to the left of the map.
by a 90-bp region only 23% identical, an essentially random degree of relatedness, which does, however, contain an inverted CAAT box element in each promoter. A larger 65-bp region of homology begins 61bp 5P of the start site, includes the TATA element and is 89% identical between the two genes. Both the upstream and downstream homology regions contain three tandem inverted repeats of the 5-bp NGAAN heat shock element (HSE) sequence. Previous reports indicated expression of neither the human [20] nor the mouse Hsc70 gene [19] was signi¢cantly induced following a mild heat shock. Heat shock of mouse NIH 3T3 cells at 43³C for 30 min did only induce an approximately 2-fold increase in Hsc70 mRNA levels (data not shown). However, when the cells were heat shocked at 45³C for 15 min (Fig. 3), Hsc70 mRNA increased 4^5-fold by 4 h after treatment, while cellular levels of the internal U14 snoRNA increased 2fold. Close examination of the Northern blot reveals that a signi¢cant portion of the Hsc70 mRNA accumulating by 4 h post-heat shock is slightly larger than the ¢nal product. During the next 4 h, these presumed splicing intermediates disappear, while the level of mature mRNA increases, suggestive of a precursor^product relationship. In addition to
BBAEXP 93241 9-3-99
320
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
Fig. 6. Induction of Hsc70 mRNA expression by azetidine. Mouse NIH 3T3 cells (A) or human HeLa cells (B) were treated with 5 mM azetidine and total cellular RNA isolated from the cells at 2-h intervals up to 16 h total treatment time. Hsc70 mRNA levels were analyzed by Northern blotting using human or mouse 3P Hsc70 probes. The Hsc70 mRNA level was normalized to the 18S ribosomal RNA level (mouse) or the GAPD mRNA level (human) then plotted as a function of treatment time with azetidine (bottom panels).
these splicing intermediates, we also observed an Hsc70 related mRNA molecule migrating faster than the normal species (4^8 h post-heat shock). Interestingly, a similar mRNA was detected in HeLa cells when cell-cycle regulated Hsc70 expression was examined (see Fig. 9). It seems likely that both these mRNAs result from aberrant splicing that jumps over one or more of the nine exons present in the Hsc70 primary transcript. 3.2. Chromosomal localization of the Hsc70 gene Initial experiments identi¢ed speci¢c hybridization of digoxigenin-labeled P5957 DNA to mouse chromosome 9 based on the DAPI-stained banding pattern. This result was con¢rmed by hybridizing both P5957 and a biotinylated DNA probe speci¢c for the Chr 9 centromeric region (Genome Systems, St. Louis, MO) simultaneously to metaphase chromosomes (data not shown). A more detailed genetic mapping of the Hsc70 gene was carried using a SmaI fragment from the gene promoter which identi¢ed polymorphic HindIII fragments of 8.6-kb in
NFS/N and C58/J, and 9.1-kb in M. m. musculus. ScaI fragments of 9.5- and 11.8-kb were identi¢ed in M. spretus and NFS/N respectively. Inheritance of the variant fragments was followed in two sets of genetic crosses, and linkage was observed with markers on Chr 9 placing the gene in the order: Fli1^Itm1^Olfr7^Hsc70(Rnu14)^Cbl (Fig. 4). This position is syntenic with 11q23 in humans where the human Hsc70 gene was previously localized by in situ hybridization [22]. 3.3. Hsc70 expression Expression of Hsc70 was found in all tissues analyzed by Northern blotting; however, the mRNA levels were not uniform (Fig. 5). Elevated levels of Hsc70 expression occur in liver, skeletal muscle and kidney tissue as compared to heart, brain, spleen and lung tissue. Interestingly, Hsc70 mRNA levels are comparatively low in testis, a tissue that expresses very high levels of the Hsp70 gene family members Hsc70t and Hsp70-2 [3,4]. Treatment of either mouse NIH 3T3 or human
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
HeLa cells with the proline amino acid analog azetidine caused the level of Hsc70 mRNA to rise 8-fold (Fig. 6). In both cases, maximum accumulation of Hsc70 mRNA was a delayed process requiring 10 h of treatment in the 3T3 cells and 8 h in HeLa cells. Elevated expression of Hsc70 mRNA was also detected in cells treated with the proteosome inhibitor MG132 (Fig. 7). Hsc70 mRNA increased approximately 10-fold after 10 h of treatment, but a signi¢cant increase could be detected by 4 h, earlier than observed with azetidine treatment. Induction of Hsp70 expression by either azetidine [23] or MG132 [24] in human cells has been previously reported and is thought to occur through the same mechanism as by heat shock, i.e. the binding of the heat shock transcription factor (HSTF) to the HSE element of the Hsp70 gene promoter. The HSE elements in the mouse Hsc70 promoter consist of only three inverted tandem repeats of the core sequence NGAAN, whereas the Hsp70 HSE elements contain four repeats [1]. A gel mobility shift assay was carried out to determine if the Hsc70 ele-
Fig. 7. Induction of Hsc70 mRNA expression by MG132. Mouse NIH 3T3 cells were treated with 10 WM MG132 for increasing periods of time and the level of total cellular Hsc70 mRNA determined by Northern blot as in Fig. 6. Individual samples were normalized to the corresponding level of actin mRNA and the Hsc70 mRNA abundance plotted as a function of MG132 treatment period.
321
Fig. 8. Gel mobility shift analysis of the Hsc70 HSE element. Extracts from control and treated NIH 3T3 cells were analyzed for HSTF binding activity by the gel mobility shift assay using a radiolabeled HSE element (CCCTTCTGGAAGGTTCTAAGA) from the Hsc70 gene promoter. Extracts prepared from cells: Lane 1, untreated control; lane 2, 30 min after 15 min at 45³C; lane 3, 7 h after 15 min at 45³C; lane 4, 3-h incubation with 5 mM azetidine ; lane 5, 10-h incubation with 5 mM azetidine; lane 6, 2-h incubation with 10 WM MG132; lane 7, 8-h incubation with 10 WM MG132; lane 8, 8-h incubation with 10 WM MG132 with unlabeled HSE competitor; lane 9, 8-h 10 WM MG132 with unlabeled NF-KB oligonucleotide competitor.
ments bound the heat shock transcription factor following heat shock and if treatment with either azetidine or MG132 also induced binding (Fig. 8). A very low level of HSTF binding to the HSE element could be detected prior to heat shock in the mouse cells. Following heat shock at 45³C for 15 min, the binding level increased dramatically by 30 min then declined, but was still detectable 7 h later. Treatment with azetidine for 3 h also induced low level binding which increased following 10 h of treatment. Treatment with MG132 caused the appearance of an anomalously shifted band after 2 h treatment, but by 8 h, there was a substantial increase in HSTF binding activity which migrated at the same position as the heat shock-induced complex. Competition experiments with either cold HSE competitor oligonucleotide or a non-speci¢c oligonucleotide con¢rmed the speci¢city of the HSE binding reactions. These results indicate that heat shock, azetidine and MG132 all induce HSTF binding to the HSE element in the Hsc70 promoter. Heat shock transcription factor is encoded by two separate genes, HSTF1 and HSTF2, both of which bind the HSE element [25]. Attempts to identify whether the complexes contained exclusively HSTF1 or HSTF2 were unsuccessful. Supershifting of the heat-induced complex with HSTF1 antibody, but not HSTF2 antibody, was ob-
BBAEXP 93241 9-3-99
322
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
Fig. 9. Cell-cycle regulation of Hsc70 mRNA levels. A population of synchronized HeLa cells was prepared by mitotic detachment then re-plated and continued in culture until the times indicated when total cellular RNA was isolated from the cells. The RNA was analyzed for Hsc70 mRNA levels (A, top panel) by Northern blot analysis using a radiolabeled PCR probe spanning the last 381 nucleotides of the human Hsc70 gene. Quantitation was carried out by phosphoimager and the results corrected for loading by re-hybridizing the Northern blot with a GAPD cDNA probe (A, middle panel). The Hsc70 mRNA levels after normalization are plotted as a function of hours post-mitotic selection (A, bottom panel). As the cells were harvested for RNA isolation, selected aliquots were also analyzed for cell-cycle position (B) by one-dimensional £ow cytometry on a FACS 440 instrument. The horizontal axis measures DNA content, while the vertical axis represents cell number.
tained; however, both antibodies supershifted the azetidine and MG132 induced complexes (data not shown). Expression of Hsc70 also appears to be regulated in relation to cell-cycle position. HeLa cells were synchronized by mitotic shake-o¡ and the level of Hsc70 mRNA determined by Northern blot analysis as a function of post-mitotic collection time (Fig. 9A). Two hours after mitosis levels of Hsc70 mRNA were very low. At 4 h post-mitosis, the amount of Hsc70 mRNA levels had begun to increase and continued increasing, reaching 8-fold higher levels 8 h post-mitosis. The Hsc70 mRNA levels then decreased and generally continued to decline until the last measured time point at 18 h postmitosis. Concurrent cell-cycle analysis of the selected cells (Fig. 9B) indicated that from 2 until 10 h postmitotic selection, the majority of cells had a DNA
content characteristic of G1 -phase. DNA synthesis was well underway 15 h after selection indicating that S-phase had begun between 10 and 15 h after mitotic detachment, consistent with a previous synchronization experiment that utilized mitotic detachment to examine cell-cycle-coupled Hsp70 expression [26]. Accumulation of Hsc70 mRNA, therefore, begins in mid-G1 -phase peaks in late G1 -phase then declines during S-phase. 4. Discussion The product of the Hsc70 gene carries out a number of basic cellular functions critical to cell growth and survival. HSC70 is an abundant and stable protein; however, given its multitudinous functions, Hsc70 expression must be responsive to altered con-
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
ditions. Expression of Hsc70 mRNA has been demonstrated here to be regulated under at least three circumstances: tissue speci¢c expression; stress-induced expression, e.g. heat, amino acid analogs or proteosome inhibitors; and cell-cycle position. The mechanism regulating Hsc70 expression in response to cellular stress appears to be related to that of Hsp70 expression. The presence of the HSE elements at the appropriate position in the Hsc70 promoter region and the corresponding gel shift analysis suggests that HSTF is responsible for stress-induced transcription. The Hsp70 gene is activated by the same treatments, i.e. heat shock, azetidine [23] or MG132 treatment [24], supporting the idea that the two genes are regulated similarly. The former two agents are presumed to utilize HSTF1 [30], and HSTF1 is undoubtedly responsible for heat-induced expression. Both azetidine and MG132, however, cause HSTF2 protein levels to increase and gel mobility supershift analysis of HSE/HSTF complexes indicates both HSTF1 and HSTF2 are present ([29,30]; Hunt and Parsian, unpublished observations). The preponderance of HSTF1/HSE complexes following azetidine treatment was interpreted to indicate that factor was responsible for increased Hsp70 transcription. Conversely, the prevalence of HSTF2 in supershifted complexes was taken as evidence for a role in Hsp70 transcription following MG132 treatment [29]. However, embryonic carcinoma cells, as well as testis cells, contain high levels of HSTF2 protein yet express neither Hsp70 nor elevated levels of Hsc70 [28,31,32]. Furthermore, recent studies have demonstrated that the HSTF1 binding activity in hemin-treated human K562 cells, while present in low amounts with respect to HSTF2 binding activity, is responsible for the observed induction of Hsp70 transcription [35] not HSTF2 as originally proposed [36]. Interestingly, hemin, like MG132, is an inhibitor of ubiquitin-dependent proteolysis. Thus the evidence is not yet de¢nitive about the relative role of either HSTF1 or HSTF2 in Hsc70 or Hsp70 transcription following treatment with either azetidine or MG132. Fortunately it should be possible to directly answer this question now that a mouse cell line lacking HSTF1 has been produced by homologous recombination [33]. On the basis of the above results, we expect these cells will not express increased levels of either
323
Hsc70 or Hsp70 mRNA in response to MG132 or azetidine treatment. Finally, Hsc70 expression is coupled by an unknown mechanism to cell-cycle position in exponentially growing HeLa cells. Accumulation of Hsc70 mRNA begins in mid-G1 -phase, peaks in late G1 phase then declines during S-phase. This is signi¢cantly earlier in the cell-cycle than the previously reported mid-S-phase expression of Hsp70 mRNA in HeLa cells [26], a period when Hsc70 mRNA levels decline. Sainis et al. [27] have also observed that Hsc70 mRNA levels are regulated in serum stimulated CV1 monkey cells and increased Hsc70 mRNA in serum stimulated rat cells has been reported [37]. In the former case, Hsc70 mRNA levels also increased before Hsp70 mRNA expression, but were maximal in S-phase then declined during G2 , while Hsp70 mRNA levels peaked in late S/G2 phase. It is unclear why CV1 monkey cells should di¡er in the timing of Hsc70 and Hsp70 expression as compared to HeLa cells. It may be related to the method of cell synchronization, mitotic selection versus serum stimulation, or it may be a di¡erence in basic biology. But, while timing may di¡er, the results demonstrate that mammalian Hsc70 mRNA levels are cell-cycle regulated and that maximal mRNA levels occur before Hsp70 mRNA expression begins. The timing of Hsc70 expression during G1 and early S-phase coincides with the major period of protein synthesis which, given its role in new protein synthesis and transmembrane transport, would require increased levels of HSC70. How Hsc70 expression is coupled to cell-cycle position is unknown. Expression of Hsp70 in HeLa cells during S-phase is regulated by a serum response element unrelated to HSE/HSTF [34] and it is also unlikely Hsc70 cellcycle expression will be HSTF related. This problem, however, is more important than the response to stress as it represents a continuously reoccurring cellular problem of coupling HSC70 levels to protein synthesis levels. Acknowledgements This work was funded by NIH Grants R29 CA/ GM69593 (P.C.G.) and RO1 CA60757 (C.R.H.). The authors would like to thank Ms. Hamideh
BBAEXP 93241 9-3-99
324
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325
Zakeri and Ms. Qun Li from the Department of Dermatology, Washington University for their help with DNA sequencing. References [1] C. Hunt, S. Calderwood, Characterization and sequence of a mouse Hsp70 gene and its expression in mouse cell lines, Gene 87 (1990) 199^204. [2] M.D. Perry, L. Aujame, S. Shtang, L.A. Moran, Structure and expression of an inducible HSP-70 encoding gene from Mus musculus, Gene 146 (1994) 273^278. [3] Z.F. Zakeri, D.J. Wolgemuth, C.R. Hunt, Identi¢cation and sequence analysis of a new member of the mouse HSP70 gene family and characterization of its unique cellular and developmental pattern of expression in the male germ line, Mol. Cell. Biol. 8 (1990) 2925^2932. [4] M. Matsumoto, H. Fujimoto, Cloning of hsp70-related gene expressed in mouse spermatids, Biochem. Biophys. Res. Commun. 166 (1990) 43^49. [5] D.G. Bole, L.M. Hendershot, J.F. Kearney, Post-translational association of immunoglobulin heavy chain binding protein with nascent heavy chains in nonsecreting and secreting hybridomas, J. Cell Biol. 102 (1986) 1558^1566. [6] Y. Michikawa, T. Baba, Y. Arai, R. Sakakura, M. Kusakabe, Structure and organization of the gene encoding a mouse mitochondrial stress-70 protein, FEBS Lett. 336 (1993) 27^33. [7] E. Ungewickell, The 70kd mammalian heat shock proteins are structurally and functionally related to the uncoating protein that releases clathrin triskelia from coated vesicles, EMBO J. 4 (1985) 3385^3391. [8] R.P. Beckmann, L.A. Mizzen, W.J. Welch, Interaction of hsp70 with newly synthesized proteins: implication for protein folding and assembly, Science 248 (1990) 850^853. [9] R.J. Deshaies, B.D. Koch, M. Werner-Washburne, E.A. Craig, R. Schekman, A subfamily of stress proteins facilitates translocation of secretory and mitochondrial precursor polypeptides, Nature 332 (1988) 800^805. [10] Y. Shei, J.O. Thomas, The transport of proteins into the nucleus requires the 70kDa heat shock protein or its cytosolic cognate, Mol. Cell. Biol. 12 (1992) 2186^2192. [11] B. Bercovich, I. Stancovski, A. Mayer, N. Blumenfeld, A. Laszlo, A.L. Schwartz, A. Ciechanover, Ubiquitin-dependent degradation of certain protein substrates in vitro requires the molecular chaperone Hsc70, J. Biol. Chem. 272 (1997) 9002^9010. [12] P.C. Goswami, J.L. Roti Roti, C.R. Hunt, The cell cyclecoupled expression of Topoisomerase IIK during S-phase is regulated by mRNA stability and is disrupted by heat shock or ionizing radiation, Mol. Cell. Biol. 16 (1996) 1500^1508. [13] J. Liu, E.S. Maxwell, Mouse U14 snRNA is encoded in an intron of the mouse cognate Hsc70 heat shock gene, Nucleic Acids Res. 18 (1990) 6565^6571.
[14] M. Adamson, J. Silver, C.A. Kozak, The mouse homolog of the gibon ape leukemia virus receptor: genetic mapping and a possible receptor function in rodents, Virology 183 (1991) 778^784. [15] C.A. Kozak, M. Peyser, M. Krall, T.M. Mariano, C.S. Kumar, S. Pestka, B.A. Mock, Molecular genetic markers spanning mouse chromosome 10, Genomics 8 (1990) 519^ 524. [16] G. Hong, W. Deleersnijder, C.A. Kozak, E. VanMarck, P. Tylzanowski, J. Meeregaert, Molecular cloning of a highly conserved mouse and human integral membrane protein (Itm1) and genetic mapping to mouse chromosome 9, Genomic 31 (1996) 295^300. [17] S.L. Sullivan, M.C. Adamson, K.J. Ressler, C.A. Kozak, L.B. Buck, The chromosomal distribution of mouse odorant receptor genes, Proc. Natl. Acad. Sci, USA 93 (1996) 884^ 888. [18] E.L. Green, Genetics and Probability in Animal Breeding Experiments, Oxford University Press, New York, 1981. [19] L.B. Giebel, B.P. Dworniczak, E.K.F. Bautz, Developmental regulation of a constitutively expressed mouse mRNA encoding a 72-kDa heat shock-like protein, Dev. Biol. 125 (1988) 200^207. [20] B. Dworniczak, M.-E. Mirault, Structure and expression of a human gene coding for a 71 kd heat shock `cognate' protein, Nucleic Acids Res. 15 (1987) 5181^5197. [21] J. Klug, Ku autoantigen is a potential major cause of nonspeci¢c bands in electrophoretic mobility shift assays, BioTechniques 22 (1997) 212^216. [22] M. Tavaria, T. Gabriele, R.L. Anderson, M.-E. Mirault, E. Baker, G. Sutherland, I. Kola, Localization of the gene encoding the human heat shock cognate protein, HSP73, to chromosome 11, Genomics 29 (1995) 266^268. [23] S.S. Watowich, R.I. Morimoto, Complex regulation of heat shock- and glucose-responsive genes in human cells, Mol. Cell. Biol. 8 (1988) 393^405. [24] K.T. Bush, A.L. Goldberg, S.K. Nigam, Proteasome inhibition leads to a heat-shock response, induction of endoplasmic reticulum chaperones, and thermotolerance, J. Biol. Chem. 272 (1997) 9086^9092. [25] K.D. Sarge, V. Zimarino, K. Holm, C. Wu, R.I. Morimoto, Cloning and characterization of two mouse heat shock factors with distinct inducible and constitutive DNA-binding ability, Genes Dev. 5 (1991) 1902^1911. [26] I.L. Milarski, R.I. Morimoto, Expression of human Hsp70 during the synthetic phase of the cell cycle, Proc. Natl. Acad. Sci. USA 83 (1986) 9517^9521. [27] I. Sainis, C. Angelidis, G. Pagoulatos, I. Lazaridis, The hsc70 gene which is slightly induced by heat is the main virus inducible member of the hsp70 gene family, FEBS Lett. 335 (1994) 282^286. [28] K.D. Sarge, O.K. Park-Sarge, J.D. Kirby, K.E. Mayo, R.I. Morimoto, Expression of heat shock factor 2 in mouse testis: potential role as a regulator of heat-shock protein gene expression during spermatogenesis, Biol. Reprod. 50 (1994) 1334^1343.
BBAEXP 93241 9-3-99
C.R. Hunt et al. / Biochimica et Biophysica Acta 1444 (1999) 315^325 [29] A. Mathew, S.K. Mathur, R.I. Morimoto, Heat shock response and protein degradation: regulation of HSF2 by the ubiquitin^proteasome pathway, Mol. Cell. Biol. 18 (1998) 5091^5098. [30] K.D. Sarge, S.P. Murphy, R.I. Morimoto, Activation of heat shock gene transcription by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity, and nuclear localization and can occur in the absence of stress, Mol. Cell. Biol. 13 (1993) 1392^1407. [31] S.P. Murphy, J.J. Gorzowski, K.D. Sarge, B. Phillips, Characterization of constitutive HSF2 DNA-binding activity in mouse embryonal carcinoma cells, Mol. Cell. Biol. 14 (1994) 5309^5317. [32] M.T. Fiorenza, T. Farkas, M. Dissing, D. Kolding, V. Zimarino, Complex expression of murine heat shock transcription factors, Nucleic Acids Res. 23 (1995) 467^474. [33] D.L. McMillan, X. Xiao, L. Shao, K. Graves, I.J. Benjamin,
[34]
[35]
[36]
[37]
325
Targeted disruption of heat shock transcription factor 1 abolishes thermotolerance and protection against heat-inducible apoptosis, J. Biol. Chem. 273 (1998) 7523^7528. B.J. Wu, G.T. Williams, R.I. Morimoto, Detection of three protein binding sites in the serum-regulated promoter of the human gene encoding the 70-kDa heat shock protein, Proc. Natl. Acad. Sci. USA 84 (1987) 2203^2207. T. Yoshima, T. Yura, H. Yanagi, Heat shock factor 1 mediates hemin-induced Hsp70 gene transcription in K562 erythroleukemia cells, J. Biol. Chem. 273 (1998) 25466^25471. L. Sistonen, K.D. Sarge, B. Phillips, K. Abravaya, R.I. Morimoto, Activation of heat shock factor 2 during hemin-induced di¡erentiation of human erythroleukemia cells, Mol. Cell. Biol. 12 (1992) 4104^4111. P.K. Sorger, H.R.B. Pelham, Cloning and expression of a gene encoding Hsc73, the major hsp70-like protein in unstressed rat cells, EMBO J. 6 (1987) 993^998.
BBAEXP 93241 9-3-99