Characterization and mapping of a new male sterility mutant of anther advanced dehiscence (t) in rice

JOURNAL OF

GENETICS AND GENOMICS J. Genet. Genomics 35 (2008) 177182

www.jgenetgenomics.org

Characterization and mapping of a new male sterility mutant of anther advanced dehiscence (t) in rice Yi Zhang 1, *, Yunfeng Li 1, Jian Zhang, Fucheng Shen, Yuanxin Huang, Zhiwei Wu Key Laboratory of Biotechnology and Crop Quality Improvement, Ministry of Agriculture, Southwest University, Chongqing 400716, China Received for publication 23 June 2007; revised 30 August 2007; accepted 30 August 2007

Abstract Anther dehiscence is very important for pollen maturation and release. The mutants of anther dehiscence in rice (Oryza sativa L.) are few, and related research remains poor. A male sterility mutant of anther dehiscence in advance, add(t), has been found in Minghui 63 and its sterility is not sensitive to thermo-photo. To learn the character of sterilization and the function of the add(t) gene, the morphological and cytological studies on the anther and pollen, the ability of the pistil being fertilized, inheritance of the mutant, and mapping of add(t) gene have been conducted. The anther size is normal but the color is white in the mutant against the natural yellow in the wild-type. The pollen is malformed, unstained, and small in the KI-I2 solution. The anther dehiscence is in advance at the bicellular pollen stage. A crossing test indicated that the grain setting ratio of the add(t) is significantly lower than that of the CMS line 2085A. The ability of the pistil being fertilized is most probably decreased by the add(t) gene. The male sterility is controlled by a single recessive gene of add(t). This gene is mapped between the markers of R02004 (InDel) and RM300 (SSR) on chromosome 2, and the genetic distance from the add(t) gene to these markers is 0.78 cM and 4.66 cM, respectively. Keywords: male sterility; sterility character; gene mapping; rice

Introduction  Plant male development is an important issue in the study of plant developmental biology, including the development and maturation of anther and pollen, as well as the dehiscence of anther, and hence, the release of pollen. A lot of genes are expressed in these processes. It is believed that about 10,000 genes are uniquely expressed in tobacco (Nicotiana tabacum L.) anther (Zhao et al., 2000), 3,500 in Arabidopsis anther, among which 1,400 are expressed specially in the pollen (Ma, 2005). In rice (Oryza sativa L.), 259 nonredundant cDNA have been discovered, which are expressed only in anther (Jakobsen et al., 2005). Any mutation in related genes can result in defects or failure during pollen development, release and fertilization, and generate mutants with various male sterile phenotypes. * Corresponding author. E-mail address: [email protected] 1 These authors contributed equally to this work.

Male sterility is disadvantageous for the plant to reproduce itself, but male sterile mutants display tremendous value as genetic tools in the research of male development and heterosis utilization. Researches on male sterile mutants, including sterilization observation, related gene cloning, and function and regulation, are the main aspects in the male development study. These efforts will finally favor controlling of sterility. There are generally two kinds of sterility classes in rice: cytoplast male sterility (CMS) and nuclear nucleic male sterility (NMS). Most male development studies are carried out using NMS mutants as experimental materials. Map cloning is an effective approach to isolate sterility-related genes. However, the premise is the localization of the genes. Many sterility-related genes have been accurately located on different chromosomes. Photosensitive pms1, pms2, and pms3 are located on chromosomes 7, 12, and 3, respectively (Mei et al., 1999). Thermo-sensitive tms1-tms6, rtms2, ms-h, tms6(t), tms7(t), Tms, and Ms-p are located on chromosomes 8, 7, 6, 2, 2, 5, 10, 9, 3, 7, 6,

178

Yi Zhang et al. / Journal of Genetics and Genomics 35 (2008) 177 182

and 10, respectively (Lee et al., 2005; Li et al., 2005). Genes msp-1, aid1, osms-1, osgen-1, ms91(t), ms121, msp1-4, tdr, wda1, and osrad21-4 reside on chromosomes 1, 6,2, 9, 1, 2, 1, 2, 10, and,5 respectively (Nonomura et al., 2003; Zhu et al., 2004; Liu et al., 2005; Moritoh et al., 2005; Liu et al., 2005; Jiang et al., 2006; Wang et al., 2006; Li et al., 2006; Jung et al., 2006; Zhang et al., 2006). Among these genes, tms6, pms1, pms3, ms121, and msp1-4 are fine mapped (Lee et al., 2005; Lu et al., 2005; Jiang et al., 2006; Wang et al., 2006). Besides, some genes such as ms1 (sf) and ms9, on chromosome 6, are located using a classical method (http://www.shigen.nig.ac.jp/rice/oryzabase/top/top.jsp). However, many male sterility genes are not mapped. Anther dehiscence is the last step of pollen maturing. It involves thickening of endothecium, degenerating of septum, and forming of stomium (Ma, 2005). It is necessary that anther keeps closed before the pollen gets matured, for the pollen to develop normally, and timely dehiscence of anther after maturation is critical for pollen release. Of late, some important genes for anther dehiscence in Arabidopsis and rice have been studied (Ma, 2005). Some of the mutants produce pollen normally, but their anthers cannot dehisce. In Arabidopsis, mutations of ms5 and atmyb26 result in nonthickened endothecium, and in the nondehiscent1 mutant, the endothecium conglutinates abnormally. The defects in the endothecium of these mutants cause anther nondehiscence (Dawson et al., 1999; Sanders et al., 1999; Steiner et al., 2003). In rice, mutation in the Aid1 gene causes 55% of the flowers to have nondehiscent anthers or be retarded in dehiscence because of septum degeneration failure (Zhu et al., 2003). Some mutants have impaired pollen and dehiscence-retarded anther, which are usually related to the jasmonic acid (JA) pathway. Mutations of fad3, fad7, and fad8 affect the synthesization of jasmonate progenitors and result in male sterility (McConn and Browse, 1996). Mutation in Dad1 impairs the phospholipase gene, which is critical for the first step of JA synthesis (Ishiguro et al., 2001). The mutant of delayed dehiscence1 displays retarded stomium dissolving (Sanders et al., 2000; Stintzi and Browse, 2000). The authors found a male sterile mutant in Minghui 63 (indica rice restorer), which had a phenotype of advanced dehiscent anther and named it anther advanced dehiscence (t) and aad(t) for short. They have reported the sterility characterization and gene location of this mutant here.

Materials and methods Plant materials Sterile material: anther advanced dehiscence (t), a male sterility mutant, mutated spontaneously from Minghui 63 (indica rice restorer), was found in 2004.

Fertile materials: Minghui 63, R27 (a restorer line bred from the generations of Jinhui 1 × Minghui 63), Zhenshan 97B (a famous indica rice maintainer) Methods Characterization of mutant phenotype The mutant aad(t) and wildtype Minghui 63 were investigated as described a little further in the text. Anatomical observation: The matured fresh anthers of Minghui 63 and aad(t) were placed together under a Nikon SMZ1500 stereoscope (Nikon, Tokyo, Japan) to investigate the modality and were photographed with a Nikon DS-5Mc digital camera (Nikon, Tokyo, Japan). To observe the shape, size, and color of the matured pollen, anthers at flowering time were dollied and stained in 1% iodine-potassium iodide KI-I2 solution. Light microscopy was performed with a Nikon E600 (Nikon, Tokyo, Japan). Cytological observation: The anthers were fixed at different developmental stages in FAA (an admixture of formalin, dehydrated alcohol, and glacial acetic acid) solution; paraffin slices were made, and observed under the microscope to study the development of each layer of cell and pollen. The standard paraffin sections were carried out as described by Li (2001). The sections were stained with 1% Ehrlich’s hematoxylin and 0.03% acid fuchsine, respectively, dehydrated through an ethanol series, infiltrated with xylene, and covered permanently. Light microscopy was performed with a Nikon E600, and a Nikon DS-5Mc digital camera was used to photograph. Ability of pistil being fertilized Using the mutant as a female parent and Minghui 63, R27, and Zhenshan 97B as male parents, out crosses were conducted thrice. A CMS line 2085A was used as a control and out crossed to Minghui 63, R27, and Zhenshan 97B, respectively. Each cross lasted for two days and was repeated twice a day. The t-test was performed to detect the difference in the pistil being fertilized ability. Genetic analysis Using a mutant as female parent and Minghui 63 and Zhenshan 97B as the male parents, out cross and in cross were conducted. Fertility of F1 generations and segregation ratio of fertility and sterility of F2 plants were measured at the flowering stage. The chi-square test was conducted to test the goodness-of-fit. Mapping population The F2 population was derived from the cross of aad(t) × Zhenshan 97B. Equal amounts of DNA from each of the 15 male sterile and fertile plants were used to construct bulks from F2 segregants. At the same time, leaves from the parents and sterile plants of the F2 population were

Yi Zhang et al. / Journal of Genetics and Genomics 35 (2008) 177 182

collected for extracting DNA. DNA extraction The parental and DNA pools were extracted using the Cetyltrimethylammonium Bromide (CTAB) method. Each individual DNA was extracted according to the Wang’s method with slight modification (Wang et al., 2002). InDel primer design The polymorphic loci of InDel were obtained by comparing the sequences of japonica rice Nipponbare and indica rice 9311(Shen et al., 2004). One hundred and thirty seven pairs of InDel primers were designed using software Primer 5.0 and every two adjacent markers were about 2.53.0 Mb apart. Microsatellite (also known as SSR) primers were synthesized according to the published primer sequences (http://www.gramene.org). Linkage analysis All InDel primers were screened against the parents and the bulks. Polymorphic primers were confirmed with sterile individuals. Amplification products were analyzed on 6% PAGE sequencing gels and silver stained.

Results Characterization of aad(t) The male sterility of aad(t) was not sensitive to variations of temperature and light because both seedling and regenerated plantlets were sterile when planted in different natural environments, such as, Chongqing with low temperature and long light and Hainan with high temperature and short light. Except for the white color, the anther sizes of aad(t) and Minghui 63 were not significantly different, but the pollen of aad(t) was abnormal and small in size and was not stained by iodine solution. Interestingly, the pollen of aad(t) in iodine solution disparted into two layers apparently (the same field of view with different foci) and each layer was different in shape. The pollen farther from the objective

179

had an enlarged germinal pore, but the pollen nearer to the objective had no germinal pore (Fig. 1). To determine the anther morphological defects in the aad(t) mutant, transverse sections of anther, at different stages of development, were further examined. There was no difference between the add(t) mutant and Minhui 63 before the late microspore stage. However, from the early bicellular pollen stage, the anthers of aad(t) dehisced in advance and the unmatured pollen was exposed to an open environment. Therefore, the pollen of aad(t) stopped development without entering the phase of bicellular pollen and became small and abnormal without starch accumulation (Fig. 2). Ability for the aad(t) pistil being fertilized During the process of preparing genetic and mapping population, the authors found that the mutant was not easy to be cross-fertilized. To find out the reasons, pollen from different parents, including Minghui 63, R27, and Zhenshan 97B, were used to adequately fertilize aad(t) and 2085A, respectively. Table 1 shows the grain setting ratios of each cross. The ability for the pistil being fertilized in aad(t) was obviously lower than in the CMS line 2085 A (Table 1). When fertilized by different parents, the aad(t) mutant was remarkably different in setting ratios. The cross of aad(t) × R27 was the highest one among the crosses, when aad(t) was used as the female parent. However, 2085 A showed less difference in the setting ratios than aad(t), when fertilized by those parents. This indicated that the mutated gene aad(t) not only resulted in male sterility, but also caused a defect in the pistil’s ability to be fertilized. The decreasing range changed with the pollen donor. Genetic analysis of aad(t) All F1 plants of each combination were fertile, which indicated that the sterility of aad(t) was recessive. The segregation ratios of aad(t) × Minghui 63 and aad(t) × Zhenshan 97B were 293:120 and 660:193, respectively. Chi-square tests showed that both ratios fitted 3:1 (F20.05 =

Fig. 1. Modality of mature anther and pollen of aad(t). A, C: fertile anther and pollen; B, D, and E: sterile anther and pollen; C, D, and E show the modality of pollen in KI-I2 solution; D: the sterile pollen farther from the object have a germinal pore; E: the sterile pollen nearer the object have no germinal pore. GP: germinal pore.

Yi Zhang et al. / Journal of Genetics and Genomics 35 (2008) 177 182

180

Fig. 2. The sterilizing course of aad(t). A, C, and E show the transverse sections of wild anther, and the other panels show the mutants. S: stomium; GP: germinal pore. A and B: The late microspore stage: no difference between wild and mutant type; C and D: the earliest bicellular pollen stage. The pollen sac stomium of mutant anther came into being in advance. E and F: the early bicellular pollen stage. The mutant anther had dehisced in advance, but the wild anther was still closed. The shape of the wild pollen took a lens form, but the mutant pollen did not change in that manner and some of them had a germinal pore. Table 1 Comparisons of grain setting ratios between aad(t) and CMS 2085A Minghui 63 *

R27

Zhenshan 97B *

aad(t) 48.93 ±8.87 69.87 ±0.47 51.63*±5.96 2085A 75.85±3.79 86.31±2.32 81.67±4.82 v = 4, t0.05 = 2.776; * represents the significant difference between aad(t) and 2085 A.

3.41, 2.44 < F20.05 = 3.84), which indicated that sterilization was controlled by a single recessive gene. Mapping of aad(t) gene Screening of InDel and SSR markers linked to the aad(t) gene One hundred and thirty seven pairs of InDel primers

were used to amplify the parent and gene pools simultaneously, and the InDel marker R02004 on chromosome 2 was polymorphic both in the parent and the gene pools. R02004 was further checked with 24 recessive individuals of the F2 population, to verify the linkage with the aad(t) gene, and the result indicated that R02004 was linked with the aad(t) gene. To locate the gene between the two marker loci, the authors synthesized 12 pairs of SSR or the InDel primers within 10.0 Mb from both sides of R02004. These primers were screened with aad (t) and Zhenshan 97B. R02001 (InDel), RM452, RM300, and RM8254 (SSR) exhibited polymorphism between the parents. The linkage relationship of these markers was confirmed by a single plant test. The sequences of the diversity primers are shown in Table 2.

Table 2 Sequences of linkage and polymorphic markers Primer name

Forward sequence

Reverse sequence

R02001

CGATAGGCAACTAAAACATT

CTTGTCCTCCTGCTCTGTA

RM452

CTGATCGAGAGCGTTAAGGG

GGGATCAAACCACGTTTCTG

R02004

GCAATTTAACCCTTATTCCTG

GGGAAGAAGAAAGCCATTAG

RM300

GCTTAAGGACTTCTGCGAACC

CAACAGCGATCCACATCATC

RM8254

AAAGGGACCCACTTGTCAGC

GTCGAGGATGGATCGATGG

Yi Zhang et al. / Journal of Genetics and Genomics 35 (2008) 177 182

Estimation of genetic distance and gene mapping To map the aad(t) gene, the authors checked the two markers (R02001 and RM8254) with 193 male sterile individuals and subsequently analyzed their linkage relationship to the aad(t) gene. These markers detected 18 and 49 recombinants, respectively. The recombinants of R02001 and RM8254 were not involved mutually, which indicated that the aad(t) gene was flanked by markers R02001 and RM8254. Subsequently, the other markers, RM452, R02004, and RM300 were checked with the recombinants of R02001 and RM8254. One, three, and eighteen recombinants of RM452, R02004, and RM300 were found, respectively. According to the recombinant numbers and the coherence of recombination of these markers, the aad(t) gene was located between the InDel marker R02004 and SSR marker RM300, with genetic distances of 0.78 cM and 4.66 cM, respectively. From the physical mapping of the GRAMENE data and the build 4.0 pseudomolecules of the rice genome (http: //www.gramene.org/Oryza_sativa/index. html), the aad(t) gene was delimitated at a physical distance of about 2.83 Mb (from 10,38,6191st bp to 13, 220, 382nd bp, on chromosome 2). The linkage map of the aad(t) gene and the linked markers are shown in Fig. 3.

Fig. 3. The linkage map of the region encompassing the aad(t) gene. The rectangle shows the possible region of the aad(t) gene.

Discussion Male development of rice is very complicated. It in-

181

volves regulations of many gene expressions. The proper spatiotemporal expression of these genes, ordinal operation of associated physiology and biochemical processes, and the synergistic effects of the tissues and cells in the anther, are the guarantee of normal development and release of the pollen. The dehiscence of anther is the final step of anther development, involving the thickening of the endothecium, degenerating of the septum, and forming of the stomium (Ma, 2005). Only two styles (no dehiscence and delayed dehiscence) regarding the abnormal phenomena of anther dehiscence have been reported. These reported mutants of anther dehiscence can form normal pollen at a certain point (McConn and Browse, 1996; Sanders et al., 1999; Dawson et al., 1999; Stintzi and Browse, 2000; Sanders et al., 2000, 2003; Ishiguro et al., 2001; Zhu et al., 2004; Ma, 2005). Only one of them concerns the anther dehiscence of rice and the related gene is located on chromosome 6. These researches are useful to the understanding of the mechanism of pollen release and distribution. In this study, the aad(t) mutant was different from the other mutants of anther dehiscence. The reported phenomena included no dehiscence and delayed dehiscence. However, the abnormal character of aad(t) was anther dehiscence in advance, at the early bicellular pollen stage. There were no normal or matured pollen in the aad (t) mutant. Gene aad(t) was located between 10.4 Mb and 13.2 Mb on chromosome 2 and the sequence was 2.83 Mb in length. Four sterility genes were located on chromosome 2 in rice, which were, ms121 (Jiang et al., 2006), tdr (osms-l) (Liu et al., 2005; Li et al., 2006), tms4, and tms5 (Lee et al., 2005). Ms121 is mapped between 7.4 Mb and 7.7 Mb, with the following sterilization characters: abnormal formation of the sporopollenin lamella of the pollen germinal pore, which leads to defects of the operculum (Jiang et al., 2006). The Tdr (osms-l) gene is mapped before 1.3 Mb and mutation in the Tdr (osms-l) gene causes abnormal expanding of cells in the tapetum, causing degeneration retardation of tapetum, collapsing of microspores, and finally there is no pollen (Liu et al., 2005). Both Tms4 and tms5 are thermosensitive nucleus male sterile. On the basis of the earlier comparison, the authors have determined that aad(t) is a new gene that is involved in anther dehiscence, in rice. Further researches, including mapped cloning and the function of aad(t), may post the reason for advanced anther dehiscence and improve the knowledge of the mechanism of anther dehiscence.

Acknowledgements This work was supported by the Natural Science Foundation Project CQ CSTC (No. 2007BB1363) and Chongqing Municipal Education Commission (No. KJ070214) of China.

182

Yi Zhang et al. / Journal of Genetics and Genomics 35 (2008) 177 182

References Dawson, J., Sozen, E., Vizir, I., van Waeyenberge, S., Wilson, Z.A., and Mulligan, B.J. (1999). Characterization and genetic mapping of a mutation (ms35) which prevents anther dehiscence in Arabidopsis thaliana by affecting secondary wall thickening in the endothecium. New Phytoltgist, 144: 213222. Ishiguro, S., Kawai-Oda, A., Ueda, J., Nishida, I., and Okada, K. (2001). The DEFECTIVE IN ANTHER DEHISCIENCE1 gene encodes a novel phospholipase A1 catalyzing the initial step of jasmonic acid biosynthesis, which synchronizes pollen maturation, anther dehiscence, and flower opening in Arabidopsis. Plant Cell 13: 21912209. Jakobsen, M.K., Poulsen, L.R., Schulz, A., Fleurat-Lessard, P., Møller, A., Husted, S., Schiøtt, M., Amtmann, A., and Palmgren1, M.G. (2005). Pollen development and fertilization in Arabidopsis is dependent on the MALE GAMETOGENESIS IMPAIRED ANTHERS gene encoding a Type V P-type ATPase. Genes Dev. 19: 27572769. Jiang, H., Yang, Z.N., and Gao, J.F. (2006). The genetic analysis and molecular mapping in rice OsMS121mutant. J. Shanghai Normal University (natural science) 35: 7175 (in Chinese with an English abstract). Jung, K.H., Han, M.J., Lee, D.Y., Lee, Y.S., Schreiber L., Franke, R., Faust, A., Yephremov, A., Saedler, H., Kim, Y.W., Hwang, I., and An, G. (2006). Wax-deficient anther1 is involved in cuticle and wax production in rice anther walls and is required for pollen development. Plant Cell 18: 30153032. Lee, D.S., Chen, L.J., and Suh, H.S. (2005). Genetic characterization and fine mapping of a novel thermo-sensitive genic male- sterile gene tms6 in rice (Oryza sativa L.). Theor. Appl. Genet. 111: 12711277. Li, G.Q. (2001). Fundamentals of Cytology Research. (Beijing: China Forestry Press). Li, N., Zhang, D.S., Liu, H.S., Yin, C.S., Li, X.X., Liang, W.Q., Yuan, Z., Xu, B., Chu, H.W., Wang, J., Wen, T.Q., Huang, H., Luo, D., Ma, H., and Zhang, D.B. (2006). The rice tapetum degeneration retardation gene is required for tapetum degradation and anther development. Plant Cell 18: 29993014. Li, R.B., Pandey, M.P., and Sharma, P. (2005). Inheritance of thermosensitive genic male sterility in rice (Oryza sativa L.) . Current Sci. 88: 18091815 Liu, H.S., Chu, H.W., Li, H., Wang, H.M., Wei, J.L., Li, N., Ding, S.Y., Huang, H., Ma, H., Huang, C.F., Luo, D., Yuan, Z., Liu, J.H., and Zhang, D.B. (2005). Genetic and mapping analysis of rice male sterile mutant of OsMS-L. Chinese Sci. Bull. 50: 122125. Liu, X., Wang, S.W., Li, C.Y., Shi, L.L., Zhang, X., Guo, Y.H., and Liu, F. (2005). Study on ms91(t) gene mapping population in rice. J. Tianjin Agri. College 12: 69 (in Chinese with an English abstract). Lu, Q., Li, X.H., Guo, D., Xu, C.G., and Zhang, Q. (2005). Localization of pms3, a gene for photoperiod-sensitive genic male sterility, to a 28.4 kb DNA fragment. Mol. Gen. Genomics 273: 507511. Ma, H. (2005). Molecular genetic analyses of microsporogenesis and microgametogenesis in flowering plants. Annu. Rev. Plant Biol. 56: 393434.

McConn, M., and Browse, J. (1996).The critical requirement for linolenic acid is pollen development, not photosynthesis, in an Arabidopsis mutant. Plant Cell, 8: 403416. Mei, M.H., Dai, X.K., Xu, C.G., and Zhang, Q.F. (1999). Mapping and genetic analysis of the genes for photoperiod-sensitive genic male sterility in rice using the original mutant nongken 58S. Crop Sci, 39: 17111715. Moritoh, S., Miki, D., Akiyama, M., Kawahara, M., Izawa, T., Maki, H., and Shimamoto, K. (2005). RNAi-mediated silencing of OsGEN-L (OsGEN-like) , a new member of the RAD2/XPG nuclease family, causes male sterility by defect of microspore development in rice. Plant Cell Physiol. 46: 699715. Nonomura, K.I., Miyoshi, K., Eiguchi, M., Suzuki, T., Miyao, A., Hirochika, H., and Kurata, N. (2003). The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice. Plant Cell 15: 17281739. Sanders, P.M., Bui, A.Q., Weterings, K., McIntire, K.N., and Hsu, Y.C. (1999). Anther developmental defects in Arabidopsis thaliana male-sterile mutants. Sex. Plant Reprod. 11: 297322. Sanders, P.M., Lee, P.Y., Biesgen, C., Boone, J.D., and Beals, T.P. (2000). The Arabidopsis DELAYEDDEHISCENCE1 gene encodes an enzyme in the jasmonic acid synthesis pathway. Plant Cell 12: 10411061. Shen, Y.J., Jiang, H., Jin, J.P., Zhang, Z.B., Xi, B., He, Y.Y., Wang, G., Wang, C., Qian, L.L., Li, X., Yu, Q.B., Liu, H.J., Chen, D.H., Gao, J.H., Huang, H., Shi, T.L., and Yang, Z.N. (2004). Development of genome-wide DNA polymorphism database for map-based cloning of rice genes. Plant Physiol. 135: 11981205. Steiner-Lange, S., Unte, U.S, ., Eckstein, L., Yang, C., and Wilson, Z.A. (2003). Disruption of Arabidopsis thaliana MYB26 results in male sterility due to non-dehiscent anthers. Plant J. 34: 519528. Stintzi, A., and Browse, J.. (2000). The Arabidopsis male-sterile mutant, opr3, lacks the 12-oxophytodienoic acid reductase required for jasmonate synthesis. Proc. Natl. Acad. Sci. USA 97: 1062510630. Wang, X.F., Yang, J.B., and Xiang, T.H. (2002). A new method for PCR reaction from alkali-treated rice leaf tissues. Chinese J. Rice Sci. 16: 6770 (in Chinese with an English abstract). Wang, Y., Wang, Y.F., and Zhang, D.B. (2006). Identification of the rice (Oryza sativa L.) mutant msp1-4 and expression analysis of its UDT1 and GAMYB genes. J. Plant Physiol. Mol. Biol. 32: 527534 (in Chinese with an English abstract). Zhang, L.G., Tao, J.Y., Wang, S.X., Chong, K., and Wang, T. (2006).The rice OsRad21-4, an orthologue of yeast Rec8 protein, is required for efficient meiosis. Plant Mol. Biol. 60: 533554. Zhao, G.R., Xiao, X.G., and Liu, P.Y. (2000). Proceeding of genetically engineering plant male sterility. In: International Symposium on Biotechnology Application in Horticultural Crops. Zhu, Q.H., Ramm, K., Ramm, K., Ramani, S., Elizabeth, S.D., and Narayana, M.U. (2004).The ANTHER INDEHISCENCE1 gene encoding a single MYB domain protein is involved in anther development in rice. Plant Physiol, 135: 15141525. H