Characterization and mutagenesis of fur gene from Burkholderia pseudomallei

Gene 254 (2000) 129–137 www.elsevier.com/locate/gene

Characterization and mutagenesis of fur gene from Burkholderia pseudomallei Suvit Loprasert a, *, Ratiboot Sallabhan a, Wirongrong Whangsuk a, Skorn Mongkolsuk a,b a Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok10210, Thailand b Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok, Thailand Received 26 January 2000; received in revised form 8 April 2000; accepted 19 June 2000 Received by J. Widom

Abstract A homolog of the ferric uptake regulator gene ( fur) was isolated from Burkholderia pseudomallei (Bp) by a reverse genetic technique. Sequencing of a 2.2 kb DNA fragment revealed an open reading frame with extensive homology to bacterial Fur proteins. The cloned gene encodes a 16 kDa protein that cross-reacts with a polyclonal anti-Escherichia coli Fur serum. The transcription start site was determined by the primer extension technique. Expression analysis of fur showed no increased fur mRNA levels in response to various stresses and iron conditions. A positive selection procedure involving the isolation of manganese-resistant mutants was used to isolate mutants that produce altered Fur proteins. Sequencing of a fur mutant revealed a nucleotide change (G to A) converting a conserved amino acid arginine-69 to histidine. The fur missense mutant produced an elevated level of siderophore that could be complemented by a multicopy plasmid carrying the Bp fur. Interestingly, Fur was found to play roles as a positive regulator of FeSOD and peroxidase. The mutant showed a decreased activity of FeSOD and peroxidase, which could be important in its pathogenicity and survival in macrophages. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Ferric uptake regulator; Gene regulation; Melioidosis; Peroxidase; Superoxide dismutase

1. Introduction Burkholderia pseudomallei (Bp) is a human bacterial pathogen endemic in Southeast Asia and Northern Australia. The organism is a Gram-negative soil saprophyte. Infection is due to soil- or water-contamination of skin abrasions or inhalation. Bp can disseminate from the site of infection to virtually any other organ in the body. In some cases, the bacteria cause an acute and fatal septicemia, and in many cases the bacteria remain dormant in the body for many years. Acute septicemic melioidosis is the most severe mortal disease in northeastern Thailand (Leelarasamee and Bovornkitti, 1989). Abbreviations: Bp, Burkholderia pseudomallei; bp, base pair(s); fur, ferric uptake regulator; kb, kilobase(s) or 1000 bp; MMLV, Moloney murine leukemia virus; nt, nucleotide(s); ORF, open reading frame; PCR, polymerase chain reaction; U, units. * Corresponding author. Tel.: +662-574-0622, ext. 1402; fax: +662-574-2027. E-mail address: [email protected] (S. Loprasert)

Bp was found to survive and multiply in phagocyte cells (Jones et al., 1996). Relapses occur if the organism is not completely eliminated after the first episode of illness or if antibiotic resistance is acquired during treatment. In host tissues and serum, the availability of free iron is very low, as most iron is complexed with host proteins such as hemoglobin and transferrin. This low iron concentration is regarded as a non-specific defense mechanism against the invading organisms. Conversely, successful pathogens can use it as a stimulus to express virulence factors such as toxins and other factors required for in vivo growth (Litwin and Calderwood, 1993). Most bacteria have the ability to produce and secrete iron chelator molecules, siderophores, to meet their iron requirements (Neilands, 1993). Siderophores are water-soluble, low-molecular-weight molecules that bind ferric ion with high affinity. Bp also produces a 1000 Da siderophore called malleobactin that belongs to the hydroxamate class. Malleobactin is capable of removing iron from both transferrin and lactoferrin

0378-1119/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 0 0 ) 0 0 27 9 - 1

130

S. Loprasert et al. / Gene 254 (2000) 129–137

( Yang et al., 1993). The molecular basis of coordinate regulation by iron has been studied most thoroughly in Escherichia coli. In this organism, coordinate regulation of gene expression by iron depends on the regulatory gene fur (ferric uptake regulator). The Fur protein represses the transcription of iron-regulated promoters in response to an increasing intracellular iron concentration. It has been suggested that Fur binds to the specific sequence, Fur box, overlapping Fur-regulated promoters when the intracellular iron concentration is high enough to allow the formation of an iron–Fur dimer complex. The N-terminus of Fur is responsible for DNA-binding, whereas the C-terminus is involved in dimerization of the protein (Stojiljkovic and Hantke, 1995). Regulation of gene expression by iron occurs in a number of pathogenic organisms. Iron-regulated expression in these organisms is coordinated by proteins homologous to the Fur protein. At least some of these different genera use Fur-like regulatory proteins to control genes encoding virulence factors. Additional regulatory proteins may be superimposed on the Fur repressor to provide the fine-tuning necessary for the precise regulation of individual virulence genes in response to iron and other environmental signals. Fur and the iron concentration are part of the more global control system regulating not only iron assimilation but also several other factors involved in pathogenicity (Litwin and Calderwood, 1993). The molecular mechanisms by which Bp causes disease are poorly understood. Studies of the mechanisms of regulation of iron acquisition systems and virulence determinants by iron should lead to a better understanding of the adaptive response of bacteria to the low-iron environment of the host and its importance in virulence. In this study, we describe the cloning, DNA sequence and mutation of the fur gene of Bp. The effects of different stresses on fur expression were analyzed at the transcriptional level. Moreover, the roles of Fur as a positive regulator of superoxide dismutase (SOD) and peroxidase expression are discussed.

2. Materials and methods 2.1. Bacterial strains, growth conditions and enzyme assays Bp P844 used in this study is a clinical isolate strain kindly provided by Professor S. Sirisinha. Bp and E. coli are routinely maintained in Luria–Bertani (LB) medium (Sambrook et al., 1989). Low-iron conditions were achieved by supplementing M9 minimum medium (Gibco BRL) with the iron chelator 2,2-dipyridyl (Sigma Chemical Co.) to a final concentration of 100 mM. Highiron conditions were achieved by supplementing M9 minimum medium with 25 mM ferric chloride. When

antibiotic selection was necessary, the growth medium was supplemented with ampicillin (100 mg/ml ). b-galactosidase assays were performed according to Miller’s method (Miller, 1972). E. coli fur mutants, QC1732 [F− D(argF–lac)U169 rpsL Dfur::kan] ( Touati et al., 1995) and H1618 [thr lac.ser fhuA thi hsdR fiu::MudI(Ap lac)fur-31] were used in the experiments.

2.2. Recombinant DNA techniques Restriction enzymes and T4 ligase were purchased from Promega, USA. All enzymes were used according to the manufacturer’s instructions. DNA manipulation, Bp chromosome isolation and E. coli transformation were performed according to the standard protocols (Sambrook et al., 1989). Conjugation of broad-hostrange plasmid pBBR1-MCS from E. coli donor S17/lpir (provided by Dr M.F. Alexeyev) to Bp was carried out as described ( Kovach et al., 1995). RNA was isolated by using Triazol (Gibco BRL). Plasmid DNA was prepared by using affinity column (Qiagen). DNA sequencing was performed with an Applied Biosystem model 310 DNA sequencing system and a Taq Dye Deoxy Terminator cycle sequencing kit (Applied Biosytems). Southern blots were prepared by standard protocols (Sambrook et al., 1989). Probes were 32Plabeled with DNA labeling kit (Amersham).

2.3. PCR A 150 bp conserved region of fur was amplified from 0.5 mg of Bp genomic DNA by PCR using primer I 5∞ GGCCTGAAGGT (GC )AC (GC )CTGCCGCG 3∞ and primer II 5∞ CAG (GC )ACGCGGTA (CG)AC (CG)CTCGCCAGGCC 3∞. Bases in parentheses are mixed bases. The PCR reaction contained 25 pmol of primers I and II, a commercial PCR reaction buffer and nucleotide mix (Promega), and 2 U of Taq polymerase. The PCR reactions were performed using the following cycle conditions: denatured at 94°C for 3 min, then 35 cycles of denaturing at 94°C for 1 min, annealed at 50°C for 1 min and extension at 72°C for 1 min. The 150 bp PCR products were cloned into pGEM-T easy vector (Promega). Promoter and open reading frame (ORF ) of fur were amplified from 0.5 mg of BpF1 genomic DNA by PCR using primer III 5∞ AGTCCGACCACGGCGACAGC 3∞ and primer IV 5∞ GCTTCTCGAGGTGCTTGCGAT 3∞. The PCR reactions and conditions were the same as mentioned above, except that Pfu polymerase (Stratagene) was used instead of Taq polymerase. The PCR products were cloned into pBluescriptKS vector (Stratagene).

S. Loprasert et al. / Gene 254 (2000) 129–137

131

2.4. Western blot and detection of Fur

2.8. Accession

Whole-cell extracts were made as described (Sambrook et al., 1989). The total protein concentration was determined by the dye-binding method and 10 mg of extract for each strain was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE ). Electrophoresis, blotting, and antibody reaction analysis were performed as previously described (Mongkolsuk et al., 1997), except that an anti-E. coli Fur antibody was used as a primary antibody at 1:5000 dilution. Antibody reactions were detected by goat antirabbit antibody conjugated to alkaline phosphatase (Promega) as recommended by the manufacturer.

The sequence of the fur gene has been deposited in the GenBank under accession number AF117238.

2.5. Primer extension Primer extension experiments were carried out as previously described ( Kullik et al., 1995). The 0.5 pmol of oligonucleotide (5∞ GCGGTCAGGTGGCGAACCGG 3∞) was end-labeled by using (c-32P)ATP and T 4 DNA kinase, mixed with 2 mg of total RNA, incubated at 70°C for 10 min, 50°C for 20 min, and then at 42°C for 2 min and reverse transcribed with Superscript II MMLV reverse transcriptase at 42°C. The extension product was electrophoresed on an 8% acrylamide–8 M urea. Comparison was made with a sequencing ladder prepared from the fur gene by using the same primer included on the same gel.

2.6. Expression analysis A 100 mM final concentration of tBOOH (tert-butylhydroperoxide), H O , and menadione was added to a 2 2 mid-log-phase BP. The induced and uninduced cultures were grown for 15 min before being harvested for total RNA isolation.

2.7. SOD and peroxidase activity gel staining and assay Whole-cell extracts were separated by native polyacrylamide gel electrophoresis; the SOD activity was detected as previously described (Clare et al., 1984) and the peroxidase activity was detected as described (Loprasert et al., 1989) by incubating the gel with 1.26 mM 3,3∞-diaminobenzidine tetrahydrochloride, 20 mM H O , and 50 mM phosphate buffer (pH 7.0) at 2 2 room temperature for 10 min. SOD assay was performed using ferricytochrome c, xanthine and xanthine oxidase and 1 U of activity is the amount of SOD required to inhibit the rate of reduction of cytochrome c by 50% (McCord and Fridovich, 1969).

3. Results and discussion 3.1. Cloning of a Bp fur homolog Fur protein sequences from many microorganisms were compared. Degenerate oligonucleotide primers I and II, corresponding to the conserved protein regions GLKVTLPR and GLATVYRVL respectively, were synthesized. PCR of Bp chromosome with primers I and II yielded a 150 bp DNA fragment that was cloned and sequenced. The DNA sequence was translated, searched against GenBank and identified to be a part of the fur gene. Southern blot of the EcoRI-digested chromosome of Bp was probed with the 150 bp fur fragment and a 2 kb fragment was hybridized. This 2 kb EcoRI fragment was isolated from an agarose gel and cloned into pBluescript KS. Plasmid containing fur was identified by colony hybridization and one positive clone designated pF22 was obtained. Restriction enzyme mapping and hybridization localized the fur gene in a 770 bp PstI–SacII fragment. The entire sequence of a PstI–SacII fragment was determined as shown in Fig. 1. An ORF coding for a polypeptide of 143 amino acid residues (16 kDa) with high homology to Fur in other bacteria was found. The Bp Fur was compared and aligned with 11 other Fur sequences in the database using the CLUSTAL W program ( Thompson et al., 1994) (data not shown). The Bp Fur has high homology to other Fur, with amino acid identities ranging between 80% for Ralstonia eutropha (AJ001224), 61% for Bordetella pertussis ( Z48227), 58% for Legionella pneumophila ( U06072), 55% for Yersinia pestis (Z12101), 54% for E. coli ( X02589), Neisseria gonorrhoeae (L11361), Pseudomonas aeruginosa (AF050676), and Klebsiella pneumoniae (L23871), 52% Vibrio cholerae (M85154), and 50% for Haemophilus ducreyi (JC5097) and Xanthomonas campestris pv. phaseoli (AF146829). Bp Fur has a highly conserved metal-binding motif, H –X–H–X –C–X –CG (Coy et al., 1994) and contains 3 2 2 four C residues similar to Fur from other organisms. The copy number for Bp fur was determined by Southern analysis. Bp genomic DNA individually digested with six restriction enzymes was separated by electrophoresis and hybridized against a fur probe. The hybridization pattern revealed strong signals under moderate stringency hybridization and washing conditions (data not shown), indicating that fur gene is a single copy gene in Bp.

132

S. Loprasert et al. / Gene 254 (2000) 129–137

Fig. 1. Nucleotide sequence of fur and flanking regions. The deduced amino acid sequence shown below the nucleotide sequence is in one-letter code. The transcription start site of fur mRNA is denoted by +1. The promoter consensus sequences, −10 and −35, and the ribosome binding (SD) sequence are underlined. The box shows the location of the putative Fur box. The nucleotide and amino acid changes in BpF1 mutant are indicated (bold ) above and below the corresponding residue in wild-type fur.

3.2. Expression of Bp fur in E. coli To test the expression of the cloned fur gene, the coding sequence was subcloned to pBluescript (pKSF ) and expressed in an E. coli fur mutant (QC1732). A 16 kDa protein was detected by western analysis with E. coli Fur antisera in E. coli QC1732 with pKSF but not in the control E. coli QC1732 with plasmid vector, as shown in Fig 2. This 16 kDa protein band was also detected in Bp lysate. This shows that Bp produces a protein that cross-reacts with E. coli Fur. The molecular mass of this protein is the same as predicted from the ORF of the fur gene. High molecular weight crossreacting protein bands in Bp and E. coli were also observed. When a plasmid containing the 2 kb EcoRI cloned fragment was overexpressed in Bp, the strongly reacting 16 kDa protein band was detected with the same density as the higher molecular weight protein band, indicating that this higher molecular weight band is a non-specific reactivity (data not shown). The higher molecular weight band in E. coli extract is also a crossreacting band, since E. coli QC1732 harboring pKS

Fig. 2. Immunoblot analysis for the expression of fur. Approximately 10 mg of protein from whole-cell extract was subjected to SDS–PAGE on a 15% polyacrylamide gel, transferred to PVDF membrane and probed with anti E. coli Fur antibody. The lanes are as follows: lane 1, Bp; lane 2, E. coli QC1732 containing pKSF; lane 3, E. coli QC1732 containing pKS vector.

vector also showed this band. To examine whether this is a functional copy of fur, pKSF was introduced into H1618, an E. coli fur mutant with a Fur-regulated lacZ fusion integrated into its chromosome. E. coli H1618 with pKSF showed a decreased b-galactosidase expres-

S. Loprasert et al. / Gene 254 (2000) 129–137

133

labeled primer and reverse transcriptase was resolved as shown in Fig. 3. The transcription start site (C ) is located 29 nt upstream from the translation start codon and 15 nt upstream from the putative SD sequence (see Fig. 1). Upstream of the transcription start site are regions TACTAT and ATGACT, at −10 and −35 respectively, with similarity to consensus E. coli promoter sequences TATAAT for the −10 region and TTGACA for the −35 region. These two regions are separated by 18 bp. Sequence GAGAATGTCACAGATGACT overlaps the −35 region and possesses a 10-of-19-base match with the E. coli consensus Fur box (GATAATGATAATCATTATC ) (Litwin and Calderwood, 1993). In E. coli, there is a single Furprotected site overlapping the −10 region of a potential promoter sequence and the experiment indicates a moderate autoregulation of fur expression by its gene product (De Lorenzo et al., 1988). We compared Bp Fur box with P. aeruginosa Fur boxes 1 and 2 located in front of fagA gene and found 6-of-19-base and 12-of-19-base matches respectively (Hassett et al., 1997). Gel mobility shift and Dnase I footprinting analysis is needed to determine if Bp Fur binds to the putative Fur box. 3.4. Transcription regulation of fur by stresses Fig. 3. Primer extension analysis of the fur gene. The first four lanes show a sequencing ladder (sequence indicated to the right) and the fifth lane ( labeled U ) shows the primer extension product, both generated by using the same primer as described in the text. The 5∞ end of the transcript is C denoted by arrow.

sion (240 U/OD ) compared with the control E. coli 600 H1618 with vector alone (426 U/OD ). These results 600 suggest that Bp fur is functional as a transcription repressor in E. coli. 3.3. Initiation of transcription and promoter analysis of fur gene The 5∞ end of the fur mRNA was determined by the primer-extension method. DNA synthesized using the

The size of fur mRNA was measured in a northern experiment and was found to be 620 bp ( Fig. 4). Thus, the fur gene is monocistronically transcribed. Next, we investigated whether Bp fur plays any role in protecting the bacterium against stress. A relationship between iron metabolism and oxidative stress has been demonstrated previously. Through the Fenton reaction, iron promotes the formation of hydroxyl radicals, which damage all cellular components. Thus, cells have evolved regulatory systems to ensure that they receive physiological iron requirements but minimize iron toxicity. We investigated the regulation of fur in response to various stresses at the transcription level. Total RNA was isolated from uninduced and induced cultures and was hybridized to fur probes. The results in Fig. 4 showed high expression

Fig. 4. Northern analysis of fur mRNA in response to high or low iron growth conditions and various oxidants. High and low iron growth and oxidant induction conditions are described in Section 2.1. 10 mg of total RNA was loaded in each lane. The lanes are as follows: lane 1, tBOOH; lane 2, H O ; lane 3, uninduced; lane 4, menadione; lane 5, dipyridyl; lane 6, FeCl . (A) Ethidium-bromide-stained gel showing the rRNA. (B) 2 2 3 Hybridization signals of radioactively labeled fur probe with northern blot of RNA samples shown in (A). The arrow indicates the position of fur mRNA.

134

S. Loprasert et al. / Gene 254 (2000) 129–137

of fur and no increase in the amount of fur after treatment with inducing concentrations of various oxidants (alkyl hydroperoxide, hydrogen peroxide, and menadione) and iron availability. The unchanged level of fur mRNA in response to many inducers may be explained by the fact that the gene is expressed constitutively at a level high enough to respond to various stresses the bacteria may encounter. A high concentration of cellular Fur is also observed in E. coli, suggesting that there are many predicted Fur sites in the genome and Fur sequesters iron in order to reduce the level of DNA-bound iron (Zheng et al., 1999). The unusually high levels of Fur protein as a transcription factor, compared with levels of other transcription factors, supports the idea that Fur not only regulates iron uptake genes but also plays a role as a global regulator. 3.5. Selection of Fur mutant by manganese mutagenesis To improve determination of the function of Bp fur, an attempt was made to construct a fur null mutant by gene replacement or gene interruption. This strategy was unsuccessful. Failure to construct a fur null mutant has already been reported for other bacteria. Our findings continue to suggest that the fur mutant is lethal, which is not unexpected considering its possible role as a global regulator. Fur mutants of Bp have been isolated, however, by a positive manganese selection procedure (Hantke, 1987) with increased concentration of MnCl . The molecular mechanism of Mn2+ mutagenesis 2 is not known, but it was suggested that Mn2+ stimulates the cell to accumulate a higher than tolerable concentration of Fe. Cells acquiring mutations in fur lose their ability to regulate tightly the fur-dependent Fe uptake systems, resulting in a fur mutant that does not accumulate toxic levels of Fe. Another possibility is that the fur gene is highly sensitive to the mutagenic action of manganese (Prince et al., 1993). A 100 ml portion of an overnight culture of Bp (about 108 cells) was plated onto Pseudomonas isolation agar (Oxoid ) that contained 75 mM MnCl . After growth at 37°C for 24 h manga2 nese-resistant colonies appeared. These manganese-resistant clones were screened by a rapid plate assay for siderophore production by patching onto Chrome Azurol blue agar plate (Schwyn and Neilands, 1987). In this assay, siderophores produced by bacteria growing on the plate remove the iron complexed to the highly colored dye contained in the plate, resulting in a change in color of the dye. One of the manganese-resistant clones, designated BpF1, produces a high level of siderophore. To examine whether Bp fur could complement the mutant phenotype, plasmid pFUR (Bp fur gene in a broad host range vector pBBR-Tc) was mated into Bp. Bp containing multiple copies of pFUR no longer produces high level of siderophore compared with Bp

containing a vector control when assayed on Chrome Azurol blue agar plate (data not shown). Thus, multiple copies of pFUR are able to restore normal siderophore production to a fur mutant F1. To analyze whether the F1 mutant still transcribed fur mRNA, a northern experiment was performed and the same size of fur mRNA was detected ( Fig. 4). The fact that siderophore in BpF1 is highly produced and is repressed when a wild-type copy of fur was introduced into F1 and fur mRNA level is normal, suggests that the F1 mutant produces an altered Fur protein.

3.6. Cloning and sequencing of fur mutant gene Clone from BpF1 was obtained after PCR with primers III and IV to amplify the fur promoter and ORF. We identified a single point mutation, a base change from G to A at position 206 of the ORF, which results in an amino acid change from R to H at position 69. This mutation occurs in an amino acid conserved in most known Fur proteins except Fur from X. campestris pv. phaseoli, which has K instead of R (Loprasert et al., 1999). The first 82 amino acids of Fur are involved in DNA recognition (Stojiljkovic and Hantke, 1995) and the alteration in a conserved amino acid residue in this region resulted in a lower activity of Fur. V. cholerae Fur mutants were generated by manganese mutagenesis and 11 independent clones contained point mutations (Lam et al., 1994). Eight of the point mutations occurred in the amino-terminal half (Q6P, V15G, K21N, I22T, Y40N, V55M, F73V, and H90L) and many of the mutations alter amino acids that have previously been suggested to mediate interactions between adjacent alpha-helices in the three-dimensional structure of Fur (Saito et al., 1991). An arginine-for-histidine substitution also found at amino acid position 18 (R18H ) in the predicted Fur protein of Bordetella avium (Murphy et al., 1999). The R18H mutant gene when cloned into a low-copy-number vector did not complement the fur mutation in E. coli H1780, indicating the impaired function. The lysine at position 77 was changed to a glycine by site-directed mutagenesis in the fur gene of Vibrio anguillarum and found to have an impaired ability to regulate a Fur box-containing promoter ( Tolmasky et al., 1994). In P. aeruginosa, fur mutants selected by a similar manganese-resistant method were found to have H86R and H86Y substitution and expressed higher levels of siderophores; Fur from these mutants was able to bind to the target DNA, but with reduced affinity in comparison with wild-type Fur (Barton et al., 1996). Whether the amino acid substitution (R69H ) of Bp Fur affects the ability of the regulatory protein to bind to specific nucleotide sequences located proximal to Fur box has yet to be determined.

S. Loprasert et al. / Gene 254 (2000) 129–137

135

3.7. Decreased FeSOD and peroxidase activities in fur mutants Next, we studied the role of Fur on the expression of the oxidative stress response enzymes, i.e. SOD and peroxidase; these enzymes are required for the detoxification of reactive oxygen metabolites, during the so-called oxidative burst, produced by professional phagocytes. Bp may have a strategy to resist the toxic actions of these metabolites by their enzymatic conversion in the concerted action of SOD, peroxidase and other oxidoreductases. We examined the level of SOD and peroxidase activities in wild type and fur mutant. There are two major types of SOD in bacteria: Mn-containing SOD encoded by sodA and Fe-containing SOD encoded by sodB. Early studies using E. coli SOD activity show that MnSOD levels respond to changes in oxygen tension, type of substrate, redox-active compounds, iron concentration, the nature of the terminal oxidant, and the redox potential of the medium ( Fee, 1991). FeSOD levels appeared nominally insensitive to these perturbations. In E. coli, sodA expression is subjected to regulation by three major regulatory systems: fur (ferric uptake regulation) and arcA arcB (aerobic respiratory control ) mediated repression of sodA, whereas soxR soxS (superoxide response) mediates activation of sodA ( Fee, 1991). In E. coli, soxR soxS (superoxide response) mediates activation of sodA expression. By contrast, sodB expression is positively activated in trans by fur ( Tardat and Touati, 1993). The analysis of isozymes from stationary phase of Bp was carried out with native PAGE and SOD activity staining (Clare et al., 1984). The results showed only one major form of SOD ( Fig. 5A, lane 1). The SOD inhibition study used to differentiate different SOD isozymes indicated that the major SOD activity was an FeSOD (the SOD activity was inhibited by H O and KCN treat2 2 ment) (Clare et al., 1984) (data not shown). As shown in Fig. 5A, lane 2, the FeSOD activity was reduced in fur mutant and the activity was restored when pFUR was introduced into BpF1 ( lane 3). The reduction and complementation of FeSOD activity was confirmed by quantitative SOD assay, as shown in Fig. 6. The SOD activity in BpF1 was reduced by 50% compared with

Fig. 6. Effect of fur expressions on SOD activity. Bp lysates were measured for SOD activities and expressed as units/milligram of protein by the previously described method (McCord and Fridovich, 1969). The results are the means and standard errors representing three separate experiments. Lane 1, Bp; lane 2, BpF1; lane 3, BpF1 harboring pFUR.

activity in wild type and was restored in BpF1 with pFUR. We observed the incomplete complementation of SOD activity in BpF1 with pFUR (7.33 U/mg and 6.46 U/mg in Bp and BpF1 harboring pFUR respectively), which might be due to the hybrid oligomerization between wild-type subunit of Fur from plasmid and mutated subunit from chromosome. This hybrid multimer Fur might have an altered and incomplete regulatory function. A similar reduction of FeSOD is also found in E. coli fur mutants (Niederhoffer et al., 1990). In P. aeruginosa fur mutant the FeSOD activity is unchanged, but MnSOD activity is increased (Hassett et al., 1996). A facultative intracellular bacteria, B. pertussis, has major FeSOD and minor MnSOD activity, and its fur mutant constitutively expressed both MnSOD and FeSOD in iron-rich conditions. It would be interesting to investigate the importance of Bp sodB for survival of this bacterium in macrophages. Peroxidase is an important enzyme in detoxifying hydrogen peroxide. We determined the peroxidase activity of a Bp fur mutant and found that the activity was lower in the mutant (Fig. 5B, lane 2). The peroxidase activity was restored when the wild-type copy of fur was introduced into BpF1 ( lane 3). Therefore, Fur functions as a

Fig. 5. Visualization of Bp SOD and peroxidase on native PAGE. (A) 20 mg of proteins were loaded and SOD activities were detected as described in Section 2.7. The lanes are as follows: lane 1, Bp; lane 2, BpF1; lane 3, BpF1 harboring pFUR. (B) 40 mg of proteins were loaded and peroxidase activities were detected. The lanes are the same as (A).

136

S. Loprasert et al. / Gene 254 (2000) 129–137

positive regulator of peroxidase expression. On the other hand, the synthesis of the Streptomyces reticuli peroxidase is under the negative control of a regulatory gene, whose gene product FurS shares 29% identical and 44% similar amino acids with E. coli Fur protein (Zou et al., 1999). An in-frame deletion of the upstream-located furS gene enhances peroxidase activity, suggesting that FurS is a repressor and regulates the transcription of katG. It remains to be seen how furA mutation affects the katG expression. In mycobacterium, IdeR is proposed to be the counterpart of the E. coli Fur protein. The ideR mutants of Mycobacterium smegmatis are defective in their ability to repress siderophore biosynthesis. They were also more sensitive to hydrogen peroxide and had decreased levels of peroxidase and MnSOD. This indicates that ideR is a negative regulator of siderophore production and is a positive regulator of MnSOD and peroxidase (Dussurget et al., 1996). Expression of E. coli katG and a set of antioxidant genes, including ahpCF (alkylhydroperoxidase), dps (a non-specific DNA binding protein), gorA (glutathione reductase), grxA (glutaredoxin I ), and oxyS (a regulatory RNA), is induced by the transcription factor OxyR, and recently E. coli fur was found to be activated by OxyR (Zheng et al., 1999). We now know that a Bp fur mutation caused an increased peroxidase activity. Thus, it is interesting to investigate whether Bp katG is regulated by OxyR. If so, what is the regulation network among fur, katG and oxyR in Bp? To our knowledge, we know of no report demonstrating the effect of a fur mutation on peroxidase activity in Gramnegative bacteria. These results suggested that Fur is a pleiotropic regulator that couples iron metabolism to the oxidativestress response. It is perhaps reasonable to expect that a regulator as central to the cell as Fur will exhibit different types of control over the many genes that it regulates. As an alternative to the direct-effect model, our results may also be explained by a cascade type of control. For example, if Fur negatively regulates the expression of a second negative regulator, the targets of that second regulator will appear to be under positive control by Fur. The missense mutants employed in this study were extremely useful in gauging the role of fur in this human pathogen. Although still very little is known of the complex regulation of Fur-regulated genes in Bp, this first report suggests that Fur is a global regulator that links iron metabolism to the oxidative stress response. We are currently attempting to elucidate how oxidative stress defense enzymes are regulated in Bp, which may lead to a better understanding of Bp pathogenesis.

4. Conclusions (1) Bp fur was cloned, sequenced and the ORF coding for Fur was identified. The deduced Fur amino acid sequence shows highly conserved metal-binding motifs.

(2) Northern analysis reveals that fur is transcribed as a monocistronic mRNA. (3) Primer extension experiments identify the fur transcription start site. Analysis of the promoter region reveals the putative Fur box overlapping the −35 region. (4) Bp fur mutants have a point mutation at arginine-69 and are defective in their ability to repress siderophore biosynthesis. The mutants also show decreased FeSOD and peroxidase activities.

Acknowledgements We thank J. Crosa for providing anti E. coli Fur antibody, D. Touati for bacterial strains, S. Atichartpongkul for performing a primer extension experiment and G. Vaughn for reviewing the manuscript. S. Kasantsri and P. Munpiyamit assisted in photographs preparation. The research was supported by grants from Chulabhorn Research Institute and the Thai Research Fund grant RDG4030007 to SL.

References Barton, H.A., Johnson, Z., Cox, C.D., Vasil, A.I., Vasil, M.L., 1996. Ferric uptake regulator mutants of Pseudomonas aeruginosa with distinct alterations in the iron-dependent repression of exotoxin A and siderophores in aerobic and microaerobic environments. Mol. Microbiol. 21, 1001–1017. Clare, D.A., Duong, M.N., Darr, D., Archibald, F., Fridovich, I., 1984. Effects of molecular oxygen on detection of superoxide radical with nitroblue tetrazolium and on activity stains for catalase. Anal. Biochem. 140, 532–537. Coy, M., Doyle, C., Besser, J., Neilands, J.B., 1994. Site-directed mutagenesis of the ferric uptake regulation gene of Escherichia coli. Biometals 7, 292–298. De Lorenzo, V., Herrero, M., Giovannini, F., Neilands, J.B., 1988. Fur (ferric uptake regulation) protein and CAP (catabolite-activator protein) modulate transcription of fur gene in Escherichia coli. Eur. J. Biochem. 173, 537–546. Dussurget, O., Rodriguez, M., Smith, I., 1996. An ideR mutant of Mycobacterium smegmatis has derepressed siderophore production and an altered oxidative-stress response. Mol. Microbiol. 22, 535–544. Fee, J.A., 1991. Regulation of sod genes in Escherichia coli: relevance to superoxide dismutase function. Mol. Microbiol. 5, 2599–2610. Hantke, K., 1987. Selection procedure for deregulated iron transport mutants ( fur) in Escherichia coli K 12: fur not only affects iron metabolism. Mol. Gen. Genet. 210, 135–139. Hassett, D.J., Sokol, P.A., Howell, M.L., Ma, J.F., Schweizer, H.T., Ochsner, U., Vasil, M.L., 1996. Ferric uptake regulator (Fur) mutants of Pseudomonas aeruginosa demonstrate defective siderophore-mediated iron uptake, altered aerobic growth and decreased superoxide dismutase and catalase activities. J. Bacteriol. 178, 3996–4003. Hassett, D.J., Howell, M.L., Ochsner, U.A., Vasil, M.L., Johnson, Z., Dean, G.E., 1997. An operon containing fumC and sodA encoding fumarase C and manganese superoxide dismutase is controlled by the ferric uptake regulator in Pseudomonas aeruginosa: fur mutants produce elevated alginate levels. J. Bacteriol. 179, 1452–1459.

S. Loprasert et al. / Gene 254 (2000) 129–137 Jones, A.L., Beveridge, T.J., Woods, D.E., 1996. Intracellular survival of Burkholderia pseudomallei. Infect. Immun. 64, 782–790. Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M., Peterson, K.M., 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175–176. Kullik, I., Toledano, M.B., Tartaglia, L.A., Storz, G., 1995. Mutational analysis of the redox-sensitive transcriptional regulator OxyR: regions important for oxidation and transcriptional activation. J. Bacteriol. 177, 1275–1284. Lam, M.S., Litwin, C.M., Carroll, P.A., Calderwood, S.B., 1994. Vibrio cholerae fur mutations associated with loss of repressor activity: implications for the structural–functional relationships of fur. J. Bacteriol. 176, 5108–5115. Leelarasamee, A., Bovornkitti, S., 1989. Melioidosis: review and update. Rev. Infect. Dis. 11, 413–425. Litwin, C.M., Calderwood, S.B., 1993. Role of iron in regulation of virulence genes. Clin. Microbiol. Rev. 6, 137–149. Loprasert, S., Negoro, S., Okada, H., 1989. Cloning, nucleotide sequence, and expression in Escherichia coli of the Bacillus stearothermophilus peroxidase gene ( perA). J. Bacteriol 171, 4871–4875. Loprasert, S., Sallabhan, R., Atichartpongkul, S., Mongkolsuk, S., 1999. Characterization of a ferric uptake regulator ( fur) gene from Xanthomonas campestris pv. phaseoli with unusual primary structure, genome organization and expression patterns. Gene 239, 251–258. McCord, J.M., Fridovich, I., 1969. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem. 244, 6049–6055. Miller, J.H., 1972. Experiment in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Mongkolsuk, S., Loprasert, S., Whangsuk, W., Fuangthong, M., Atichartpongkun, S., 1997. Characterization of transcription organization and analysis of unique expression patterns of an alkyl hydroperoxide reductase C gene (ahpC ) and the peroxide regulator operon ahpF–oxyR–orfX from Xanthomonas campestris pv. phaseoli. J. Bacteriol. 179, 3950–3955. Murphy, E.R., Dickenson, A., Militello, K.T., Connell, T.D., 1999. Genetic characterization of wild-type and mutant fur genes of Bordetella avium. Infect. Immun. 67, 3160–3165. Neilands, J.B., 1993. Siderophores. Arch. Biochem. Biophys. 302, 1–3. Niederhoffer, E.C., Naranjo, C.M., Bradley, K.L., Fee, J.A., 1990.

137

Control of Escherichia coli superoxide dismutase (sodA and sodB) genes by the ferric uptake regulation ( fur) locus. J. Bacteriol. 172, 1930–1938. Prince, R.W., Cox, C.D., Vasil, M.L., 1993. Coordinate regulation of siderophore and exotoxin A production: molecular cloning and sequencing of the Pseudomonas aeruginosa fur gene. J. Bacteriol. 175, 2589–2598. Saito, T., Wormald, M.R., Williams, R.J., 1991. Some structural features of the iron-uptake regulation protein. Eur. J. Biochem. 197, 29–38. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a Laboratory Manual. second edition, Cold Spring Habor Laboratory Press, Cold Spring Habor, NY. Schwyn, B., Neilands, J.B., 1987. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 160, 47–56. Stojiljkovic, I., Hantke, K., 1995. Functional domains of the Escherichia coli ferric uptake regulator protein ( Fur). Mol. Gen. Genet. 247, 199–205. Tardat, B., Touati, D., 1993. Iron and oxygen regulation of Escherichia coli MnSOD expression: competition between the global regulators Fur and ArcA for binding to DNA. Mol. Microbiol. 9, 53–63. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Tolmasky, M.E., Wertheimer, A.M., Actis, L.A., Crosa, J.H., 1994. Characterization of the Vibrio anguillarum fur gene: role in regulation of expression of the FatA outer membrane protein and catechols. J. Bacteriol. 176, 213–220. Touati, D., Jacques, M., Tardat, B., Bouchard, L., Despied, S., 1995. Lethal oxidative damage and mutagenesis are generated by iron in delta fur mutants of Escherichia coli: protective role of superoxide dismutase. J. Bacteriol. 177, 2305–2314. Yang, H., Kooi, C.D., Sokol, P.A., 1993. Ability of Pseudomonas pseudomallei malleobactin to acquire transferrin-bound, lactoferrinbound and cell-derived iron. Infect. Immun. 61, 656–662. Zheng, M., Doan, B., Schneider, T.D., Storz, G., 1999. OxyR and SoxRS regulation of fur. J. Bacteriol. 181, 4639–4643. Zou, P., Borovok, I., Ortiz de Orue Lucana, D., Muller, D., Schrempf, H., 1999. The mycelium-associated Streptomyces reticuli catalaseperoxidase, its gene and regulation by FurS. Microbiology 145, 549–559.