Characterization of a cerebellar granule progenitor cell line, EtC.1, and its responsiveness to 17-β-estradiol

BR A IN RE S E A RCH 1 1 86 ( 20 0 7 ) 2 9 –4 0

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s

Research Report

Characterization of a cerebellar granule progenitor cell line, E t C.1, and its responsiveness to 17-β-estradiol Andres Gottfried-Blackmoreb , Gist Croftb , Janet Clarkc , Bruce S. McEwenb , Peter H. Jellinckd , Karen Bullocha,⁎ a

Laboratory of Cellular Physiology and Immunology, The Rockefeller University, 1230 York Avenue Box #165, New York, NY 10065, USA Laboratory of Neuroendocrinology, The Rockefeller University, New York, NY, USA c Molecular Endocrinology Merck & Co., Inc., Rahway, NJ, USA d Department of Biochemistry, Queen's University, Kingston, Ontario, Canada K7l 3N6 b

A R T I C LE I N FO

AB S T R A C T

Article history:

Mouse cerebellar development occurs at late embryonic stages and through the first few

Accepted 23 August 2007

weeks of postnatal life. Hormones such as 17-β-estradiol (E2) have been implicated in

Available online 8 September 2007

cerebellar development, through the expression of E2 receptors (ER). However, the role of E2 in the development and function of cerebellar neurons has yet to be fully elucidated. To gain

Keywords:

insight into E2's actions on the developing cerebellum, we characterized a cloned neuronal

Cerebellar granule cell

cell line, EtC.1, derived from late embryonic cerebellum for its neural properties and

Estrogen receptor

responsiveness to E2. Our results revealed that EtC.1 cells express markers characteristic of

Math1

neural progenitor cells such as Nestin, Musashi, and Doublecortin (DCX), and of the granule

Zipro1

cell lineage such as Math1 and Zipro1. The ER alpha and beta (ERα and ERβ) were also

FMRP

identified in this cell line. Functionality of ERs was verified using an Estrogen Response

IL-6

Element (ERE)-Luciferase reporter plasmid. E2 modulated ERα, FMRP, and IL-6, which were expressed in these cells. However, E2 did not induce changes in neural proteins nor induce maturation of EtC.1 cells. CREB and ERK1/2 protein kinases were not modulated by E2 either. Interestingly, EtC.1 expressed active p450 Aromatase (P450arom), which was confirmed by the aromatization of androstenedione (AD) to E2 and other estrogen metabolites. Collectively, our results show that the EtC.1 cell line may serve as a model to study early development of cerebellar progenitor granule cells, and their responsiveness to E2. © 2007 Published by Elsevier B.V.

1.

Introduction

Among the sex hormones, 17-β estradiol (E2) is critical to the differentiation and function of brain structures associated

with reproductive behavior, as well as to those in the adult CNS not normally associated with reproduction (McEwen et al., 1997; McEwen, 2001). One such region of the brain is the hippocampus, where estrogen receptor alpha and beta (ERα

⁎ Corresponding author. Fax: +1 212 327 8634. E-mail address: [email protected] (K. Bulloch). Abbreviations: E2, 17-β-estradiol; ERα and ERβ, Estrogen receptors alpha and beta; ERE, Estrogen Response Element; DCX, Doublecortin; FMRP, Fragile-X Mental Retardation Protein; GFAP, Glial Fibrillary Acidic Protein; Math-1, Atonal homologue (Drosophila) 1; Zipro1, Zinc finger protein 38; Pax6, Paired box gene 6; En2, Engrailed 2; Zic1–2, Zinc finger protein of the cerebellum 1–2; Cyc-D2, Cyclin D2; CREB, Cyclic-AMP response element binding protein; ERK1/2, Extracellular regulated mitogen activated protein kinase; LPS, Lipopolysaccharide; IL-6, Interleukin 6; p450arom, p450 Aromatase; AD, Androstenedione 0006-8993/$ – see front matter © 2007 Published by Elsevier B.V. doi:10.1016/j.brainres.2007.08.071

30

BR A IN RE S EA RCH 1 1 86 ( 20 0 7 ) 2 9 –40

Fig. 1 – Immunocytochemical detection of Nestin and NeuN in EtC.1 cells. (A) Anti-Nestin ICC showed subcellular localization of nestin immunoreactivity (IR) in processes (white arrow) and perinuclear regions (double white arrow). (B) Anti-NeuN ICC staining was uniform in the whole cell, and nucleus as shown by DAPI staining. (C and D) Cells incubated in secondary antibody served as controls and displayed no immuno-fluorescence. Scale bar = 10 μm (A, C) and 15 μm (B, D).

and ERβ) are expressed (Mitra et al., 2003) and mediate the generation of new synaptic connections in normal female rats in the CA1 region (Woolley and McEwen, 1992; Lewis et al., 1995; Woolley et al., 1997; Leranth et al., 2004). The cerebellum is another non-traditional CNS target for E2 (Litteria, 1987), which is rich in the expression of ERα and ERβ (Jakab et al., 2001; Mitra et al., 2003). Reminiscent of the effect seen on the principal cells of the hippocampus (Woolley and McEwen, 1992), Sakamoto et al. (2003) have shown that the growth of dendritic spines in developing cerebellar Purkinje cells is affected by E2, which can be produced locally by the

expression of p450 Aromatase (p450Arom). Throughout development, the ratio of estrogen receptor subtypes changes as the cerebellum matures: ERβ has a low constitutive expression in early development and becomes the predominant receptor in adulthood, whereas ERα appears to play a role mostly in development (Belcher, 1999; Price and Handa, 2000; Guo et al., 2001; Ikeda and Nagai, 2006). Importantly, during development, E2 may influence the differentiation of neural stem cells (Brannvall et al., 2002). In the present study we have characterized the developmental stage of an embryonic cerebellar cell line, EtC.1, initially cloned by Bulloch et al. (1977, 1978). Neural stem cell markers were analyzed by Western blot, as well as cerebellar cell lineage markers by PCR. We have also characterized the expression of estrogen receptors and explored various functional estrogenic properties in EtC.1 cells with the purpose of using this cell line as a potential model to study E2 actions in cerebellar development.

2.

Results

2.1.

Neural progenitor cell markers are expressed in EtC.1

The expression of neural proteins characteristic of developing and adult nervous systems was examined in EtC.1. Two markers (Nestin and NeuN) were examined by immunofluorescence detection as an example of the expression of neuron-specific proteins in the intact cells. Fluorescence microscopy revealed discrete immuno-reactivity (IR) around the nucleus, consistent

Table 1 – Primary antibodies used to characterize the EtC.1 cell line Protein Actin Aromatase CREB Phospho-CREB Doublecortin ERα ERβ FMRP GFAP MAPK p44/42 Phospho-MAPK p44/42 Musashi Nestin NeuN Vimentin

Dilution

Company/#

1:40,000 1:1000 1:2000 1:2000 1:1000 1:500 1:25,000 1:2000 1:2000 1:2000 1:2000 1:1000 1:2000 1:2000 1:250

Sigma #A5441 Santa Cruz sc-14245 Cell Signaling #9192 Cell Signaling #9191 Santa sc-8067 Novocastra NCL-ER-6F11 Merck 80424 Chemicon MAB2160 Chemicon MAB3402 Cell Signaling #9102 Cell Signaling #9101 Chemicon AB5977 Chemicon MAB353 Chemicon MAB377 Hybridoma Bank #40E-C

Fig. 2 – Neural progenitor protein profile in EtC.1 lysates. Western blot analysis of EtC.1 protein lysates (6–10 μg) revealed positive immunoreactivity for Nestin, Vimentin, DCX, Musashi, and NeuN. EtC.1 were negative for GFAP. Adult mouse brain tissue (10 μg) was used as a positive control, and Actin staining was used as a loading control.

BR A IN RE S E A RCH 1 1 86 ( 20 0 7 ) 2 9 –4 0

31

Fig. 3 – EtC.1 cells express granule cell lineage markers. EtC.1 cell mRNA was reverse-transcribed and PCR reactions were run with gene-specific primers for granule cell-specific markers Zipro1, Math-1, Pax-6, EN-2, Pax-6, Zic-1, and Zic-2 (appropriate amplicon size in base pairs is indicated for each PCR product). Calbindin was used as a negative control. Brain tissue (Br) was used as a positive control and EtC.1 cell reverse-transcriptase negative samples (RT−) were used as a negative control for the PCR reactions.

Fig. 4 – EtC.1 cells express functional ERα and ERβ. (A) Western blot analysis of EtC.1 cells (EtC.1) and cells transfected to over express hERα and hERβ (+hER). Actin was used as a loading control. (B) RT-PCR analysis of ERα and ERβ expression in EtC.1 cells treated with vehicle (−/−) or 10 nM E2 (E2) for 24 h. (C) Western blot quantification of ERα protein densitometry in EtC.1 treated with vehicle (−/−) or 10 nM E2 (E2) for 24 h. (D) Luciferase activity from EtC.1 cells transfected with an ERE-Luciferase reporter gene and incubated with vehicle (−/−), 10 nM E2 (E2) ± the ER antagonist ICI 182,780 (ICI) (100 nM) for 24 h. Bars represent the mean ± S.E.M. Asterisk (*) = significantly different p < 0.05 (Student T-test; n = 2 exp. in triplicate).

32

BR A IN RE S EA RCH 1 1 86 ( 20 0 7 ) 2 9 –40

with rough endoplasmic reticulum, and also in cell processes of EtC.1 cells (Fig. 1A). EtC.1 were also immunopositive for NeuN, which stained the nucleus and cytoplasm of the cells (Fig. 1B). Controls stained with secondary antibody alone showed no immunofluorescence (Figs. 1C, D). DAPI counter-staining is shown in B and D to show the whole cell morphology. Since a Western blot (WB) provides more precise and quantitative information, we elected this method to analyze protein expression in EtC.1. The initial panel of proteins analyzed (Table 1) was targeted to identify whether EtC.1 are neural progenitor cells. WB for Nestin revealed a strong band in EtC.1 at the expected 404 kDa range, and adult mouse brain displayed a weaker band (Fig. 2). The Vimentin antibody detected an IR band at the expected MW of 55 kDa on WB in EtC.1, and an equal, less intense band in mouse brain homogenate (Fig. 2). EtC.1 were negative for GFAP (Fig. 2). Western blot for DCX revealed a 40 kDa protein band in both EtC.1 and brain, but an additional 45 kDa band was observed in EtC.1 (Fig. 2). Using a different antibody directed against the C-terminus of DCX, we detected the 40 kDa in both EtC.1 and brain. Various DCX protein bands in our Western blots could be due to several factors, such as species differences or post-translational

modifications (Brown et al., 2003). The antibody to Musashi protein revealed a strong 39 kDa band in EtC.1, whereas, adult mouse brain exhibited a faint band at this molecular weight (Fig. 2). NeuN was detected in both EtC.1 and brain (Fig. 2). Western blot detection studies of NeuN have reported bands of various molecular weights for this protein. Mouse brain showed the strongest bands at 90 kDa and 100 kDa, whereas EtC.1 showed a doublet that was shifted to 115 kDa and 125 kDa, respectively (Fig. 2). A variety of differing molecular weights for NeuN have been reported, which correlate with our findings (Mullen et al., 1992).

2.2.

EtC.1 express cerebellar granule cell precursor markers

The developing cerebellum contains progenitor cells of two principal lineages: the granule cell lineage and the Purkinje cell lineage. To distinguish if EtC.1 cells belonged to either, expression of lineage specific markers was performed by PCR. Zipro1, a defining transcription factor for the granule cell lineage (Yang et al., 1996) was expressed in EtC.1 cells, as well as other granule cell precursor transcription factors: Math-1 (Ben-

Fig. 5 – E2 increases FMRP protein levels, but does not induce expression of mature synaptic proteins in EtC.1 cells. (A) Western blot and densitometric analysis of changes in FMRP expression from vehicle (−/−) and 10 nM E2 (E2) treated EtC.1 cells. Graph represents mean values (n = 2) ± S.E.M. Asterisk (*) = significantly different p < 0.05 (Student T-test; n = 2 exp. in triplicate). (B) Western blot analysis of synaptic proteins in EtC.1 cell lysates from vehicle (−/−) or 24 h 10 nM E2 (E2) treated cells. Brain protein (10 ng) was used as a positive control, and Actin as a loading control.

BR A IN RE S E A RCH 1 1 86 ( 20 0 7 ) 2 9 –4 0

33

Luciferase, transiently transfected into EtC.1. Stimulation of EtC.1 with physiological doses of E2 (10 nM) led to a robust induction of luciferase activity (Fig. 4D). Further, induction of luciferase activity by E2 was blocked by the ER antagonist ICI 182,780 (100 nM) (Fig. 4D).

2.4. E2 does not participate in maturation or differentiation of EtC.1 cells The expression of the various neural and granule progenitorcell markers was measured in EtC.1 cells incubated for 24 h and 36 h with E2 (10 nM). E2 treatment had no effect on protein levels for the neural progenitor cell markers we analyzed (Nestin, DCX, NeuN, Vimentin, Musashi), nor was the expression of GFAP induced (data not shown). E2 (10 nM) incubations (24 h) did not affect mRNA expression levels of Pax-6 and Zipro1, nor the expression of Cyclin-D2, Zic-1 and Zic-2 (data not shown).

Fig. 6 – E2 does not modulate MAPK signaling in EtC.1 cells. (A) 24 h serum-starved EtC.1 cells were treated with vehicle (−/−), 10% fetal calf serum (FCS), or two doses of E2 for 30 min. Cell lysates were then analyzed by Western blot for ERK1/2 MAPK phosphorylation levels. (B) Serum-starved EtC.1 cells were treated for 30 min with vehicle (−/−), 10 nM E2 (E2), or 1 μM cAMP (cAMP), and analyzed for CREB phosphorylation levels. Non-phosphorylated proteins from the same lysates were analyzed in parallel blots as loading controls.

Arie et al., 1997), Pax-6 (Engelkamp et al., 1999), and En-2 (Liu and Joyner, 2001) (Fig. 3). In contrast, Calbindin, a commonly expressed marker in Purkinje cells, was not expressed in EtC.1 (Fig. 3). In agreement with a precursor phenotype of the cells, two transcription factors expressed in mature cerebellar granule cells, Zic-1 and Zic-2 (Aruga et al., 1998, 2002), were not expressed in EtC.1 (Fig. 3), whereas the Cyclin-D2 gene, present in dividing neural progenitor cells (Ross et al., 1996), was expressed in EtC.1 cells (Fig. 3).

2.3.

EtC.1 express functional estrogen receptors

Expression and function of ERs in EtC.1 was assessed. WB analysis with a specific antibody against ERα demonstrated an expected band at 64 kDa for EtC.1, which matched recombinant human ERα transiently expressed in EtC.1 (Fig. 4A). ERβ immunoblots yielded a 45 kDa band, whereas recombinant human ERβ transiently expressed in EtC.1, produced a 54 kDa band (Fig. 4A). Given some of the controversy that surrounds estrogen receptor antibodies, the expression of ERα and ERβ transcripts was analyzed. qRT-PCR showed expression for both of ERα and ERβ mRNA in EtC.1 cells, which was not altered by treatment with E2 as compared with vehicle treated cells (Fig. 4B). However, E2 incubation reduced ERα protein levels (Fig. 4C), while ERβ levels were unaffected (data not shown). To evaluate if the estrogen receptors present in these cells acted as functional transcription factors, we measured the expression of an E2-dependent reporter gene-construct, ERE-

Fig. 7 – E2 modulates IL-6 produced by EtC.1 cells in response to LPS. (A) Time course of cytokine production in supernatants from EtC.1 treated with 100 ng/ml LPS. Data points represent % of maximum cytokine concentration. (B) IL-6 quantification from cells incubated with 10 nM E2 (E2/LPS) or vehicle (–/LPS) for 24 h, followed by LPS stimulation (100 ng/ml) for an additional 12 h. Graph represents mean values (n = 4) ± 1 S.E.M. and is representative of multiple independent experiments. Asterisk (*) = significantly different p < 0.05 (Student T-test; n = 4 exp. in triplicate).

34

BR A IN RE S EA RCH 1 1 86 ( 20 0 7 ) 2 9 –40

2.6.

IL-6 is produced by EtC.1 and is regulated by E2

IL-6 expression is found in cerebellar cells and can contribute to neuronal differentiation (Marz et al., 1997). Resting EtC.1 cells presented no detectable levels of IL-6 in culture supernatants assayed by ELISA. However, when the cells were stimulated with LPS, a known inducer of cytokines in various tissues, EtC.1 cells produced IL-6, but not TNFα, IL-1β, or the reactive oxygen species NO (Fig. 7A). The LPS-stimulated IL-6 production increased linearly from 3 to 12 h and reached a plateau after 24 h (Fig. 7A). Estrogen has been shown to attenuate IL-6 expression in various cell types. When EtC.1 cell cultures were pre-treated with E2 (10 nM) for 24 h before stimulation with LPS, E2 significantly attenuated the IL-6 response at 12 h as determined by IL-6 ELISA (Fig. 7B).

2.7. EtC.1 cells express p450 Aromatase enzyme and are able to synthesize E2

Fig. 8 – EtC.1 cells express p450 Aromatase and metabolize estrogens. (A) Western blot detection of p450Arom in EtC.1 cell lysates, prostate (Pro) and ovary tissue (Ova). (B) Quantification from thin layer chromatography analysis of steroids extracted from EtC.1 supernatants after 24 h incubation with H3-AD. Graph shows percentage of non-metabolized H3-AD (Res. Substr), E2, and estrone (E1).

E2 increased protein levels of the Fragile-X (FMRP) neural protein (Fig. 5A), a marker expressed by mature neurons (Weiler and Greenough, 1999). To determine if E2 treatment could induce maturation of EtC.1 cells, the expression of various pre- and post-synaptic proteins was assessed by WB. As expected, un-stimulated EtC.1 cells did not express Synaptophysin, Syntaxin, PSD-95, Spinophylin, and connexin-36 (Fig. 5B), nor did incubation with E2 (10 nM, 24 h) induce expression of these proteins (Fig. 5B).

2.5. E2 does not regulate CREB and ERK1/2 MAPK Signaling in EtC.1 cells CREB and ERK1/2 MAPK mediate important signaling pathways in neuronal cells, and their phosphorylation can be modulated by E2 (Lee and McEwen, 2001; Lee et al., 2004a; JoverMengual et al., 2007). In EtC.1 both MAPK are constitutively phosphorylated and serum-starvation reduces phosphorylation levels (data not shown). To determine if E2 activated these kinases in our cells, serum-starved EtC.1 cultures were stimulated with E2 (10 nM) and phosphorylation of CREB and ERK1/2 MAPK was assessed by WB. While ERK1/2 phosphorylation was increased by FCS, it was unaffected by E2 treatment (Fig. 6A). In the same manner, CREB phosphorylation was increased by cAMP (1 uM) stimulation, but not by E2 treatment (Fig. 6B).

Previous studies with EtC.1 showed these cells can metabolize the steroid precursors DHEA and AD (Jellinck et al., 2005, 2007). In this study we examined the expression of p450 Aromatase, which is the rate-limiting enzyme for E2 synthesis. WB analysis yielded 3 IR bands at 51 kDa, 40 kDa, and 30 kDa (Fig. 8A). The bands corresponded to 51 kDa and 30 kDa bands in the mouse ovary, while the negative control (mouse prostate) showed no IR (Fig. 8A). Mouse brain shared 51 kDa, and 30 kDa IR bands with EtC.1 and showed additional bands at 60 kDa and 70 kDa (data not shown). To establish if these aromatase-IR protein bands represented a functional enzyme, EtC.1 cells were incubated with the tritiated estrogen precursor, AD. Thin layer chromatography separation of steroids indicated that estrone and E2 were produced from this substrate (Fig. 8B). Purity and identity of the tritiated E2 produced by EtC.1 cells was demonstrated by successive rounds of reverse isotope dilution re-crystallizations, without significant percentage loss of tritium radioactivity (data not shown). It should be noted that no estrogens were produced in the absence of substrate (AD).

3.

Discussion

3.1.

Developmental state of EtC.1 cells

In this study we characterized the progenitor phenotype of EtC.1 cells, originally isolated from the developing cerebellum at E17. Commitment of this cell line towards a neuronal lineage is supported by the experiments showing EtC.1 express five neuronal progenitor cell markers: Nestin; Vimentin; DCX; and the neuronal marker, NeuN. Nestin and Vimentin are two intermediate filament proteins found in neural stem cells in the developing and adult mammalian nervous system (Wang et al., 1980; Hockfield and McKay, 1985; Lendahl et al., 1990; Blumcke et al., 2001). Nestin transcripts are expressed during the development of the mouse brain from E10 to adult (Yang et al., 1997). While the expression of Nestin and Vimentin in EtC.1 cells correlates well with their time of origin (Bulloch et al., 1977, 1978; Yang et al., 1997, 2001; Colucci-Guyon et al., 1999), we cannot

BR A IN RE S E A RCH 1 1 86 ( 20 0 7 ) 2 9 –4 0

discount that these markers may have been retained in the process of EtC.1 cells adaptation to culture and/or self-immortalization (Snyder et al., 1992; Gao and Hatten, 1994). DCX is a microtubule-associated phosphoprotein required for normal CNS and PNS neuronal migration, and is also expressed in developing granule and Purkinje cells (Matsuo et al., 1998). Helms et al. (2001) have further shown that DCX can distinguish maturing granule cells in the inner and external granule cell layer (Helms et al., 2001). Musashi expression in EtC.1 cells provides further support to the neuronal precursor phenotype of this cell line. Musashi is a neural mRNA-binding protein that is enriched in neural progenitor and stem cells in the developing mouse CNS (Kaneko et al., 2000), and is a marker for proliferating neuronal precursors in the external granule cell layer (Sakakibara and Okano, 1997). NeuN is commonly found in post-mitotic granule cells of the cerebellum and is not present in Purkinje cells (Mullen et al., 1992; Weyer and Schilling, 2003). Its expression in EtC.1 cells may also be a result from in vitro culturing as this protein is usually present in terminally differentiated neurons. The neuronal phenotype of EtC.1 cells was further refined by experiments showing expression of granule cell markers. In the mouse, at embryonic day 13 (E13), granule cell neuroblasts from the anterior rhombic lip begin to migrate over the surface of the cerebellar anlage to populate the external germinal layer (Miale and Sidman, 1961). The earliest known marker of these cells is the transcription factor Math1 (BenArie et al., 1997). In this study we show that Math1 and another early granule cell marker, the zinc finger protein, Zipro1 (Yang et al., 1996), are expressed by EtC.1. Additionally, we found EtC.1 expressed Pax6, a “master control” gene for the development of neural structures like the cerebellum (Engelkamp et al., 1999). EtC.1 also expressed low levels of En2, a transcription factor downstream of the Pax6 program described to be involved in cerebellar patterning (Joyner and Martin, 1987; Kuemerle et al., 1997). Low levels of En2 may be due to the in vitro isolation of EtC.1 from in vivo patterning cues. However, EtC.1 cells expressed Cyclin D2, which Ross et al. (1996) describe in embryonic cerebellar neurons, and in postnatal granule precursors prior to their differentiation (Ross et al., 1996). We further ruled out the possibility that EtC.1 are precursors to Purkinje cells, by showing that they express NeuN, which is lacking in Purkinje cells (Mullen et al., 1992), and were negative for Calbindin, a gene specifically expressed in Purkinje cells. Since EtC.1 cells did not express GFAP, a classic marker for astrocytes and radial glia-like cells (Bignami et al., 1972), nor mature synaptic markers such as Synaptophysin, Syntaxin, PSD-95, or Spinophylin, we surmise EtC.1 cells are immature granule cell precursors.

3.2.

EtC.1 cells express functional estrogen receptors

The presence of estrogen receptors are well documented in the developing cerebellum, and have been well characterized on granule cells (Belcher, 1999; Price and Handa, 2000; Guo et al., 2001; Ikeda and Nagai, 2006). We found via WB, qRT-PCR, and an E2-sensitive gene reporter assay that EtC.1 expressed ERα and ERβ. The 45 kDa bands we noted in WB for ERβ, differ

35

from the canonical MW for ERβ of 54 kDa (mERβ1) as reviewed by Lewandowski et al. (2002). While it is plausible that the ERβ species in EtC.1 may be a truncated isoform, a more detailed molecular study will be needed to resolve this possibility. Transcriptional function of ERs in EtC.1 cells was demonstrated by the expression of a Luciferase reporter gene transfected into the cells following E2 treatment. The specificity of this effect was demonstrated with the use of the ER antagonist ICI 182,780. We also found E2 induced the down-regulation of ERα protein, but not mRNA. This result is consistent with reports showing E2-induced down-regulation of ERα in multiple cell types by proteasome-dependent and independent mechanisms (reviewed by Balan et al., 2006). We further found that treatment with E2 had no effect on the EtC.1 progenitor phenotype we characterized so far. However, E2 did increase Fragile-X Mental Retardation Protein (FMRP), a mRNA binding protein that shuttles mRNA from the nucleus to synaptic sites in dendrites. FMRP is associated with pre- and post-synaptic terminals (Weiler and Greenough, 1999; Schenck et al., 2001) and Greenough et al. (2001) and Darnell et al. (2001) have shown that FMRP is associated with many target mRNAs involved in forming and modulating synapses. While E2 increased FMRP, suggesting synapse formation by E2 as shown in the cerebellum (Sakamoto et al., 2003), E2 failed to induce expression of mature synaptic proteins Synaptophysin, Syntaxin, PSD-95, or Spinophylin. While E2 functions as a modulator of these synaptic proteins in mature neurons (Woolley and McEwen, 1992; Choi et al., 2003; Li et al., 2004; Prange-Kiel and Rune, 2006), our results suggest that E2 alone is not sufficient to induce them in progenitor/immature neurons. Similarly, E2 failed to cause activation of classical second messenger pathways like CREB and ERK1/2 MAPK in EtC.1, which contrasts data from primary cultured hippocampal and cerebellar neurons of neonatal and adult rats, where E2 can activate CREB (Lee et al., 2004a), and induce rapid stimulation of ERK1/2 signaling (Wong et al., 2003; Zsarnovszky et al., 2005). In agreement with its inability to stimulate ERK1/2 MAPK in these cells, EtC.1 cell proliferation was not affected by E2 (unpublished results), in contrast to other studies reporting that E2 can increase the proliferation of developing cerebellar neurons (Wong et al., 2003) and embryonic, but not adult, neural stem cells (Brannvall et al., 2002). The limited range of E2 effects would seem to suggest that EtC.1 cells correspond to a developmental stage (E17) that is refractory to E2, in-spite of ER expression. Early studies in rat development report ER binding sites appearing until E21 and cerebellum presenting low levels of ER binding sites until after birth (MacLusky et al., 1979). Further, ER expression is increased drastically in the first week after birth, precisely the time when the brain becomes sensitive to the permanent differentiating effects of estrogen (MacLusky et al., 1979); coinciding with the time when the cerebellar cortex initiates most of its organization (Altman, 1972; Altman and Anderson, 1972). It is possible that driving EtC.1 down differentiation and maturation pathways, such as the ones shown by Salero and Hatten (2007) could induce them to respond to E2 in a manner consistent with neonatal or adult granule neurons (Sakamoto et al., 2003; Wong et al., 2003; Lee et al., 2004b; Zhao et al., 2005).

36 3.3.

BR A IN RE S EA RCH 1 1 86 ( 20 0 7 ) 2 9 –40

Cytokine expression by EtC.1 cells

The production of IL-6 by EtC.1 is in agreement with previous reports detecting IL-6 and its receptor in cerebellar neurons (Gadient et al., 1994). However, we also found that this response to LPS differs from that observed in primary microglia in several ways. First, no other inflammatory factors were detected; second, the magnitude of the IL-6 response in EtC.1 was an order of magnitude lower than microglia; third, the IL-6 response induced by LPS in these cerebellar cells was attenuated by E2. While inhibition of this cytokine by E2 is in agreement with other reports (Kurebayashi et al., 1997; Ray et al., 1997) the mechanisms of IL-6 inhibition by E2 in EtC.1 will require further molecular studies. IL-6 has various roles in the CNS other than inflammation. Several studies have shown that it supports the survival of different neuronal subpopulations (Hama et al., 1991), provokes axonal sprouting and regeneration (Hakkoum et al., 2007), and induces neuronal differentiation (Satoh et al., 1988; Marz et al., 1997). Further studies will be required to determine if low levels of IL-6, induced by LPS, may cause EtC.1 to differentiate.

3.4.

Steroid metabolism by EtC.1 cells

Neurosteroids such as E2 are synthesized in the brain, and the cerebellum is a major site for neurosteroid formation (Ukena et al., 1998; Tsutsui and Ukena, 1999; Tsutsui et al., 2000; Sakamoto et al., 2003). In the developing cerebellum of neonatal rats p450Arom mRNA is highly expressed in Purkinje cells and external granule cells of the cerebellar cortex (Sakamoto et al., 2003). Our findings of p450Arom protein and activity in EtC.1 are in agreement with these findings. Further, E2 concentration is much greater in the developing cerebellum than at 21 and 60 days of age and synthesis of P and E2 in the neonatal cerebellum can promote dendritic growth, spinogenesis, and synaptogenesis of Purkinje cells (Sakamoto et al., 2003). In this regard, EtC.1 cells may provide an important model to explore local hormonal regulation of neuronal plasticity in a manner similar to E2 specific spine formation in the adult hippocampus (Brake et al., 2001; Breedlove and Jordan, 2001; McEwen et al., 2001). In conclusion, our characterization of the cerebellar EtC.1 cell line revealed a provocative profile for the lineage of this cell, and raises interesting aspects of its estrogen-related properties that contrast with the response of neonatal and adult cerebellar cells to E2. Our results strongly suggest that this cloned cerebellar cell is an immature neuronal progenitor cell of the granule cell lineage that could serve as a potential model for studying the contributions of E2 on the development of the cerebellum.

4.

Experimental procedures

4.1.

EtC cell line

The EtC cell line was cloned from embryonic day 17 (E17) mouse brain and tested for its neuronal properties (Bulloch et al., 1977, 1978). Cells from an early passage (#3) were cryopreserved in

liquid nitrogen for future use, according to standard tissue culture protocols. All cells used in these experiments were derived from passages 4–10. The properties evaluated in this study remained stable throughout all passages.

4.2.

Cell culture

Cryoprotected cells were quickly thawed and seeded in 25 ml of Dulbecco's Modified Eagle Media with 4 mM glutamine (DMEM, Gibco, Carlsbad, CA) containing 20% heat-inactivated Fetal Calf Serum (FCS, Sigma, St. Louis, MO) and Penicillin, Streptomycin, Antimycotic (PSA) (Gibco) in 75 cm2 tissue culture flasks (B&D, Franklin Lakes, NJ) in a CO2 water jacketed incubator at 37 °C with 5% CO2. After initial plating, confluent cultures were trypsinized (0.25%, trypsin, Gibco), centrifuged, and re-suspended in standard culture media (SCM) comprised of DMEM containing 10% fetal calf serum plus PSA. For experiments with E2 incubations, cells were either serum starved for 24 h or cultured in Charcoal Stripped fetal calf serum (CSS, Hyclone, Logan, UT), as charcoal stripping removes endogenous bovine hormones and growth factors that could spuriously influence results. For ERK1/2 and CREB phosphorylation experiments, cells were incubated in media without serum for 12 and 48 h respectively, before stimulation with E2.

4.3.

Cell lysate harvest

Following treatment, supernatants were removed, cells were placed on ice, washed with ice-cold PBS, and scraped in icecold lysis buffer (6 M Urea, 20 mM Tris–HCl pH7.5, 2% SDS, 10% glycerol, 1% protease inhibitor cocktail (Sigma-Alridge) and frozen at −70 °C. Phosphatase inhibitor, Sodium Orthovanadate (2 mM) (Sigma-Aldridge), was added fresh to the lysis buffer when phosphoproteins were analyzed. Cell lysates, or control adult mouse brain lysates were sonicated, centrifuged free of cell debris, and total protein was assayed by Detergent Compatible Protein Assay according to manufacturer's instructions (BioRad, Hercules, CA).

4.4.

Western blot (WB) and immunodetection

Proteins were separated by SDS-PAGE performed under reducing conditions with NuPage gels according to manufacturer's instructions (Invitrogen), and then transferred to PVDF Membranes (Invitrogen). Membranes were rinsed with 0.1 M Tris-Buffered Saline with 0.1% Tween-20 (TBS-T) and blocked in TBS-T plus 5% non-fat dry milk (Block) for 1 h at room temperature (RT) on an orbital shaking platform. Membranes were washed (3 × 15 min in TBS-T) and incubated overnight at 4 °C with primary antibody (Table 1) diluted in Block or TBS-T 5% BSA (Sigma). Membranes were washed and incubated with the appropriate Horseradish Peroxidase-conjugated, speciesspecific secondary antibody (Pierce, Rockford, IL) 1:20,000 in Block. Blots were washed and developed with SuperSignal West Pico substrate (Pierce), and then exposed to X-ray film (XOMAT AR, Kodak, Rochester, NY). After exposure, membranes were stripped with Restore stripping buffer (Pierce), washed, blocked, and re-probed, as described above, for Actin as a loading control. Immunoreactive bands were quantified from films by densitometry using a lightbox, CCD camera, and MCID

BR A IN RE S E A RCH 1 1 86 ( 20 0 7 ) 2 9 –4 0

software (MCID-M4; Imaging Research, Inc., St. Catherines, ON), and normalized to Actin values, or non-phosphorylated protein values in the case of MAPK and CREB. Table 1 contains antibody–antigen information for the proteins screened by WB. Mouse adult brain tissue was used as a positive control. Optimal antibody titers and sample concentrations were experimentally determined. All secondary antibodies (Pierce) were used at 1:20,000 dilution and were negative for un-specific background staining.

4.5.

Immunocytochemistry (ICC)

Cells were seeded at 5 × 103 cells/well on poly-L-lysine-coated glass coverslips in 24 well tissue culture plates. After 48 h, media was aspirated, cells were washed with 1 ml sterile 0.1 M PBS and incubated 30 min in 4% paraformaldehyde in PBS, then washed with 0.5 ml 0.1M Phosphate Buffer (PB). Cells were blocked overnight at 4 °C on an orbital shaker in PB + 1% BSA. Blocking buffer was aspirated and coverslips were incubated in blocking buffer + 1:200 anti-Nestin (Chemicon) for 1 h, or 1:2000 anti-NeuN (Chemicon) overnight at 4 °C. Coverslips were washed and incubated for 1 h with conjugated anti-mouse IgG; for Nestin, Alexa Fluor 488 (Molecular Probes) at 1:500, and for NeuN, Rhodamine-Red-X (Jackson ImmunoResearch Labs, Westgrove, PA) at 1:300, both diluted in blocking buffer. Coverslips were washed and mounted on slides with Perma Fluor (Therma Shandon) and viewed on a Nikon fluorescent microscope and a LSM510 Confocal Zeiss microscope.

4.6. Reverse-transcription (RT) and polymerase chain reaction (PCR) Equal amounts (1 μg) of RNA extracted from ECt.1 cells using the RNeasy kit (Quiagen, Valencia, CA) were retrotranscribed with SuperScript II Reverse Transcriptase (Invitrogen) in a 30 ul reaction. 5 ul of cDNA were then used for PCR amplification of specific targets using the following primer pairs: Zipro1 (FWD-CTGCTGGCTCGGGAATCTGT; REV-CCTGCAGTCCTGGCTCATCA), Zic-1 (FWD-AAAAGGACACACACAGGGGAG; REV-GTCTCTTAAATAGGGGGTCG), Zic-2 (FWD-GGAGCAATACCGCCAAGTGG; REV-AACGAGCTGGGATGCGTGTA), Math-1 (FWD-ACCTGGTGTGCGATCTCCGA; AAGGTGTCTCGCCTGCAGGG), Pax-6 (FWD-CACCAACTCCATCCAGTTCTA; GCAAAGCACTGTACGTGTT), Cyclin-D2 (FWD-GTTCTGCAGAACCTGTTGAC; REV-ACAGCTTCTCCTTTTGCTGG), Calbindin28 (FWD-GCAGAATCCCACCTGCAG; REV-GTTGCTGGCATCGAAAGAG), and L-27A (FWD-TGTTGGAGGTGCCTGTGTTCT; REV-CATGGAGAGAAGGAAGGATGC). PCR reaction products were loaded on a 2% agarose gel with 0.005% Ethidium Bromide (SIGMA) and electrophoresed for 30 min at 100 volts. Bands were visualized under a UV-transilluminator, images were captured at non-saturating light levels, and densitometric analysis was done on saved images using MCID software. L27A expression was measured for normalization of gene expression levels.

of total RNA was DNase-treated using the DNA-free kit and protocol (Ambion) and 1 μg of DNase-treated total RNA was transferred to a cDNA reaction (TaqMan Gold RT-PCR kit, ABI). Real-time RT-PCR was run with 2.5 μl of cDNA template, 1× TaqMan Universal Master Mix (ABI), 20 nM each of forward and reverse primers for 18 S control and 100 nM 18 S control probe (ABI). RT-PCR for ER-α was run with 300 nM each of forward and reverse primers with 200 nM probe and RT-PCR for ER-β was run with 600 nM each of forward and reverse primers with 400 nM probe. ER-α forward primer corresponds to bases 1550 to 1580 in the murine ER-α sequence (Accession # M38651); ERα reverse primer corresponds to bases 1613 to 1635 and the ERα probe corresponds to bases 1585 to 1611. ER-β forward primer corresponds to bases 1144 to 1163 in the murine ER-β sequence (Accession # U81451); ER-β reverse primer corresponds to bases 1191 to 1211 and the ER-β probe corresponds to bases 1165 to 1189. Samples were run on an ABI 7700 Sequence Detection Instrument (Applied Biosystems) and collected data were analyzed using Merck Biometrics TaqManPlus program.

4.8. Enzyme Ligand ImmunoSorbent Assay (ELISA) and Greiss Assay EtC.1 cells were seeded in 24 well plates at 1 × 105 cells/well in SCM and incubated overnight. Media was removed and replaced with SCM containing 5% CSS and E2, +/− ICI 182,780, or ethanol vehicle (1:500,000 v/v) for 24 h before LPS stimulation (100 ng/ml). Cell culture supernatants were subjected to ELISAs following manufacturer's protocols: eBiosciences Mouse IL-1β, IL-6, and TNF-α ELISA kits. Supernatants were also subjected to Greiss Assay for NO content according to manufacturer's instructions (Promega Madison, WI). Data was collected and analyzed using a SpectraMax 190 Microplate spectrophotometer and SoftmaxPro software (Molecular Devices). Except for IL-6, cytokines were not present above the detection limit of the assay and were assigned a nominal value of 5% of maximum on the graph.

4.9. assay

ERE-luciferase and β-gal plasmid transfection and

4.9.1.

Plasmids and transfection

The 3× ERE-Luciferase plasmid was a generous gift of Don McDonnell, Duke University Durham, NC, and the β-Galactosidase (β-Gal) plasmid was from Promega (pSV-β-Gal control vector). For transfection, cells were plated in 24-well plates at a density of 2 × 104 cells/well in 0.5 ml SCM + 10% CSS to yield 50– 60% confluent wells the following day. On the day of transfection, 0.4 μg DNA was pre-complexed with 4 μl Plus Reagent, and then complexed with 1 μl Lipofectamine (per well) following manufacturer's instructions (Invitrogen). Cell media was replaced with 0.2 ml of fresh media, then 50 μl of transfection mix was added per well and plates incubated at 37 °C for 24 h, after which cells were stimulated with inhibitor, hormone, or vehicle.

4.9.2. 4.7.

Quantitative RT-PCR (qRT-PCR)

ECt.1 cells were lysed in TRIZOL reagent (Invitrogen) and total RNA was isolated following manufacturers' instructions. 5 μg

37

Luciferase measurement

Twenty-four hours after hormone treatments, cell lysates were prepared and luciferase activity measured using Promega Luciferase Assay System according to manufacturer's instructions (Cat. # E4030). Briefly, cells were rinsed with 1×

38

BR A IN RE S EA RCH 1 1 86 ( 20 0 7 ) 2 9 –40

PBS (Ca2+Mg2+) and then lysed in 100 μl of reporter lysis buffer with one freeze/thaw cycle (10 min at −70 °C, thaw at R.T.). Lysates were scraped, collected, and spun at 14,000 rpm using a tabletop microfuge at 4 °C for 10 min. Supernatants were recovered into new tubes, supplemented with luciferase substrate, and light emission was quantified in a single-sample luminometer (Turner Biosystems; Sunnyvale, CA).

4.9.3.

β-Gal assay

β-Gal activity was measured from the recovered supernatant by mixing it 1:1 with a 2× assay buffer (100 μM K2PO4, 100 μM KH2PO4, 0.7% β-mercaptoethanol, 4 μM MgCl2, 1.33 mg/ml onitrophenyl-β-D-galactopyranoside). The reaction was incubated in a 37 °C water bath until the development of yellow color (1–24 h), stopped with addition of 1 M Na2CO3 at a 1:1.66 ratio (sample: Na2CO3), and read at 420 nm OD in a 96-well plate reader. Transfection efficiency ranged from 70% to 100% across treatments and β-Gal values were used to normalize luciferase readings.

4.10.

Steroid metabolism assay

EtC.1 cells were seeded at 1 × 105 cells/well. The next day cells were rinsed and media was replaced with SCM plus 74 Ci/ mmol tritiated androstenedione (AD) ([1,2,6,7-3H] AD, Perkin Elmer Life Science, Wellesley, MA) for 6 or 22 h. Cell supernatants (0.2 ml) were vortexed with acetone (0.2 ml) and ethyl acetate (0.5 ml), and the organic phase was recovered. A portion (0.2 ml) of the extract was evaporated, the residue redissolved in methanol, and the metabolites separated by TLC on silica gel aluminium sheets (Fisher) using xylene-ethyl acetate-chloroform (40:15:45 by vol.) which gives good separation of T, E2, AD and estrone (E1) (RF: 0.20, 0.27, 0.40, 0.54, respectively). Unlabeled steroids (Sigma, St. Louis, MO) were run in lanes adjacent to the putative metabolites and were identified by their chromogenic properties after spraying with 5% (by vol.) sulfuric acid in methanol and charring on a hot plate. In addition, AD and T location was determined by their UV light absorption at 312 nm. Separated metabolites were cut out and added directly to vials containing scintillation fluid (5 ml) for determination of radioactivity. The purity and identity of E2 was confirmed by reverse isotope dilution as previously described (Jellinck et al., 2001).

4.11.

Data analysis

Data derived from WB densitometry, Luciferase assays, and ELISA was analyzed for statistical significance using Student's T-test comparison to control, and ANOVA where appropriate, at 95% confidence interval using StatView software (SAS Institute, Cary, NC). All experiments were performed in duplicate or triplicate, and all data is representative of multiple independent experiments.

Acknowledgments This work was supported by Grants 5RO1 NS07080 (NIH) and 5PO1 AG16765-07 (NIA). We thank Enrique Salero for providing primer pairs and helpful discussions about cerebellar progen-

itor cells. We also thank Nino Devitze for the ERE-Luciferase plasmid and technical help with transfections. REFERENCES

Altman, J., 1972. Postnatal development of the cerebellar cortex in the rat. I. The external germinal layer and the transitional molecular layer. J. Comp. Neurol. 145 (3), 353–397. Altman, J., Anderson, W.J., 1972. Experimental reorganization of the cerebellar cortex. I. Morphological effects of elimination of all microneurons with prolonged x-irradiation started at birth. J. Comp. Neurol. 146 (3), 355–406. Aruga, J., Minowa, O., et al., 1998. Mouse Zic1 is involved in cerebellar development. J. Neurosci. 18 (1), 284–293. Aruga, J., Inoue, T., et al., 2002. Zic2 controls cerebellar development in cooperation with Zic1. J. Neurosci. 22 (1), 218–225. Balan, K.V., Wang, Y., et al., 2006. Proteasome-independent down-regulation of estrogen receptor-alpha (ERalpha) in breast cancer cells treated with 4,4′-dihydroxy- trans-stilbene. Biochem. Pharmacol. 72 (5), 573–581. Belcher, S.M., 1999. Regulated expression of estrogen receptor alpha and beta mRNA in granule cells during development of the rat cerebellum. Brain Res. Dev. Brain Res. 115 (1), 57–69. Ben-Arie, N., Bellen, H.J., et al., 1997. Math1 is essential for genesis of cerebellar granule neurons. Nature 390 (6656), 169–172. Bignami, A., Eng, L.F., et al., 1972. Localization of the glial fibrillary acidic protein in astrocytes by immunofluorescence. Brain Res. 43 (2), 429–435. Blumcke, I., Schewe, J.C., et al., 2001. Increase of nestin-immunoreactive neural precursor cells in the dentate gyrus of pediatric patients with early-onset temporal lobe epilepsy. Hippocampus 11 (3), 311–321. Brake, W.G., Alves, S.E., et al., 2001. Novel target sites for estrogen action in the dorsal hippocampus: an examination of synaptic proteins. Endocrinology 142 (3), 1284–1289. Brannvall, K., Korhonen, L., et al., 2002. Estrogen-receptor-dependent regulation of neural stem cell proliferation and differentiation. Mol. Cell. Neurosci. 21 (3), 512–520. Breedlove, S.M., Jordan, C.L., 2001. The increasingly plastic, hormone-responsive adult brain. Proc. Natl. Acad. Sci. U. S. A. 98 (6), 2956–2957. Brown, J.P., Couillard-Despres, S., et al., 2003. Transient expression of doublecortin during adult neurogenesis. J. Comp. Neurol. 467 (1), 1–10. Bulloch, K., Stallcup, W.B., et al., 1977. The derivation and characterization of neuronal cell lines from rat and mouse brain. Brain Res. 135 (1), 25–36. Bulloch, K., Stallcup, W.B., et al., 1978. A new method for the establishment of neuronal cell lines from the mouse brain. Life Sci. 22 (6), 495–504. Choi, J.M., Romeo, R.D., et al., 2003. Estradiol increases pre- and post-synaptic proteins in the CA1 region of the hippocampus in female rhesus macaques (Macaca mulatta). Endocrinology 144 (11), 4734–4738. Colucci-Guyon, E., Gimenez, Y.R.M., et al., 1999. Cerebellar defect and impaired motor coordination in mice lacking vimentin. Glia 25 (1), 33–43. Darnell, J.C., Jensen, K.B., et al., 2001. Fragile X mental retardation protein targets G quartet mRNAs important for neuronal function. Cell 107 (4), 489–499. Engelkamp, D., Rashbass, P., et al., 1999. Role of Pax6 in development of the cerebellar system. Development 126 (16), 3585–3596.

BR A IN RE S E A RCH 1 1 86 ( 20 0 7 ) 2 9 –4 0

Gadient, R.A., Otten, U., et al., 1994. Expression of interleukin-6 (IL-6) and interleukin-6 receptor (IL-6R) mRNAs in rat brain during postnatal development. Brain Res. 637 (1–2), 10–14. Gao, W.Q., Hatten, M.E., 1994. Immortalizing oncogenes subvert the establishment of granule cell identity in developing cerebellum. Development 120 (5), 1059–1070. Greenough, W.T., Klintsova, A.Y., et al., 2001. Synaptic regulation of protein synthesis and the fragile X protein. Proc. Natl. Acad. Sci. U. S. A. 98 (13), 7101–7106. Guo, X.Z., Su, J.D., et al., 2001. Expression of estrogen receptor (ER)-alpha and -beta transcripts in the neonatal and adult rat cerebral cortex, cerebellum, and olfactory bulb. Cell Res. 11 (4), 321–324. Hakkoum, D., Stoppini, L., et al., 2007. Interleukin-6 promotes sprouting and functional recovery in lesioned organotypic hippocampal slice cultures. J. Neurochem. 100 (3), 747–757. Hama, T., Kushima, Y., et al., 1991. Interleukin-6 improves the survival of mesencephalic catecholaminergic and septal cholinergic neurons from postnatal, two-week-old rats in cultures. Neuroscience 40 (2), 445–452. Helms, A.W., Gowan, K., et al., 2001. Overexpression of MATH1 disrupts the coordination of neural differentiation in cerebellum development. Mol. Cell. Neurosci. 17 (4), 671–682. Hockfield, S., McKay, R.D., 1985. Identification of major cell classes in the developing mammalian nervous system. J. Neurosci. 5 (12), 3310–3328. Ikeda, Y., Nagai, A., 2006. Differential expression of the estrogen receptors alpha and beta during postnatal development of the rat cerebellum. Brain Res. 1083 (1), 39–49. Jakab, R.L., Wong, J.K., et al., 2001. Estrogen receptor beta immunoreactivity in differentiating cells of the developing rat cerebellum. J. Comp. Neurol. 430 (3), 396–409. Jellinck, P.H., Lee, S.J., et al., 2001. Metabolism of dehydroepiandrosterone by rat hippocampal cells in culture: possible role of aromatization and 7-hydroxylation in neuroprotection. J. Steroid Biochem. Mol. Biol. 78 (4), 313–317. Jellinck, P.H., Croft, G., et al., 2005. Metabolism of dehydroepiandrosterone by rodent brain cell lines: relationship between 7-hydroxylation and aromatization. J. Steroid Biochem. Mol. Biol. 93 (1), 81–86. Jellinck, P.H., Kaufmann, M., Gottfried-Blackmore, A., McEwen, B.S., Jones, G., Bulloch, K., 2007. Selective conversion of dehydroepiandrosterone (DHEA) by microgila to 5-androstenediol — a steroid with inherent estrogen properties. J. Steroid Biochem. 107 (3–5), 156–162. Jover-Mengual, T., Zukin, R.S., et al., 2007. MAPK signaling is critical to estradiol protection of CA1 neurons in global ischemia. Endocrinology 148 (3), 1131–1143. Joyner, A.L., Martin, G.R., 1987. En-1 and En-2, two mouse genes with sequence homology to the Drosophila engrailed gene: expression during embryogenesis. Genes Dev. 1 (1), 29–38. Kaneko, Y., Sakakibara, S., et al., 2000. Musashi1: an evolutionally conserved marker for CNS progenitor cells including neural stem cells. Dev. Neurosci. 22 (1–2), 139–153. Kuemerle, B., Zanjani, H., et al., 1997. Pattern deformities and cell loss in Engrailed-2 mutant mice suggest two separate patterning events during cerebellar development. J. Neurosci. 17 (20), 7881–7889. Kurebayashi, S., Miyashita, Y., et al., 1997. Characterization of mechanisms of interleukin-6 gene repression by estrogen receptor. J. Steroid Biochem. Mol. Biol. 60 (1–2), 11–17. Lee, S.J., McEwen, B.S., 2001. Neurotrophic and neuroprotective actions of estrogens and their therapeutic implications. Annu. Rev. Pharmacol. Toxicol. 41, 569–591. Lee, S.J., Campomanes, C.R., et al., 2004a. Estrogen induces phosphorylation of cyclic AMP response element binding (pCREB) in primary hippocampal cells in a time-dependent manner. Neuroscience 124 (3), 549–560.

39

Lee, S.J., Romeo, R.D., et al., 2004b. Estradiol affects spinophilin protein differently in gonadectomized males and females. Neuroscience 127 (4), 983–988. Lendahl, U., Zimmerman, L.B., et al., 1990. CNS stem cells express a new class of intermediate filament protein. Cell 60 (4), 585–595. Leranth, C., Hajszan, T., et al., 2004. Androgens increase spine synapse density in the CA1 hippocampal subfield of ovariectomized female rats. J. Neurosci. 24 (2), 495–499. Lewandowski, S., Kalita, K., et al., 2002. Estrogen receptor beta. Potential functional significance of a variety of mRNA isoforms. FEBS Lett. 524 (1–3), 1–5. Lewis, C., McEwen, B.S., et al., 1995. Estrogen-induction of dendritic spines in ventromedial hypothalamus and hippocampus: effects of neonatal aromatase blockade and adult GDX. Brain Res. Dev. Brain Res. 87 (1), 91–95. Li, C., Brake, W.G., et al., 2004. Estrogen alters hippocampal dendritic spine shape and enhances synaptic protein immunoreactivity and spatial memory in female mice. Proc. Natl. Acad. Sci. U. S. A. 101 (7), 2185–2190. Litteria, M., 1987. Cerebellar Na+,K+-ATPase activity is increased during early postnatal development of the estrogenized female rat. Brain Res. 430 (1), 157–160. Liu, A., Joyner, A.L., 2001. EN and GBX2 play essential roles downstream of FGF8 in patterning the mouse mid/hindbrain region. Development 128 (2), 181–191. MacLusky, N.J., Lieberburg, I., et al., 1979. The development of estrogen receptor systems in the rat brain: perinatal development. Brain Res. 178 (1), 129–142. Marz, P., Herget, T., et al., 1997. Activation of gp130 by IL-6/soluble IL-6 receptor induces neuronal differentiation. Eur. J. Neurosci. 9 (12), 2765–2773. Matsuo, N., Kawamoto, S., et al., 1998. Cloning and developmental expression of the murine homolog of doublecortin. Biochem. Biophys. Res. Commun. 252 (3), 571–576. McEwen, B.S., 2001. Invited review: estrogens effects on the brain: multiple sites and molecular mechanisms. J. Appl. Physiol. 91 (6), 2785–2801. McEwen, B.S., Alves, S.E., et al., 1997. Ovarian steroids and the brain: implications for cognition and aging. Neurology 48 (5 Suppl 7), S8–S15. McEwen, B., Akama, K., et al., 2001. Tracking the estrogen receptor in neurons: implications for estrogen-induced synapse formation. Proc. Natl. Acad. Sci. U. S. A. 98 (13), 7093–7100. Miale, I.L., Sidman, R.L., 1961. An autoradiographic analysis of histogenesis in the mouse cerebellum. Exp. Neurol. 4, 277–296. Mitra, S.W., Hoskin, E., et al., 2003. Immunolocalization of estrogen receptor beta in the mouse brain: comparison with estrogen receptor alpha. Endocrinology 144 (5), 2055–2067. Mullen, R.J., Buck, C.R., et al., 1992. NeuN, a neuronal specific nuclear protein in vertebrates. Development 116 (1), 201–211. Prange-Kiel, J., Rune, G.M., 2006. Direct and indirect effects of estrogen on rat hippocampus. Neuroscience 138 (3), 765–772. Price Jr., R.H., Handa, R.J., 2000. Expression of estrogen receptor-beta protein and mRNA in the cerebellum of the rat. Neurosci. Lett. 288 (2), 115–118. Ray, P., Ghosh, S.K., et al., 1997. Repression of interleukin-6 gene expression by 17 beta-estradiol: inhibition of the DNA-binding activity of the transcription factors NF-IL6 and NF-kappa B by the estrogen receptor. FEBS Lett. 409 (1), 79–85. Ross, M.E., Carter, M.L., et al., 1996. MN20, a D2 cyclin, is transiently expressed in selected neural populations during embryogenesis. J. Neurosci. 16 (1), 210–219. Sakakibara, S., Okano, H., 1997. Expression of neural RNA-binding proteins in the postnatal CNS: implications of their roles in

40

BR A IN RE S EA RCH 1 1 86 ( 20 0 7 ) 2 9 –40

neuronal and glial cell development. J. Neurosci. 17 (21), 8300–8312. Sakamoto, H., Mezaki, Y., et al., 2003. Dendritic growth and spine formation in response to estrogen in the developing Purkinje cell. Endocrinology 144 (10), 4466–4477. Salero, E., Hatten, M.E., 2007. Differentiation of ES cells into cerebellar neurons. Proc. Natl. Acad. Sci. U. S. A. 104 (8), 2997–3002. Satoh, T., Nakamura, S., et al., 1988. Induction of neuronal differentiation in PC12 cells by B-cell stimulatory factor 2/interleukin 6. Mol. Cell. Biol. 8 (8), 3546–3549. Schenck, A., Bardoni, B., et al., 2001. A highly conserved protein family interacting with the fragile X mental retardation protein (FMRP) and displaying selective interactions with FMRP-related proteins FXR1P and FXR2P. Proc. Natl. Acad. Sci. U. S. A. 98 (15), 8844–8849. Snyder, E.Y., Deitcher, D.L., et al., 1992. Multipotent neural cell lines can engraft and participate in development of mouse cerebellum. Cell 68 (1), 33–51. Tsutsui, K., Ukena, K., 1999. Neurosteroids in the cerebellar Purkinje neuron and their actions (review). Int. J. Mol. Med. 4 (1), 49–56. Tsutsui, K., Ukena, K., et al., 2000. Novel brain function: biosynthesis and actions of neurosteroids in neurons. Neurosci. Res. 36 (4), 261–273. Ukena, K., Usui, M., et al., 1998. Cytochrome P450 side-chain cleavage enzyme in the cerebellar Purkinje neuron and its neonatal change in rats. Endocrinology 139 (1), 137–147. Wang, C., Asai, D.J., et al., 1980. The 68,000-dalton neurofilament-associated polypeptide is a component of nonneuronal cells and of skeletal myofibrils. Proc. Natl. Acad. Sci. U. S. A. 77 (3), 1541–1545. Weiler, I.J., Greenough, W.T., 1999. Synaptic synthesis of the Fragile X protein: possible involvement in synapse maturation and elimination. Am. J. Med. Genet. 83 (4), 248–252.

Weyer, A., Schilling, K., 2003. Developmental and cell type-specific expression of the neuronal marker NeuN in the murine cerebellum. J. Neurosci. Res. 73 (3), 400–409. Wong, J.K., Le, H.H., et al., 2003. Estrogens and ICI182,780 (Faslodex) modulate mitosis and cell death in immature cerebellar neurons via rapid activation of p44/p42 mitogen-activated protein kinase. J. Neurosci. 23 (12), 4984–4995. Woolley, C.S., McEwen, B.S., 1992. Estradiol mediates fluctuation in hippocampal synapse density during the estrous cycle in the adult rat. J. Neurosci. 12 (7), 2549–2554. Woolley, C.S., Weiland, N.G., et al., 1997. Estradiol increases the sensitivity of hippocampal CA1 pyramidal cells to NMDA receptor-mediated synaptic input: correlation with dendritic spine density. J. Neurosci. 17 (5), 1848–1859. Yang, X.W., Zhong, R., et al., 1996. Granule cell specification in the developing mouse brain as defined by expression of the zinc finger transcription factor RU49. Development 122 (2), 555–566. Yang, J., Bian, W., et al., 1997. Nestin mRNA expression during the development of mouse central nervous system. Sheng Li Xue Bao 49 (6), 657–665. Yang, J., Cheng, L., et al., 2001. Mouse nestin cDNA cloning and protein expression in the cytoskeleton of transfected cells. Biochim. Biophys. Acta 1520 (3), 251–254. Zhao, L., Chen, S., et al., 2005. 17beta-estradiol induces Ca2+ influx, dendritic and nuclear Ca2+ rise and subsequent cyclic AMP response element-binding protein activation in hippocampal neurons: a potential initiation mechanism for estrogen neurotrophism. Neuroscience 132 (2), 299–311. Zsarnovszky, A., Le, H.H., et al., 2005. Ontogeny of rapid estrogen-mediated extracellular signal-regulated kinase signaling in the rat cerebellar cortex: potent nongenomic agonist and endocrine disrupting activity of the xenoestrogen bisphenol A. Endocrinology 146 (12), 5388–5396.