Characterization of a midgut-specific chitin synthase gene (LmCHS2) responsible for biosynthesis of chitin of peritrophic matrix in Locusta migratoria

Insect Biochemistry and Molecular Biology 42 (2012) 902e910

Contents lists available at SciVerse ScienceDirect

Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb

Characterization of a midgut-specific chitin synthase gene (LmCHS2) responsible for biosynthesis of chitin of peritrophic matrix in Locusta migratoria Xiaojian Liu a, Huanhuan Zhang a, Sheng Li b, Kun Yan Zhu c, Enbo Ma a, *, Jianzhen Zhang a, b, ** a

Research Institute of Applied Biology, Shanxi University, Taiyuan, Shanxi 030006, China Institute of Plant Physiology and Ecology, Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China c Department of Entomology, 123 Waters Hall, Kansas State University, Manhattan, KS 66506, USA b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 2 July 2012 Received in revised form 8 September 2012 Accepted 10 September 2012

Chitin, an essential component of peritrophic matrix (PM), is produced by a series of biochemical reactions. Chitin synthase plays a crucial role in chitin polymerization in chitin biosynthetic pathway. In this study, we identified and characterized a full-length cDNA of chitin synthase 2 gene (LmCHS2) from Locusta migratoria. The cDNA contains an open reading frame of 4569 nucleotides that encode 1523 amino acid residues, and 76- and 373-nucleotides for 50 - and 30 -noncoding regions, respectively. Analysis of LmCHS2 transcript in different tissues of the locust by using real-time quantitative PCR indicated that LmCHS2 was exclusively expressed in midgut and gastric caeca (a part of the midgut). The highest expression was found in the anterior midgut with a decline of the transcript level from the anterior to posterior regions. During growth and development of locusts, there was only a slight expression in eggs, but the expression gradually increased from nymphs to adults. In situ hybridization further revealed that LmCHS2 transcript mainly presented in the apical regions of brush border forming columnar cells of gastric caeca. LmCHS2 dsRNA was injected to fifth-instar nymphs to further explore biological functions of LmCHS2. Significantly down-regulated transcript of LmCHS2 resulted in a cessation of feeding and a high mortality of the insect. However, no visible abnormal morphological change of locusts was observed until insects molted to adults. After dissection, we found that the average length of midguts from the LmCHS2 dsRNA-injected locusts was shorter than that of the control insects that were injected with dsGFP. Furthermore, microsection of midguts showed that the PM of the LmCHS2 dsRNA-injected nymphs was amorphous and thin as compared with the controls. Our results demonstrate that LmCHS2 is responsible for the biosynthesis of chitin associated with PM and plays an essential role in locust growth and development. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Chitin synthase 2 Gene expression pattern Locusta migratoria Peritrophic matrix RNA interference

1. Introduction Chitin is an essential component of insect cuticular exoskeleton and tracheae, and significant chitin deposition occurs in peritrophic matrix (PM) that lines the midgut epithelium (Merzendorfer and Zimoch, 2003). The PM, semi-permeable matrix, is involved in the protection of insect gut against food abrasion, and invasion of microorganisms and parasites, and many other functions (Terra, 2001; Khajuria et al., 2010).

* Corresponding author. Tel.: þ86 351 7018871/7016098; fax: þ86 351 7011981. ** Corresponding author. Research Institute of Applied Biology, Shanxi University, Taiyuan, Shanxi 030006, China. Tel.: þ86 351 7018871/7016098; fax: þ86 351 7011981. E-mail addresses: [email protected] (E. Ma), [email protected] (J. Zhang). 0965-1748/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.ibmb.2012.09.002

In insects, although there is a great diversity of PM structures, it was typically categorized into two types (Types I and II) based on the mode of PM formations. Type I PM is secreted by the entire epithelium lining midgut, whereas a small number of specialized cells called the cardia produce Type II PM. Type I PM is widespread in insects and particularly prevalent in lepidopterans in which forms a “felt-like” material with a thickness of 0.5e1.0 mm. In contrast, Type II PM is more organized and contains one to three laminated layers which are found in primitive orders (e.g., Dermaptera and Isoptera) (Shao et al., 2001; Kato et al., 2006). Both types of PM contain chitin and proteins, which include proteins, glycoproteins, and proteoglycans (Terra, 2001). The chitin content in PM generally accounts for 3e13% (Hegedus et al., 2009). Ultrastructural observations of PM suggest that chitin appears to form a flexible framework onto which the proteins are assembled to form a matrix structure (Wang and Granados, 2001).

X. Liu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 902e910

Despite the PM is biologically important in insects, relatively little information is available about the chitin biosynthetic pathway in insects. The last enzyme catalyzed chitin polymer biosynthesis in insects is chitin synthase which converts UDP-N-acetylglucosamine (UDP-GlcNAc) to the growing chitin polymer (Cohen, 2001). To date, two chitin synthase genes (CHS1 and CHS2, also referred to CHSA and CHSB, respectively) have been reported in insects. CHS1 is responsible for chitin synthesis in cuticle and cuticular lining of the foregut, hindgut, and trachea, whereas CHS2 is dedicated to chitin synthesis in the PM (Zimoch and Merzendorfer, 2002). They are large transmembrane proteins with a slightly acidic isoelectric points. Insect CHS1 is known to have a short alternative exons, which lead to the production of two splicing variants. Unlike CHS1, no alternative exons have been reported for CHS2 (Merzendorfer, 2006). CHS1 and CHS2 can also be distinguished by expression patterns in different tissues of an insect. CHS1 is predominantly expressed in the epidermis and tracheal cells, whereas CHS2 is specifically expressed in the midgut epithelial cells (Merzendorfer and Zimoch, 2003). However, a recent study detected both enzymes in newly formed compound eyes of Anopheles gambiae pupae by using immunohistochemical analysis (Zhang et al., 2012). RNA interference (RNAi) is a phenomenon of down-regulation of gene expression triggered by double-stranded RNA (dsRNA) or small interfering RNA (siRNA). RNAi can be used as a powerful tool for the rapid analysis of gene function in a variety of organisms. The first clear demonstration that the two chitin synthase genes have distinct functions was carried out in Tribolium castaneum (Arakane et al., 2005, 2008). By injection of dsRNA synthesized based on either of the two chitin synthase genes, they found that knockdown of TcCHS2 affected only midgut chitin without a significant impact on total chitin, whereas down-regulation of TcCHS1 resulted in substantial loss of chitin only in the exoskeleton. In An. gambiae, the total chitin content was significantly reduced in the larvae fed on chitosan/AgCHS1 dsRNA-based nanoparticles. In contrast, the larvae fed on chitosan/AgCHS2 dsRNA-based nanoparticles showed increased PM permeability and larval susceptibility to several chemicals (Zhang et al., 2010b). All these results suggest that there is a specialization in the function of the two chitin synthases genes. CHS1 is required exclusively for chitin synthesis of cuticle and trachea, whereas CHS2 is only responsible for chitin synthesis of the PM-associated chitin in gut epithelial cells (Merzendorfer, 2006). To date, most studies on insect chitin synthases have focused on chitin synthase 1 gene expressed by epidermal cells, and there is limited information on chitin synthase 2 gene. In our earlier research, RNAi of LmCHS1 in Locusta migratoria adversely affects growth and development of nymphs (Zhang et al., 2010a). In this paper, we report chitin synthase 2 gene (LmCHS2) from a major

903

hemimetabolous agricultural insect pest, L. migratoria, which includes: 1) isolation and sequencing of a full-length cDNA derived from LmCHS2; 2) determinations of expression patterns of LmCHS2 in different tissues and at different developmental stages; 3) subcellular localization of LmCHS2 mRNA by in situ hybridization; and 4) functional analysis of LmCHS2 by RNAi. 2. Materials and methods 2.1. Insects L. migratoria were provided by Insect Protein Co., Ltd. of Cangzhou City in China and reared using fresh wheat seedlings and bran in the laboratory. The eggs were then incubated in a growth chamber (Yiheng, China) at 30  C under a relatively humidity of 50% and a photoperiod of 14 h light and 10 h dark cycle. Insects of different developmental stages were synchronized for sample collections. 2.2. Isolation and sequencing of cDNA encoding CHS2 A cDNA fragment of LmCHS2 encoding chitin synthase 2 was first identified from Migratory Locust EST Database (http:// locustdb.genomics.org.cn/). Total RNA was extracted from the midgut of fifth-instar nymphs using RNAiso Plus reagent (TaKaRa, China). mRNA was then isolated using PolyATtract mRNA isolation systems (Promega, Madison, WI). cDNA was synthesized from 1 mg mRNA using the Smart Race cDNA Amplification Kit (Clontech, Mountain View, CA). To obtain the full-length cDNA of LmCHS2, RACE-PCR was performed using Advantage 2 PCR Enzyme System (Clontech). The sequences of the gene-specific primers for RACE PCR are presented in Table 1. The PCR products were analyzed on 1% agarose gel, purified using Gel Mini Purification Kit (TIANGEN, China), subcloned into pGEM-T Easy Vector (Promega), and then sequenced completely from both directions. 2.3. Analysis of LmCHS2 cDNA and its deduced amino acid sequence The amino acid sequence of LmCHS2 was translated using online tools of ExPASy website (http://www.expasy.org/tools/). Other sequence analysis tools to predict its molecular mass, isoelectric point, transmembrane helices, and N-glycosylation sites were also obtained from ExPASy website. Multiple amino acid sequence alignment of all known insect chitin synthases was carried out using ClustalW (http://www.ebi.ac.uk/Tools/msa/ clustalw2/). The phylogenetic tree was generated by MEGA 4.

Table 1 Sequences of PCR primers used in RACE-PCR for amplification of the full-length cDNA, qPCR for gene expression analysis, RNA probe preparation for in situ hybridization, and dsRNA synthesis for RNA interference of LmCHS2. Application of primers

Gene name

Primer name

Primer sequence (50 e30 )

cDNA cloning

LmCHS2

Adapter 50 RACE-R 30 RACE-F ECHS2F ECHS2R b-actin F b-actin R CHS2F CHS2R dsCHS2F dsCHS2R dsGFPF dsGFPR

CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT AGCCTGTACCTTTGGAGATTCCCTTG CCTGGCTCTGGGAGGCTAAGAATGCG CAGCCTTCCGCATAGACAACT CGGCCATCATAACCAATGAAT CGAAGCACAGTCAAAGAGAGGTA GCTTCAGTCAAGAGAACAGGATG AGGCACGTATCACCAAGGAC CTTGGTCCTCATTCCTTCCA TAATACGACTCACTATAGGGAGGTACAGGCTGAGCAGGAA TAATACGACTCACTATAGGGCATCAGTGGACTTTCTCGCA TAATACGACTCACTATAGGGGTGGAGAGGGTGAAGG TAATACGACTCACTATAGGGGGGCAGATTGTGTGGAC

qPCR analysis

LmCHS2

b-actin In situ hybridization

LmCHS2

dsRNA synthesis

LmCHS2 GFP

Size (bp) 3229 1537 150 156 360 188 712

904

X. Liu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 902e910

2.4. Tissue-specific expression of LmCHS2 using real-time quantitative PCR LmCHS2- and b-actin-specific primers used for real-time quantitative PCR (qPCR) analysis are shown in Table 1. b-actin was used as a reference gene. For tissue-specific gene expression studies, 10 tissues, including integument, foregut, midgut, hindgut, gastric caeca, Malpighian tubules, fatbodies, muscles, wing and trachea, were dissected from fifth-instar nymphs on day 1. Total RNA was isolated from each sample using RNAisoÔ Plus (TaKaRa, Japan). cDNA was synthesized from 1.5 mg of total RNA treated with RNasefree DNase (Promega) using M-MLV reverse transcriptase (Promega). qPCR was carried out in a 20-ml reaction containing 3 ml of a 10-fold diluted cDNA, 0.4 mM of each primer and 12.5 ml SYBR Premix Ex TaqÔ II (TaKaRa, Japan) on Applied Biosystems 7300 Real-Time PCR system (Applied Biosystems, USA). The relative expression of each gene was determined using cycling parameters of an initial denaturation at 95  C for 10 s, followed by 40 cycles of 95  C for 5 s, and 60  C for 34 s. A melt curve was evaluated for each qPCR experiment to confirm the amplification specificity. All these experiments were performed using three biological replicates, each with two technical replicates. The 2DDCT method was used to calculate the relative levels of LmCHS2 transcript in different tissues. 2.5. Expression of LmCHS2 in different regions of midgut To further analyze differential expression of LmCHS2 throughout the midgut. The midgut was dissected from fifth-instar nymphs on day 1 and divided into three equal segments corresponding to anterior, median, and posterior regions. Total RNA was isolated from each sample from 15 midguts. All these experiments were performed using three biological replicates. Other methods were the same as described in Section 2.4.

2.6. Developmental expression of LmCHS2 Eggs, midgut and gastric caeca dissected from first, second, third, forth and fifth-instar nymphs and adults were used for total RNA isolation. The cDNA templates were used for determining the stage-dependent expression of LmCHS2. The relative expression of LmCHS2 was analyzed by using qPCR as described in Section 2.4.

2.7. In situ hybridization To prepare the RNA probes for LmCHS2, a pair of specific primers was designed as shown in Table 1. After the resulting PCR product of 360 bp was purified and ligated into the pGEM-T vector (Promega), both strands of the recombinant plasmid were sequenced. Digoxigenin-labeled RNA probes were generated by in vitro transcription from the plasmid using Dig RNA-Labeling Kit (Roche, Germany), and SP6 and T7 RNA polymerase to produce the sense and antisense strands, respectively. Subsequently, a dot-blot assay was used to estimate the appropriate concentration of the probes for in situ hybridization. The gastric caeca from day 1 of the fifth-instar nymph were dissected in ice-cold phosphate buffered saline (PBS), fixed in 4% paraformaldehyde at 4  C overnight, dehydrated through an ethanol series and xylene, and embedded in paraffin. The samples were sectioned at 5 mm. The in situ hybridization was performed following the protocol described by Zimoch and Merzendorfer (2002) and the slides were viewed under an OLYMPUS BX51 and photography was taken with an OLYMPUS digital camera.

2.8. Functional analysis of LmCHS2 RNAi was carried out to study the function of LmCHS2. A homologous region with most sequence divergence between the cDNAs of LmCHS1 and LmCHS2 was selected for gene-specific dsRNA synthesis. The nucleotide sequence identity between the two genes is 58%. Specific primers, with T7 RNA polymerase promoter sequence at the 50 -end, were designed corresponding to the dsRNA region. PCR was performed using cDNA from midguts of fifth-instar nymphs to prepare the template for dsRNA synthesis. The resulting fragment was subcloned and sequenced to confirm its identity. dsRNA of LmCHS2 and GFP were prepared according to the method of Zhang et al. (2010a). The sequences of the primers used for dsRNA synthesis and transcript analysis are shown in Table 1. Aliquots of 10 mg LmCHS2 or GFP dsRNA were injected into the dorsal side between the second and third abdominal segments of fifth-instar nymphs on day 2 using a manual microinjector (Ningbo, China). Each group consisted of 50 individual nymphs and the experiment was carried out in three replicates. Following the injections, nymphs were maintained in a growth chamber at 30  C, and carefully observed for any visible abnormalities and mortality. To ensure that the down-regulation of transcripts was specific for LmCHS2, total RNA was isolated from days 5, 6 and 7 of fifth-instar nymphs (abbreviated as N5D5, N5D6 and N5D7, respectively) after LmCHS2 dsRNA or GFP dsRNA injection. The integuments or midguts dissected from three insects were pooled for each RNA extraction. cDNA synthesis and qPCR were performed to determine the relative expression of LmCHS1 or LmCHS2 using the same methods as described in Section 2.4. The whole gut from individual nymph was dissected in ice-cold phosphate buffered saline (PBS) from days 5, 6 and 7 of fifth-instar nymphs after the injection of LmCHS2 dsRNA or GFP dsRNA. A total of 10 whole guts were dissected from the LmCHS2 dsRNA or GFP dsRNA injected locusts in each replicate and scanned using EPSON PERFECTION V700 PHOTO (Indonesia). The lengths of the midguts were measured using a vernier caliper. In addition, 10 midguts dissected from the locusts in day 3 after injected with LmCHS2 dsRNA or GFP dsRNA were fixed in 4% paraformaldehyde at 4  C overnight to prepare paraffin sections as described in Section 2.7. Samples were stained with hematoxylin and eosin (H & E). Calcofluor White (Sigma, Germany) was used to detect chitin. Rehydrated samples were rinsed in phosphate-buffered saline (PBS; 20 mM KH2PO4, 20 mM NaH2PO4, 0.15 M NaCl, buffered to pH 7.3), incubated for 90 min in PBS containing 0.01% (w/v) Calcofluor white (Sigma), 0.1% Triton-X 100 and 2% BSA and washed three times for 30 min with PBS. The fluorescence of Calcofluor was visualized using an Olympus BX51 fluorescence microscope. Photography was taken with an OLYMPUS digital camera. The chitin content was also measured based on the method of Zhang and Zhu (2006). 3. Results 3.1. Characterization of LmCHS2 cDNA and deduced amino acid sequences An LmCHS2 cDNA fragment was obtained from Migratory Locust EST Database (accession number: LM_GL5_006268) and RACE-PCR was used to amplify the 50 and 30 -end regions of its full-length cDNA. By assembling the cDNA fragments from Locust EST Database and RACE-PCR, a full-length cDNA (GenBank accession number: JQ901491) of LmCHS2 was finally obtained. The LmCHS2 cDNA contains 5018 nucleotides consisting of an open reading frame of 4569 nucleotides, a 76-nucleotide 50 -untranslated region (UTR) and a 373-nucleotide 30 -UTR. The encoded protein contains

X. Liu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 902e910

1523 amino acids with calculated molecular mass (MM) of about 174 kDa and isoelectric point (pI) of 6.65. Like other CHSs, LmCHS2 was predicted to contain three domains, including an N-terminal domain (residues 1e544) with 7 transmembrane helices, a putative catalytic domain (residues 545e881) in the middle showing high

905

sequence identity with those from other insects, and a C-terminal domain (residues 882e1523) with additional 7 transmembrane helices (Fig. 1). The signature sequences (QRRRW and EDR) for chitin synthases, were also found in LmCHS2. Five potential Nglycosylation sites were predicted using NetNGlyc 1.0 software

Fig. 1. Nucleotide and deduced amino acid sequences of LmCHS2 cDNA from Locusta migratoria. The numbers on the right are for the deduced amino acid sequence. The stop codon (TAA) is indicated in *. The putative polyadenylation signals (AATAAA) are underlined. The putative transmembrane segments predicted by TMHMM Server v. 2.0 are shaded gray. The five potential N-glycosylation sites by PROSCAN are boxed. The amino acid sequence of the putative catalytic domain is in white with black background. The signature sequences (EDR and QRRRW), which are suggested to be involved in catalytic function, are in white with blue background. The sequences have been deposited in GenBank (accession number: JQ901491). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

X. Liu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 902e910

from the ExPASy Proteomics website. These N-glycosylation sites are distributed throughout the sequence, suggesting that the protein is glycosylated. 3.2. Phylogenetic analysis of CHS2 A phylogenetic tree was generated using MEGA 4 after the fulllength amino acid sequences of all known insect CHSs were aligned using ClustalW (Fig. 2). Insect CHSs can be grouped into two classes, CHS1 and CHS2. The CHS that was derived from our locust cDNA analysis belongs to CHS2 (i.e., LmCHS2). LmCHS2 has the highest identity (47%) to the coleopteran T. castaneum CHS2 based on deduced amino acid sequences.

180

Relative expression (fold)

906

a

150 120 90 60 30 b

3.3. Tissue-specific expression patterns of LmCHS2 qPCR was carried out to analyze the expression patterns of LmCHS2 in different tissues of fifth-instar nymphs. Our results showed that the transcript of LmCHS2 was specifically expressed in midgut and gastric caeca (a part of the midgut) and no detectable expression in integument, foregut, hindgut, Malpighian tubules, fatbodies, muscle, wings and trachea (Fig. 3).

a

0 IN

b

b

b

b

b

b

FG MG HG GC MT FB MU WI

b TR

Fig. 3. qPCR analysis of tissue-dependent expression of LmCHS2 in fifth-instar nymphs (day 1). The constitutively expressed b-actin gene was used as internal control. The tissues include integument (IN), foregut (FG), midgut (MG), hindgut (HG), gastric caeca (GC), Malpighian tubules (MT), fatbodies (FB), muscle (MU), wing (WI) and trachea (TR). Data are expressed as means  SD of three biological replications. The data of tissue-dependent expression are shown as fold changes as compared with the tissue showing the lowest expression which is ascribed an arbitrary value of 1. Different letters on the bars of the histogram indicate statistically significant difference (P < 0.05, Fisher’s LSD test; n ¼ 3).

3.4. Expression patterns of LmCHS2 in different regions of midgut Our qPCR analysis of the anterior, median, and posterior regions of the midgut showed the highest expression level of LmCHS2 in the anterior midgut but with a decline from the anterior to the posterior regions (Fig. 4). The decreased expression was drastic from the anterior to the posterior regions of the midgut. 3.5. Developmental expression patterns of LmCHS2 The expression profiles of LmCHS2 during L. migratoria development were determined in eggs, midgut and gastric caeca

Fig. 2. Phylogenetic analysis of LmCHS1, LmCHS2 and other known insect CHSs. The tree was constructed based on the CHS amino acid sequences. Values at cluster branches indicate results of the boostrap analysis. CHSs are from Lucilia cuprina (Lc), Drosophila melanogaster (Dm), Drosophila pseudoobscura (Dp), Anopheles gambiae (Ag), Aedes aegypti (Aa), Anopheles quadrimaculatus (Aq), Manduca sexta (Ms), Spodoptera frugiperda (Sf), Spodoptera exigua (Se), Plutella xylostella (Px), Choristoneura fumiferana (Cf), Ostrinia furnacalis (Of), Ectropis oblique (Eo), Tribolium castaneum (Tc), Apis mellifera (Am), and Locusta migratoria (Lm). GenBank accession numbers are as follows: LcCHS1 (AAG09712), DmCHS1 (NP_524233), DmCHS2 (NP_524209), DpCHS1 (XP_001359390), DpCHS2 (XP_001352881), AgCHS1 (XP_321337), AgCHS2 (XP_321951), AaCHS1 (XP_001651163), AaCHS2 (EAT46081), AqCHS1 (ABD74441), MsCHS1 (AAL38051), MsCHS2 (AAX20091), SfCHS2 (AAS12599), SeCHS1 (AAZ03545), SeCHS2 (ABI96087), PxCHS1 (BAF47974), CfCHS1 (ACD84882.1), OfCHS1 (ACB13821), OfCHS2 (ABX46067), EoCHS1 (ACA50098), TcCHS1 (AAQ55059), TcCHS2 (AAQ55061), AmCHS1 (XP_395677), AmCHS2 (XP_001121152), LmCHS1 (GU067730) and LmCHS2 (JQ901491).

Relative expression (fold)

7 6

a

5 4

b

3 2 c 1 0 Anterior

Median

Posterior

The midgut of the 5th instar nymph Fig. 4. qPCR analysis of LmCHS2 transcript in different regions of midguts dissected from fifth-instar nymphs (day 1). The constitutively expressed b-actin gene was used as internal control. Data are expressed as means  SD of three biological replications. The data of LmCHS2 expression in different regions of the midgut are shown as fold changes as compared with the region showing the lowest expression which is ascribed an arbitrary value of 1. Different letters on the bars of the histogram indicate statistically significant difference (P < 0.05, Fisher’s LSD test; n ¼ 3).

X. Liu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 902e910

dissected from first, second, third, forth and fifth-instar nymphs and adults by using qPCR (Fig. 5). Our studies showed that LmCHS2 expression was not detected in eggs; however, LmCHS2 expression was found to gradually increase from first to fifth-instar nymphs, and reach the highest in the first day of adults. It appeared that LmCHS2 is expressed during the periods when locusts are actively feeding. 3.6. In situ hybridization In order to visualize the distribution of LmCHS2 transcript in gastric caeca, we performed in situ hybridization using paraffin section of gastric caeca of the fifth-instar nymph. Our results showed that LmCHS2 transcript was mainly detected in the apical regions of brush border forming columnar cells (Fig. 6) as compared with the control hybridization using digitonin-labeled sense RNA. 3.7. Functional analysis of LmCHS2 RNAi was performed using LmCHS2-specific dsRNA to reveal the function of LmCHS2 in L. migratoria development and molting. LmCHS2 or GFP dsRNA was synthesized in vitro and injected into fifth-instar nymphs (2 days old). As shown in Fig. 7A, only the targeted mRNA (LmCHS2) was greatly down-regulated and there was no significant decrease in the transcript level of the non-target gene (LmCHS1). These results indicate that our dsRNA-mediated gene silencing for LmCHS2 was gene-specific. In total of 40 fifthinstar nymphs injected with LmCHS2 dsRNA, 20 died before they developed into the adult stage, 10 molted to adults but finally died after 1e3 days, and 10 survived. The total mortality is 75%. However, no visible morphological change was observed in the locusts injected with the dsRNA of LmCHS2. However, when we examined the guts dissected from days 5, 6 and 7 of the fifth-instar nymphs (abbreviated as N5D5, N5D6 and N5D7) that were injected with LmCHS2 or GFP dsRNA, we found that the midguts that were dissected from the nymphs injected with dsRNA of LmCHS2 contained virtually no food, whereas the midguts of the control nymphs injected with dsRNA of GFP gene were completely full with food. Furthermore, the average length of the midguts from the control nymphs was 9.0  1.5 mm (n ¼ 30),

Relative expression (fold)

100 a

80 ab

60

a

ab

bc 40

c

20

0

d EG

N1

N2

N3

N4

N5

AD

Fig. 5. qPCR analysis of LmCHS2 transcript in eggs (EG); first- (N1), second- (N2), third(N3), forth- (N4) and fifth-instar (N5) nymphs; and adults (AD) of L. migratoria. The constitutively expressed b-actin gene was used as internal control. Data are expressed as means  SD of three biological replications. Mean expression in each stage is shown as fold change as compared with the stage showing the lowest expression which was ascribed an arbitrary value of 1. Different letters on the bars of the histogram indicate statistically significant difference (P < 0.05, Fisher’s LSD test; n ¼ 3).

907

whereas the average length of the midguts from the LmCHS2 dsRNA-injected nymphs was only 4.5  0.5 mm (n ¼ 30), representing a 50% reduction (P < 0.001, Student’s t test) in the length of the midguts when the expression of LmCHS2 was suppressed by RNAi. Furthermore, the gastric caeca was smaller in the LmCHS2 dsRNA-injected nymphs than those of the control nymphs (Fig. 7B). Because our results of tissue-specific expression patterns indicated that LmCHS2 was specifically expressed in the midgut and gastric caeca, the high mortality associated with the decrease in the LmCHS2 transcript level apparently was due to a reduction of chitin biosynthesis in the midgut after fifth-instar nymphs were injected with LmCHS2 dsRNA. To test this hypothesis, we analyzed the influence of the gene silencing for LmCHS2 on the PM formation. The midgut paraffin sections were prepared from the nymphs three days after the injection of LmCHS2 or GFP dsRNA. The sections were stained with hematoxylin and eosin (H & E) or Calcofluor White. We found that the midguts from the control nymphs injected with GFP dsRNA contained a fully developed PM. The PM appeared to be well structured, clearly separating the food from the epithelial cells. In contrast, the midguts from the nymphs injected with LmCHS2 dsRNA showed a disrupted structure of PM and contained little food. In some of these nymphs, the PM was even invisible, suggesting a possible loss of PM or significantly reduced PM (Fig. 7C). 4. Discussion In the past decade, research has made some significant advances in better understanding of chitin synthases in insects, particularly through molecular cloning and functional analyses in several insect orders such as Diptera, Lepidoptera, Coleoptera, Orthoptera and Hymenoptera (Zhang et al., 2010a, 2012). To date, various insect species are known to possess two different chitin synthases, CHS1 and CHS2, which are mainly responsible for the syntheses of chitin associated with the cuticular exoskeleton and tracheae, and that associated with PM that underlies the epithelial cells of the midgut, respectively (Shao et al., 2001). However, relatively little information is available about the PM chitin synthesis in insects. We previously reported molecular characteristics of the chitin synthase 1 gene (LmCHS1) from hemimetabolous insect, L. migratoria (Zhang et al., 2010a). In this paper, we report the fulllength cDNA sequence of a new chitin synthase from the same insect species. Based on our phylogenetic analysis of all known insect chitin synthases, the chitin synthase gene that we revealed from this study was classified to CHS Group 2. Therefore, we designated this gene as LmCHS2. LmCHS2 is relatively shorter than LmCHS1 and encodes a protein with a predicted pI of 6.65. The slightly more acidic pI than the predicted pI of 6.89 for LmCHS1 is conducive to its function in the PM. Like other chitin synthases, LmCHS2 is a large (174 kDa) and complex transmembrane protein characterized by multiple transmembrane segments. In Manduca sexta, purification of MsCHS2 from the larval midgut revealed a trimeric chitin synthase complex (Maue et al., 2009). Hence, the ability to form oligomers may facilitate the formation of pores in the membrane through which the nascent chitin polymers are translocated. The isolation of LmCHS2 cDNA provided us with an opportunity to study the expression patterns and biological functions in L. migratoria. LmCHS2 was specifically expressed in the midgut and gastric caeca (Fig. 3), and such an expression pattern is consistent with those of class 2 chitin synthase genes of other insect species including Drosophila melanogaster (Gagou et al., 2002), M. sexta (Hogenkamp et al., 2005), T. castaneum (Arakane et al., 2004), Ostrinia furnacali (Qu et al., 2011), Spodoptera exigua (Kumar et al., 2008) and Spodoptera frugiperda (Bolognesi et al., 2005). Such an expression pattern is also in agreement with the hypothesis that

908

X. Liu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 902e910

A

A'

Sense-CHS2

100

250

B'

B Anti-CHS2

100

250

Fig. 6. Localization of LmCHS2 transcript in gastric caeca of fifth-instar nymph of L. migratoria. In situ hybridization of the paraffin sections of the gastric caeca was performed with a digoxigenin-labeled antisense RNA probe that was complementary to a part of the LmCHS2 coding region. The arrow indicates the localization of LmCHS2 transcript. (A) and (A0 ) show the results of hybridization by using the sense probe of LmCHS2; (B) and (B0 ) show the results of hybridization by using the anti-sense probe of LmCHS2.

LmCHS2 is responsible for biosynthesis of the PM-associated chitin in the midgut. It has been known that gastric caeca are connected to the foregut and a supplementary structure of midgut to increase the surface area for digestion as well as nutrient absorption (Akpan and Okorie, 2003). Therefore, LmCHS2 mRNA found in the gastric caeca is likely to serve the same function as that found in the midgut. Our qPCR analysis clearly demonstrated that LmCHS2 was highly expressed in the anterior midgut, but tapered off in the median and posterior parts of the midgut. A similar result was also observed for MsCHS2 in M. sexta as evaluated by northern blot and RT-PCR analysis (Hogenkamp et al., 2005). Our results indicated that L. migratoria has Type I PM; however, the anterior midgut may play a more important role in chitin biosynthesis than the rest of the midgut. To further localize LmCHS2 transcript in gastric caeca, in situ hybridization of the paraffin sections of gastric caeca from fifthinstar nymphs was performed using a digoxigenin-labeled antisense RNA probe that was complementary to a specific region of the LmCHS2 cDNA. The transcript of LmCHS2 was localized in the apical regions of brush border forming columnar cells with strong signals, whereas the hybridization in the controls using digitonin-labeled sense RNA showed little signals (Fig. 6). In M. sexta, MsCSH2 transcript was enriched in the cytoplasm of columnar cells (Zimoch and Merzendorfer, 2002). We further examined stage-dependent expression patterns of LmCHS2 transcript from eggs to adults by qPCR. Because LmCHS2 is specifically expressed in the midgut and gastric caeca, we used these two tissues for our analysis. As demonstrated in Fig. 5, LmCHS2 was expressed throughout the feeding stages of nymphs and adults. By contrast, no detectable expression was found in eggs. L. migratoria is a typical hemimetabolous insect that develops from egg to nymph and then directly to adult without going through an intermediate pupal stage. In holemetabolous insects like D. melanogaster (Gagou et al., 2002), M. sexta (Hogenkamp et al., 2005), T. castaneum (Arakane et al., 2004), O. furnacali (Qu et al., 2011), S. exigua (Kumar et al., 2008) and S. frugiperda (Bolognesi et al., 2005), CHS2 mRNA was expressed in the course of the intermolt stages. However, in phases of starvation during the instar molt or the

prepupal wandering stage, CHS2 mRNA is down-regulated. In the mosquito Aedes aegypti, in situ hybridization of the midgut samples showed that AaCHS2 mRNA increased following a blood meal (Ibrahim et al., 2000). Through these studies, it is clear that CHS2 mRNA levels gradually increased with the food demanding to form PM surrounding the food bolus. In this study, we revealed the role of LmCHS2 in insect development by using RNAi. As shown in Fig. 7A, the injection of dsRNA of LmCHS2 substantially suppressed the level of LmCHS2 transcript without significant effect on the level of LmCHS1 transcript. The RNAi-mediated suppression of LmCHS2 transcript ultimately resulted in a high mortality of the insect. Such mortality was apparently caused by the starvation due to reduced chitin biosynthesis, which is strongly supported by our several findings. First, the length of midguts dissected from the nymphs on days 5, 6 and 7 after the injection of LmCHS2 dsRNA was significantly reduced as compared with those of the control nymphs injected with GFP dsRNA. Secondly, the size of the gastric caeca dissected from the nymphs injected with LmCHS2 dsRNA was also significantly reduced. Thirdly, the PM of the LmCHS2 dsRNA-injected nymphs appeared amorphous and thin as compared with the controls. In some individuals, the PM was even absent. Fourthly, the chitin content of the midguts dissected from LmCHS2 dsRNA-injected nymphs was below the limit of detection in our chitin content assay (data not shown). In contrast, chitin content in the midguts from the control nymphs can be easily detected (0.012 mg/midgut). Finally, a more direct evidence was that the midguts dissected from the nymphs injected with LmCHS2 dsRNA virtually contained no food. All these results support our notion that RNAi-mediated suppression of LmCHS2 transcript leads to a reduced biosynthesis of chitin to form the PM in the midgut. The loss of the PM or the PM with disrupted structure due to insufficient chitin contents ultimately affects insect feeding. Thus, the integrity of the PM is critical for maintaining normal physiological function for insect growth and development as observed in other insect species (Khajuria et al., 2010). Our findings are consistent with the results from T. castaneum. Larvals treated with TcCHS2 dsRNA exhibited little or no chitin in their PM and a dramatic shrinkage in larval size due to

X. Liu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 902e910

909

dsGFP

Relative expression (fold)

LmCHS1

NS

6 5 4

NS

3

NS

2 1 0

N5D5

N5D6

N5D7

Relative expression (fold)

dsCHS2

A

LmCHS2 2

*

* *

1.5 1 0.5 0

N5D5

N5D6

N5D7

B

Gc Py

Mg

10 mm dsGFP

dsCHS2

dsCHS2

dsGFP

N5D5

N5D6

dsGFP

dsCHS2

N5D7

C

PM

dsGFP 100

250

dsCHS2

100

250

Fig. 7. Effect of LmCHS2 dsRNA injected into fifth-instar nymphs on day 2 on the transcript levels of two LmCHS genes and development of L. migratoria. (A) Analysis of relative transcript levels of LmCHS2 and LmCHS1 after LmCHS2 dsRNA injection on days 5, 6 and 7 of fifth-instar nymphs (abbreviated as N5D5, N5D6 and N5D7) using qPCR. Control insects were injected with equivalent amount of GFP dsRNA. b-actin gene was used as internal control. Data are shown as means  SD from three independent experiments. * shows a significant difference between the nymphs injected with LmCHS2 dsRNA and those injected with GFP dsRNA (P < 0.05, T-test); NS indicates no significant difference between the two groups. (B) The change of midgut and gastric caeca after the injection of LmCHS2 dsRNA in fifth-instar nymphs on days 5, 6 and 7. The arrows show gastric caeca (Gc), pylorus (Py) and midgut (Mg). (C) Effect of the injection of LmCHS2 dsRNA on the formation of peritrophic matrix (PM) in nymphs 3 days after the injections by showing the hematoxylin and eosin (H & E) stained midguts from nymphs injected with LmCHS1 dsRNA and GFP dsRNA. The arrow shows the PM of the midgut from a control insect with fully formed PM lining the midgut lumen. However, there was no PM formation in the midgut from the insect injected with LmCHS2 dsRNA.

the cession of feeding (Arakane et al., 2005, 2008). In Ae. aegypti and An. gambiae, the PM is disrupted when the levels of CHS2 transcripts are suppressed. Such a PM disruption often leads to insect mortality or increased susceptibility to chemical insecticides (Kato et al., 2006; Zhang et al., 2010a). In addition, insect CHS2 also

play other important roles as reported in several insect species. For example, TcCHS2 played important roles during embryonic and adult development in the red flour beetle. Specifically, the female beetles injected with TcCHS2 dsRNA are not able to lay their eggs (Arakane et al., 2008).

910

X. Liu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 902e910

Recently, transgenic plants engineered to produce hairpin dsRNAs in vivo have been reported for protecting the plants from the feeding damage of herbivorous insects (Baum et al., 2007; Gordon and Waterhouse, 2007; Mao et al., 2007). However, identification of a suitable gene for transgenic RNAi plants is important, as Baum et al. (2007) observed, not all dsRNAs may effectively suppress the expression of target genes, and not all dsRNAs are effective in killing insects. Nevertheless, our results suggest that LmCHS2 could serve as a good candidate gene for developing RNAibased technologies for locust control due to the sequence specificity of LmCHS2 dsRNA coupled with its ability to suppress the gene critical for insect survival. Because chitin biosynthesis is absent in higher animals and LmCHS2 is critically important for maintaining the integrity of PM in insects, results from this study are expected to help researchers develop effective and environmentally friendly strategies for insect pest control by attacking chitin biosynthesis in insects. Acknowledgments This work was supported by National Basic Research Program of China (2012CB114102), National Natural Science Foundation of China (Grant No. 30970410), International Cooperation and Exchange Program (30810103907), Science and Technology Research Project of Shanxi Province (20110311010), Program for Top Young Academic Leaders of Higher Learning Institutions of Shanxi (TYAL), China Postdoctoral Science Foundation (Grant No. 20100480642 and 201104297) and Shanghai Postdoctoral Science Foundation (Grant No. >11R21417300). References Akpan, B.E., Okorie, T.G., 2003. Allometric growth and performance of the gastric caeca of Zonocerus variegatus (L.) (Orthoptera: Pyrgomorphidae). Acta Entomol. Sinica 46, 558e566. Arakane, Y., Hogenkamp, D.G., Zhu, Y.C., Kramer, K.J., Specht, C.A., Beeman, R.W., Kanost, M.R., Muthukrishnan, S., 2004. Characterization of two chitin synthase genes of the red flour beetle, Tribolium castaneum, and alternate exon usage in one of the genes during development. Insect Biochem. Mol. Biol. 34, 291e304. Arakane, Y., Muthukrishnan, S., Kramer, K.J., Specht, C.A., Tomoyasu, Y., Lorenzen, M.D., Kanost, M., Beeman, R.W., 2005. The Tribolium chitin synthase genes TcCHS1 and TcCHS2 are specialized for synthesis of epidermal cuticle and midgut peritrophic matrix. Insect Mol. Biol. 14, 453e463. Arakane, Y., Specht, C.A., Kramer, K.J., Muthukrishnan, S., Beeman, R.W., 2008. Chitin synthases are required for survival, fecundity and egg hatch in the red flour beetle, Tribolium castaneum. Insect Biochem. Mol. Biol. 38, 959e962. Baum, J., Bogaert, T., Clinton, W., Heck, G., Feldmann, P., Ilagan, O., Johnson, S., Plaetinck, G., Munyikwa, T., Pleau, M., Vaughn, T., Roberts, J., 2007. Control of coleopteran insect pests through RNA interference. Nat. Biotechnol. 25, 1322e1326. Bolognesi, R., Arakane, Y., Muthukrishnan, S., Kramer, K.J., Terra, W.R., Ferreira, C., 2005. Sequences of cDNAs and expression of genes encoding chitin synthase and chitinase in the midgut of Spodoptera frugiperda. Insect Biochem. Mol. Biol. 35, 1249e1259. Cohen, E., 2001. Chitin synthesis and inhibition: a revisit. Pest Manage. Sci. 57, 946e950.

Gagou, M.E., Kapsetaki, M., Turberg, A., Kafetzopoulos, D., 2002. Stage-specific expression of the chitin synthase DmeChSA and DmeChSB genes during the onset of Drosophila metamorphosis. Insect Biochem. Mol. Biol. 32, 141e146. Gordon, K.H.J., Waterhouse, P.M., 2007. RNAi for insect-proof plants. Nat. Biotechnol. 25, 1231e1232. Hegedus, D., Erlandson, M., Gillott, C., Toprak, U., 2009. New insights into peritrophic matrix synthesis, architecture, and function. Annu. Rev. Entomol. 54, 285e302. Hogenkamp, D.G., Arakane, Y., Zimoch, L., Merzendorfer, H., Kramer, K.J., Beeman, R.W., Kanost, M.R., Specht, C.A., Muthukrishnan, S., 2005. Chitin synthase genes in Manduca sexta: characterization of a gut-specific transcript and differential tissue expression of alternately spliced mRNAs during development. Insect Biochem. Mol. Biol. 35, 529e540. Ibrahim, G.H., Smartt, C.T., Kiley, L.M., Christensen, B.M., 2000. Cloning and characterization of a chitin synthase cDNA from the mosquito Aedes aegypti. Insect Biochem. Mol. Biol. 30, 1213e1222. Kato, N., Mueller, C.R., Fuchs, J.F., Wessely, V., Lan, Q., Christensen, B.M., 2006. Regulatory mechanisms of chitin biosynthesis and roles of chitin in peritrophic matrix formation in the midgut of adult Aedes aegypti. Insect Biochem. Mol. Biol. 36, 1e9. Khajuria, C., Buschman, L.L., Chen, M.S., Muthukrishnan, S., Zhu, K.Y., 2010. A gutspecific chitinase gene essential for regulation of chitin content of peritrophic matrix and growth of Ostrinia nubilalis larvae. Insect Biochem. Mol. Biol. 40, 621e629. Kumar, N.S., Tang, B., Chen, X., Tian, H., Zhang, W., 2008. Molecular cloning, expression pattern and comparative analysis of chitin synthase gene B in Spodoptera exigua. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 149, 447e453. Mao, Y., Cai, W., Wang, J., Hong, G., Tao, X., Wang, L., Huang, Y., Chen, X., 2007. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotechnol. 25, 1307e1313. Maue, L., Meissne, D., Merzendorfer, H., 2009. Purification of an active, oligomeric chitin synthase complex from the midgut of the tobacco hornworm. Insect Biochem. Mol. Biol. 39l, 654e659. Merzendorfer, H., 2006. Insect chitin synthases: a review. J. Comp. Physiol. B 176, 1e16. Merzendorfer, H., Zimoch, L., 2003. Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases. J. Exp. Biol. 206, 4393e4412. Qu, M., Liu, T., Yang, J., Yang, Q., 2011. The gene, expression pattern and subcellular localization of chitin synthase B from the insect Ostrinia furnacalis. Biochem. Biophys. Res. Commun. 404, 302e307. Shao, L., Devenport, M., Jacobs-Lorena, M., 2001. The peritrophic matrix of hematophagous insects. Arch. Insect Biochem. Physiol. 47, 119e125. Terra, W.R., 2001. The origin and functions of the insect peritrophic membrane and peritrophic gel. Arch. Insect Biochem. Physiol. 46, 47e61. Wang, P., Granados, R.R., 2001. Molecular structure of the peritrophic membrane (PM): identification of potential PM target sites for insect control. Arch. Insect Biochem. Physiol. 47, 110e118. Zhang, J.Z., Liu, X.J., Zhang, J.Q., Li, D.Q., Sun, Yi., Guo, Y.P., Ma, E.B., Zhu, K.Y., 2010a. Silencing of two alternative splicing-derived mRNA variants of chitin synthase 1 gene by RNAi is lethal to the oriental migratory locust. Insect Biochem. Mol. Biol. 40, 824e833. Zhang, X., Zhang, J.Z., Zhu, K.Y., 2010b. Chitosan/double-stranded RNA nanoparticlemediated RNA interference to silence chitin synthase genes through larval feeding in the African malaria mosquito (Anopheles gambiae). Insect Mol. Biol. 19, 683e693. Zhang, X., Zhang, J., Park, Y., Zhu, K.Y., 2012. Identification and characterization of two chitin synthase genes in African malaria mosquito, Anopheles gambiae. Insect Biochem. Mol. Biol. 42, 674e682. Zhang, J.Z., Zhu, K.Y., 2006. Characterization of a chitin synthase cDNA and its increased mRNA level associated with decreased chitin synthesis in Anopheles quadrimaculatus exposed to diflubenzuron. Insect Biochem. Mol. Biol. 36, 712e725. Zimoch, L., Merzendorfer, H., 2002. Immunolocalization of chitin synthase in the tobacco hornworm. Cell. Tissue Res. 308, 287e297.