Characterization of a new periplasmic single-domain rhodanese encoded by a sulfur-regulated gene in a hyperthermophilic bacterium Aquifex aeolicus

Biochimie 92 (2010) 388e397

Contents lists available at ScienceDirect

Biochimie journal homepage: www.elsevier.com/locate/biochi

Research paper

Characterization of a new periplasmic single-domain rhodanese encoded by a sulfur-regulated gene in a hyperthermophilic bacterium Aquifex aeolicus Marie-Cécile Giuliani a,1, Cécile Jourlin-Castelli b, Gisèle Leroy a, Aderrahman Hachani c, d, Marie Thérèse Giudici-Orticoni a, * a

Laboratoire de Bioénergétique et Ingénierie des Protéines (BIP), IMM-CNRS, 31 chemin Joseph Aiguier, 13402 Marseille cedex 20, France Laboratoire de Chimie Bactérienne (LCB), IMM-CNRS, 31 chemin Joseph Aiguier, 13402 Marseille cedex 20, France Laboratoire d'Ingénierie des Systèmes Macromoléculaires (LISM), IMM-CNRS, 31 chemin Joseph Aiguier, 13402 Marseille cedex 20, France d Imperial College London, Division of Cell and Molecular Biology, Center for Molecular Microbiology and Infection, South Kensington Campus, Flowers Building, SW7 2AZ London, United Kingdom b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 3 July 2009 Accepted 22 December 2009 Available online 8 January 2010

Rhodaneses (thiosulfate cyanide sulfurtransferases) are enzymes involved in the production of the sulfur in sulfane form, which has been suggested to be the relevant biologically active sulfur species. Rhodanese domains occur in the three major domains of life. We have characterized a new periplasmic singledomain rhodanese from a hyperthermophile bacterium, Aquifex aeolicus, with thiosulfate:cyanide transferase activity, Aq-1599. The oligomeric organization of the enzyme is stabilized by a disulfide bridge. To date this is the first characterization from a hyperthermophilic bacterium of a periplasmic sulfurtransferase with a disulfide bridge. The aq-1599 gene belongs to an operon that also contains a gene for a prepilin peptidase and that is up-regulated when sulfur is used as electron acceptor. Finally, we have observed a sulfur-dependent bacterial adherence linked to an absence of flagellin suggesting a possible role for sulfur detection by A. aeolicus. Ó 2009 Elsevier Masson SAS. All rights reserved.

Keywords: Aquifex aeolicus Sulfurtransferase Hyperthermophile

1. Introduction Sulfur adds considerable functionality to a wide variety of biomolecules because its chemical bonds can be made and broken easily, and it serves both as an electrophile and as a nucleophile [1,2]. For incorporation into biomolecules, sulfur must be reduced and/or activated. The activated form of sulfur, the ‘sulfane sulfur’ (RS-SH), is produced enzymatically with cysteine desulfurases like the IscS and the SufS proteins and rhodanese being the most prominent biocatalysts [2]. Rhodaneses (thiosulfate:cyanide sulfurtransferase or TSTs) are ubiquitous enzymes found in many organisms from all three domains of life [3]. They catalyze the transfer of a sulfane sulfur. Thiosulfate is generally used as a substrate for rhodaneses in vitro assays, and cyanide is used as a sulfur acceptor to regenerate the covalent catalytic cysteinyl residue (Eqs. (1a) and (1b)): Abbreviations: MST, bmercaptopyruvate sulfurtransferase; DTT, dithiotreitol; ST, sulfurtransferase; TST, thiosulfate sulfurtransferase; Rho, rhodanese; Sud, sulfide dehydrogenase. * Corresponding author. Tel.: þ33 4 91 16 45 50; fax: þ33 4 91 16 45 78. E-mail address: [email protected] (M. Thérèse Giudici-Orticoni). 1 Laboratoire de Biochimie et Biologie moléculaire du végétal, UMR CNRS 6134 SPE, Université de Corse, Campus Grimaldi, BP 52, 20250 Corte, France. 0300-9084/$ e see front matter Ó 2009 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.biochi.2009.12.013

2
SSO2
3 þ Rho
SH/SO3 þ Rho
S
SH;

(1a)

Rho
S
SH þ CN
/Rho
SH þ SCN


(1b)

There are two classes of sulfurtransferases distinguished according the nature of the donor: thiosulfate sulfurtransferase (TST; E.C.2.8.1.1) and mercaptopyruvate sulfurtransferase (MST; E.C.2.8.1.2) [3]. At present, the best characterized rhodanese is the two-domain sulfurtransferase from bovine liver that catalyses in vitro sulfur transfer from thiosulfate to cyanide, forming thiocyanate and sulfite [4,5]. In spite of numerous studies, the physiological role of rhodaneses remains unclear and is still widely debated as the in vivo substrates have not been identified [6e11]. The difficulties in establishing the functions in vivo lie in the multiplicity of modules and activities [3]. Besides the two-domain rhodaneses, single-domain versions are known [12e14], with the Escherichia coli GlpE protein as the prototype [13,14]. Characterization of the single-domain rhodaneses indicates that the N-terminal domain in the two-domain rhodaneses is not essential for catalysis. In addition, characterization of the sulfide dehydrogenase (Sud) from a mesophilic bacterium, Wolinella succinogenes, revealed a direct intervention of

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

rhodanese in energetic sulfur metabolism, as this protein is the sulfur donor for the terminal acceptor of respiratory chain, the sulfur reductase [15,16]. Even though the discovery of the hyperthermophiles has important implications, not only in microbial physiology and evolution, but also in biotechnology, until now only one rhodanese has been characterized from these extremophilic organisms [17]. Microorganisms able to grow at temperatures near and above 100  C have been isolated from shallow submarine and deep-sea volcanic environments over the last 20 years. Most of these hyperthermophilic microorganisms are Archaea and, considered to represent the most slowly evolving forms of life [18e21]. Numerous hyperthermophilic Archaea are known, but only very few hyperthermophilic Bacteria have been discovered so far. The most hyperthermophilic bacteria known to date are members of the genus Aquifex and grow at optimal temperatures of 85  C [19,21]. Aquifex is a hyperthermophilic, hydrogen-oxidizing, microaerophilic, obligate chemolithoautotrophic bacterium. It gains energy for growth from hydrogen, oxygen and sulfur (thiosulfate or elemental sulfur), and uses the reductive TCA cycle for fixing CO2 [17,22]. Two rhodanese genes, rhdA1 and rhdA2 are annotated in the Aquifex aeolicus genome which has been completely sequenced [23]. Both encode proteins in the two-domain family of rhodaneses. Recently, we have characterized the first single-domain sulfurtransferase from A. aeolicus, Aq-477 [17]. To date this is the only enzyme where the use of different sulfur donors has been demonstrated, in vitro, since Sud, a sulfurtransferase from W. succinogenes, is inactive with thiosulfate [15] and polysulfide sulfurtransferase activity of GlpE from E. coli has not been demonstrated [13]. We have proposed that aq-477 encodes a homo-tetrameric cytoplasmic rhodanese with polysulfide sulfurtransferase activity and we have therefore renamed this gene rhdB1. Here, we describe the identification, purification, and biochemical characterization of a third rhodanese that is a new singledomain rhodanese in A. aeolicus which was not identified by the annotation of the genome. We demonstrate that, the expression of this protein is associated with a shift from planktonic lifestyle to an adherent behaviour and depends of the sulfur source. The results bring to light some particularities of the protein, which could be linked to the necessity for extremophiles to develop mechanisms of adaptation to extreme conditions to detect their physiological substrate. 2. Materials and methods 2.1. Growth conditions and purification of Aq-1599 A. aeolicus was cultivated in 2-liter bottles under 1.4 bars of H2/CO2 (80/20) in SME medium modified according to Giuliani et al. [17] at pH 6.8 in the presence of S (7.5 g/l) and harvested in the late exponential growth phase by centrifugation (30 min at 3700 g, 4  C). Periplasmic extraction was done according to Brugna et al. [24]. Lactate dehydrogenase activity was measured to test potential cytoplasmic contaminants. After dialysis the supernatant was loaded onto an S-Sepharose column (FPLC) equilibrated in 50 mM TriseHCl (pH 7.6). Rhodanese activity was detected in the effluent. This fraction was then loaded onto a hydroxyapatite HA column (2  12 cm, biogel, BIORAD) equilibrated in 50 mM TriseHCl (pH 7.6). The column was washed with the same buffer, and proteins were then eluted with a 50 mM-step 0e1 M gradient of potassium phosphate. The 500 mM phosphate fraction was concentrated using Centriprep concentrators (Amicon) with YM-10 membranes and loaded on Superose 12 high resolution column (FPLC apparatus, Amersham Pharmacia Biotech) equilibrated in 50 mM TriseHCl 50 mM NaCl

389

pH 7.6 (0.3 ml/min). Active fractions were concentrated and frozen in liquid nitrogen. All steps were performed at room temperature. 2.2. Sulfurtransferase activity assays All buffers used for activity assays were pre-incubated under argon, all assays were done at 80  C. One unit of ST activity corresponds to the production of 1 mmol of thiocyanate or H2S per minute. 2.2.1. Thiosulfate:cyanide sulfurtransferase activity þ CN
:SCN
þ SO2
(S2O2
3 3 ) was determined by measuring
SCN formation as the red Fe(SCN)3 complex from cyanide and thiosulfate [15]. The reaction mixture contained 100 mM TriseHCl, pH 9.0, 10 mM KCN, and enzyme extract and was initiated by addition of 10 mM Na2S2O3. This was done in the presence and in absence of 2.5 mM DTT. After incubation at 85  C for 10 min the reaction was stopped by addition of 200 ml acidic iron reagent (FeCl3, 50 g l
1; 65% HNO3, 200 ml l
1). After centrifugation at 13 000 g for 3 min, the absorption was read at 460 nm. Spontaneous rates of thiocyanate formation were determined by omitting the enzyme from the reaction mixture. Amounts of product formation were quantified using a standard curve done with NaSCN. A test without enzyme was done as control. Na2S2O3 stability at 80  C and linearity of SCN
production up to 20 min has been verified. The final concentration of Aq-1599 was 35 nM. 2.2.2. 3-mercaptopyruvate:cyanide sulfurtransferase activity (HSCH2COCOO
þ CN
:CH3COCOO
þ CNS
). The assay mixture consisted of 100 mM TriseHCl, pH 9.0, 10 mM KCN, 2.5 mM DTT and enzyme extract and was initiated by addition of 5 mM 3-mercaptopyruvate. Assays were incubated and treated as described above. The final concentration of Aq-1599 was 35 nM. 2.2.3. Thiosulfate:borohydride reductase activity 2

þ BH
þ BH3). Assay mixtures of 1 ml (S2O2
3 4 :HS þ SO3 contained 100 mM TriseHCl, pH 9, 2.5 mM DTT and protein extracts as stated above, and were started by adding 200 mM Na2S2O3 as described in Papenbrock and Schmidt [25]. Reactions were incubated for 20 min at 37  C. The amount of H2S developed during the reaction was fixed by adding 100 ml 30 mM FeCl3 solved in 1.2 M HCl and 100 ml 20 mM NN'-dimethyl-p-phenylenediamine solved in 7.2 M HCl. Samples were kept in the dark for 20 min, centrifuged and the absorption of methylene blue formed was measured at 670 nm. For quantification, standard curves were prepared or the molar extinction coefficient of 15  106 cm
1 M
1 was used. The final concentration of Aq-1599 was 3 mM. One unit of ST activity corresponds to the production of 1 mmol of thiocyanate per minute. 2.2.4. Polysulfide sulfur:cyanide sulfurtransferase activity 2


(S2
n þ CN : SCN þ S(ne1)). Polysulfide sulfur was generated as described by Klimmeck et al. [15] and polysulfide assay was done following polysulfide consumption directly by measuring A360 (3 ¼ 0.38 mM
1 cm
1 polysulfide sulfur) at 60  C. No cyanide and DTT were added in the medium. The final concentration of Aq-1599 was 8 nM. 2.2.5. Polysulfide sulfur:borohydride reductase activity
2

(S2
n þ BH4 :HS þ Sne1 þ BH3). In this case NaBH4 (5 mM) replaced KCN in the mixture assay as described by Klimmek et al. [15]. H2S production was measured following polysulfide consumption directly by measuring A360 (3 ¼ 0.38 mM
1 cm
1) at 60  C. The final concentration of Aq-1599 was 1 mM.

390

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

2.2.6. Thioredoxin sulfurtransferase We have used an NADPH-coupled assay with thioredoxin reductase to show if reduced thioredoxin is an effective sulfur acceptor substrate for Aq-1599 as described in [13]. NADPH, thioredoxin and thioredoxin reductase stability has been verified at various temperatures. The system was not stable at 85  C, so the activity was measured at 50  C. Each assay (0.5 ml, final volume) contained 50 mM TriseHCl (pH 7.6), 0.25 U of thioredoxin reductase (Sigma) per ml, 100 mM NADPH, and 16 mM of thioredoxin. Cuvettes containing all reagents except NADPH were used as blanks. NADPH was added, and the reaction mixtures were allowed to equilibrate. Measurements of the absorbance at 340 nm were used to ensure that the mixtures had reached equilibrium. After equilibrium had been reached, purified Aq-1599 (160 nM), ammonium thiosulfate (30 mM), or both were added. The basis for this assay is that when thioredoxin, which contains the active site motif WCGPC, accepts a sulfane sulfur from rhodanese, a persulfide is formed at the N-terminal cysteine within the active site. The C-terminal cysteine within the active site then reacts with the persulfide, yielding sulfide and oxidized thioredoxin. Thioredoxin reductase acts to reduce the disulfide bond of oxidized thioredoxin 1, with the concomitant oxidation of NADPH. The decrease in absorbance at 340 nm was measured to determine the rate of NADPH oxidation. For steady state kinetics studies, thiosulfate was used as sulfur donor and cyanide as sulfur acceptor. The final concentration of Aq-1599 was 35 nM. Steady state kinetic measurements were fitted to the MichaeliseMenten equation using Sigma-Plot. 2.3. Fluorescence studies Fluorescence quenching was measured using a Cary Eclipse (Varian) using a right angle configuration, at 20  C by using 2.5-nm excitation and 10-nm emission bandwidths. The excitation wavelength was 285 nm and the emission spectra were measured between 290 and 500 nm. Binding samples contained 0.05 mg or 0.016 mg of oligomeric and dimeric Aq-1599 respectively in 100 mM TriseHCl buffer, pH 9.0; ligands were used at concentrations between 10 mM and 5 mM. In all experiments the final methanol concentration in the cuvette was kept below 1%. 2.4. Inhibition studies Inactivation of cysteine was done on purified Aq-1599 pretreated or not with 20 mM DTT, by incubation in 100 mM TriseHCl pH 7.6 with 20 mM iodoacetamide reagent at room temperature. Aliquots of Aq-1599 pre-treated with DTT were subjected to PD10 gel filtration to remove the DTT from the sample prior to iodoacetamide treatment. The remaining ST activity was determined as function of times and compared with that of Aq-1599 incubated without iodoacetamide. 2.5. SH group determination in Aq-1599 by Ellman analysis The number of the free thiols in Aq-1599 was determined by the Ellman DTNB assay [26]. Aliquots of Aq-1599 had been initially subjected to PD10 gel filtration to remove the DTT from the sample. 15 nmol of Aq-1599 were transferred into a quartz cuvette (1-cm length path) containing 0.1 M sodium phosphate buffer at pH 7.5 and 0.25 mM DTNB for a final volume of 1 ml. The reaction was followed spectrophotometrically at 25  C by a Varian spectrophotometer Cary 50. The increase in absorbance at 412 nm due to the release of the 2-nitro-5-thiobenzene anion (3412 ¼ 13.6  103 M
1 cm
1) was detected against a reference cuvette containing all reactants except the proteins.

2.6. N-terminal sequence determination The N-terminal amino acid sequences were determined from soluble protein or after SDS-PAGE. After electrophoresis on 12% polyacrylamide gel under denaturing conditions, proteins were transferred onto polyvinylidene difluoride (PVDF) membrane for 45 min at a current intensity of 0.8 mA/cm2 using a semi-dry electrophoretic transfer unit (BioRad). Sequence determinations were carried out with an Applied Biosystems Procise 494 microsequencer. Quantitative determination of phenylthiohydantoin derivates was done by high-pressure liquid chromatography (Water Associates, Inc) monitored by a data and chromatography control station (Waters). 2.7. Denaturing gel electrophoresis 1 mg of purified enzyme was incubated 3 min at 90  C with a sample loading buffer containing 2% SDS and 20 mM DTT and was loaded on a 4% polyacrylamide stacking/12% running SDS gel (MiniProtean II, BioRad) or on 12.5% polyacrylamide Phast Gels with SDS buffer strips (Pharmacia Phast System). After migration, the gel was stained as described previously [27]. 2.8. Immunoblotting After migration, Western blotting was done using standard procedures. Anti-RhdB1 antibodies against A. aeolicus RhdB1 or anti-FliC antibodies against Pseudomonas aeruginosa FliC were used and the detection reaction was performed using goat peroxidase conjugated anti-rabbit IgG (Sigma) and SuperSignal West Pico Chemiluminescent Substrate reagents (Pierce). 2.9. Adhesion assays on inert surfaces The bacterial adherence assay was done according to O'Toole and Kolter [28] with slight modifications. Glass tubes were first treated with 49% ethanol, 1% KOH, 50% H2O for 30 min at 50  C in order to generate negative charges. Then surfaces were treated by polyethyleneimine (PEI) to generate positive charges and facilitate the interaction between glass and sulfur compounds [29]. After washing with water, sulfur flower (from 5 to 10 mg) was immobilized on the surface and 1 ml of medium SME were added. The wells were inoculated with 108 bacterial cells from an overnight inoculum of A. aeolicus cultures obtained from S or Na2S2O3, and then put in bottles under H2/CO2 atmospheres at 85  C for 16e18 h. Bacterial cells bound to the wall of the wells were stained with crystal violet 1% (Sigma), and for quantification they were suspended in 400 ml of 95% ethanol followed by addition of 600 ml of water, and the OD590 was measured. All quantification assays were made in triplicate. The same experiments were done in presence of thiosulfate (from 2 to 5 mg). 2.10. Sequence Sequence alignments were performed using Clustal W [30]. Sequences were retrieved via the NCBI server (http://www.ncbi. nlm.nih.gov/). Motif searches were performed with PROSITE via the expasy server (http://an.expasy.org). The modelization of Aq-1599 was done as in [31,32] and using the sequence of Aq-1599. The polysulfide-sulfurtransferase homodimer from W. succinogenes structure (pdb entry 1QXN) was used as a template. The resulting theoretical model was displayed and analyzed with DeepView/Swiss-PdedViewer software.

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

2.11. RNA preparations A. aeolicus was cultivated either in the presence of S or in the presence of thiosulfate. Cells were harvested in the late exponential growth phase and an equal volume of RNAlater (Ambion) was immediately added in order to stabilize RNA. RNA were prepared using the High pure RNA isolation kit (Roche Diagnostics) with the slight following modifications: two DNase I digestion steps were done on columns in order to diminish the quantity of contaminating DNA and an additional step of DNase I treatment was done in solution with the RQ1 RNase-free DNase (Promega) between the two passages through columns. The integrity of RNA preparations was verified by electrophoresis on agarose gel. Absence of contaminating DNA was checked by PCR reaction. 2.12. Real-time quantitative RT-PCR The relative abundance of aq-1603, aq-1602, aq-1601 and aq1599 transcripts of A. aeolicus grown in the presence of S or thiosulfate was determined by real-time quantitative RT-PCR. 16S rRNA was used as a reference standard. Real-time RT-PCR was performed using the LightCycler instrument and the LightCycler-FastStar DNA Master SYBR Green I kit (Roche Diagnostic) according to the manufacturer's instructions. Total RNA, extracted from A. aeolicus grown in the presence of S or thiosulfate, was first reversed-transcribed using random hexamers and Superscript II reverse transcriptase (Invitrogen). The primer pairs used to quantify the aq-1603, aq1602, aq-1601, aq-1599 and 16S rRNA gene expression levels were aq1603-5 (50 TGAGTACAGAGGCGTTGACG 30 )/aq1603-6 (50 TCTTTCT GCCTTGACCTCGT 30 ), aq1602-1 (50 AAGTGGGGTGGTGAGTGAAG 30 )/ aq1602-2 (50 CAACGGAATATCCTGCAACC 30 ), aq1601-1 (50 AAGGGA AGGTGCAGACACTG 30 )/aq1601-2 (50 TAACGAGGAGTGCGGAAAAG 30 ), aq1599-1 (5’CGACAAGATGTTCAGCCAGA3’)/aq1599-2 (50 AGTC CCACGATGGATTGTTC 30 ) and 16S1 (50 CAGCTCGTGTCGTGAGATGT 30 )/16S2 (50 GGGCATAAAGGGCATACTGA 30 ), respectively. PCR assay parameters were one cycle at 95  C for 8 min followed by 40 cycles at 95  C for 10 s, 55  C for 6 s and 72  C for 8 s. Results were analyzed with the LightCycler software. Expression levels were normalized using the expression level of 16S rRNA. 2.13. RT-PCR The cDNA used as template for the real-time quantitative RT-PCR was also used as template for PCR amplification. The primer pairs used to determine if the aq-1603, aq-1602, aq-1601 and aq-1599 genes belong to the same transcriptional unit were aq1603-5/ aq1602-2, aq1602-1/aq1601-2 and aq1601-1/aq1599-2. PCR assay parameters were one cycle at 94  C for 2 min followed by 30 cycles at 94  C for 30 s, 55  C for 30 s and 72  C for 1 min. Amplification products were visualized after electrophoresis on agarose gel. 3. Results Sulfurtransferases are classically considered to be cytoplasmic proteins. However, a few periplasmic rhodaneses are known to date like Sud in W. succinogenes [15], phage shock protein PspE in E. coli [12] or P21 in Acidithiobacillus ferrooxidans [33]. We thus decided to investigate which protein might have sulfurtransferase activity in the periplasm of A. aeolicus. 3.1. Purification and identification of a new periplasmic sulfurtransferase We have detected thiosulfate:cyanide sulfurtransferase activity (951 units/mg) in periplasmic extract of A. aeolicus. The periplasmic

391

protein with ST activity was purified by S-Sepharose, hydroxyapatite, and Superose 12 or S200 chromatography, from the periplasmic fraction of A. aeolicus grown on H2/S0 medium. At the last step, ST activity was detected in two peaks. The first one corresponds to molecular mass higher than 60 kDa and the second to molecular mass of 35 kDa. N-terminal sequence determination of these fractions led to identify these peaks as containing one protein identified in A. aeolicus proteins database as Aq-1599. This protein, with a molecular mass deduced from the amino acid sequence of 14900 Da, is encoded by the aq-1599 gene. The product of aq-1599 purified from A. aeolicus can transfer sulfur from thiosulfate to cyanide. According to the sequence deduced from the gene, a signal peptide cleavage site is detected at position 23, which is in agreement with the purification of the protein from the periplasmic space of A. aeolicus. Aq-1599 was annotated as an “unknown function protein” in the published genome [23]. It is related as a member of COG0607P which regroups 168 rhodanese-related sulfurtransferases but no previous studies have been reported. All these homologues belong to a a/b fold protein domain found duplicated in the rhodanese proteins. Each protein from this family contains at least one cysteine residue that was found to be essential for the function of the protein [3]. Unlike classical two-domain rhodaneses, Aq-1599 is composed of a single-domain rhodanese fold, the catalytic domain, as it contains the characteristic catalytic cysteine (Cys 93). However, a second non conserved cysteine residue (Cys 26) is present in the N-terminal part of the protein. Only few single-domain rhodaneses have been characterized in detail. The primary sequence of Aq-1599 shows 31.6% identity with the cytoplasmic RhdB1 from A. aeolicus and smaller degrees of identity with the other single-domain proteins with known 3D structure ie: 23% with GlpE from E. coli [13], 21% with Sud from W. succinogenes [15], 28% with a TTHA0613 ORF from Thermus thermophilus [34] and 20.8% with At 5 g 66040 from Arabidopsis [35]. However, structural alignment shows the same global fold for all single-domain STs with a typical a/b topology (Fig. 1 A). The extension and location of the regular secondary structure elements approximately coincide in all these proteins. Particularly, the global fold of Aq-1599 seems more similar to Sud from W. succinogenes than to RhdB1 from A. aeolicus. A model of the tridimensional structure of Aq-1599 has been calculated with SWISS-MODEL protein modelling program using the structure of the SUD from W. succinogenes as a template (pdb entry 1QXN) [16] (Fig. 1B). The major similarities are the presence of the same extra a helix in Sud and Aq-1599 proteins which is absent in other one-domain ST and the same structural location for the catalytic cysteine. In a same way, the a6 helix is absent in thermo/hyperthermophile enzymes RhdB1 and TTHA0613 ORF from T. thermophilus but present in Aq-1599. 3.2. Oligomerization state of Aq-1599 Aq-1599 is purified as a protein with a molecular mass higher than 60 kDa, though the value deduced from the amino acid sequence is about 15 kDa. This suggests a possible oligomeric organization of Aq-1599. SDS-PAGE analysis of purified Aq-1599 revealed several bands corresponding to molecular masses of about 65, 30 and 18 kDa (Fig. 2A lane 1). Proteins from extremophile organisms typically have very stable quaternary structures, a property that makes denaturation more difficult. As Aq-1599 presents an extra cysteine located in the N-terminal part of the protein which, in sulfurtransferase from W. succinogenes is involved in the dimerization, we have tested if a disulfide bridge could be involved in the quaternary structural organization of Aq-1599. SDS-PAGE experiments without reducing agent were done on the “as prep” enzyme and showed an increase of oligomer band

392

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

Fig. 1. A. Structural alignment of Aq-1599 with RhdB1 from A. aeolicus, GlpE from E. coli, Sud from W. succinogenes and 1WV9 (TTHA0613) from T. thermophilus. Secondary structures are indicated, based on the three dimensional modelization (www.compbio.dundee.ac.uk/wwww-jpred/) for A. aeolicus and from the 3D structure for GlpE, Sud and TTHA0613. Residues involved in a helix are boxed and those in b sheet are underlined. Conserved residues involved in substrate binding are in bold. The arrow indicates the active-site cysteine. B. Structural model of Aq-1599 from Aa and 3D structure of SUD from W.s. [16] The catalytic cysteine in SUD and the proposed catalytic cysteine in Aq-1599 are shown in red, the supplementary cysteine in Aq-1599 is shown in cyan. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 2. (A) SDS polyacrylamide gel of the purified Aq-1599 from A. aeolicus. Lane 1: 1 mg of purified Aq-1599 pre-incubated with DTT 20 mM; Lane 2: 1 mg of purified Aq-1599 without DTT treatment; Lane 3. Molecular mass markers (in kDa). (B) Size exclusion chromatography of Aq-1599. Superose 12 column (1  30 cm) was equilibrated in 100 mM TriseHCl, 50 mM NaCl, pH 7.6 at 20  C 20 mM cystein. a: injection of 200 ml of Aq-1599 at 4 mg/ml; b: injection of 200 ml of Aq-1599 at 4 mg/ml pre-incubated with 20 mM DTT. The protein was detected by its adsorbance at 280 nm. Inset: Calibration curve in 100 mM TriseHCl, 50 mM NaCl, pH 76, flow rate 0.3 ml/min, sample volume 200 ml at 2 mg/ml of ferredoxin (8 kDa); cytochrome c3 (13 kDa); Ovalbumin (43 kDa).

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

120 100 Residual activity (%)

(Fig. 2A lane 2) suggesting a possible role of disulfide bridge in oligomerization process. In parallel, gel filtration was realized in presence of 20 mM cystein, on “as prep” enzyme or enzyme preincubated with DTT. One peak is obtained corresponding to a mix of the dimeric and monomeric forms (30 kDa with a shoulder at 15 kDa, Fig. 2B trace (b)) instead of higher than 60 kDa and 35 kDa for “as prep” enzyme (Fig. 2B trace (a)). This result confirms the hypothesis of the presence of disulfide bond stabilizing an oligomeric form of Aq-1599. To control the reduction of disulfide bridge, we have determined the concentration in free SH. From 15 mM of Aq-1599, a concentration of 11 mM and 20 mM has been measured in oligomeric enzyme and after DTT treatment respectively, suggesting that only one cysteine is involved in the disulfide bridge.

393

80 60 40 20 0 0

50

3.3. Physico-chemical and functional properties As Aq-1599 presents several oligomerization states, we decided to investigate which form was active. The standard sulfurtransferase assay includes DTT, and in consequence the structural disulfide bridge that stabilizes the oligomeric Aq-1599 was systematically cleaved during the test. To determine which Aq-1599 form can bind thiosulfate, we did fluorescence studies on the oligomeric form (“as prep” Aq-1599) as well as on monomeric Aq-1599 obtained after gel filtration and DTT treatment. The intrinsic fluorescence of Aq-1599 is due to four phenylalanine and four tyrosine residues and fluorescence quenching of the rhodanese has been used in the past to monitor the state of the enzyme during the sulfurtransferase activity. There is no modification of the fluorescence emission when thiosulfate was added to “as prep” enzyme (data not shown). In contrast, with monomeric protein, thiosulfate addition induces fluorescence quenching, suggesting that monomeric form can bind it. As the monomeric form was obtained after disulfide bridge reduction, this reduction is necessary to get the active form of Aq-1599. As we previously mentioned, Aq-1599 sequence analysis revealed the existence of two cysteine residues, Cys 93 and Cys 26. By sequence alignment we can propose that Cys 93 is involved in the active site. To check if Cys 26 is an equivalent catalytic site for substrate and which cysteine (Cys 93 or Cys 26) is involved in the disulfide bridge, “as prep” Aq-1599 was pre-incubated with a cysteine-modifying reagent, iodoacetamide. After inactivation of accessible cysteine, we realized the classical sulfurtransferase assay and due to the presence of dithiothreitol, disulfide bridge(s) cysteine was (were) exposed to substrate. Iodoacetamide can totally inactivate Aq-1599, which means that the cysteine residue implicated in the active site is not involved in a disulfide bridge formation (Fig. 3). In line with the sequence alignment, this result suggests that cysteine 93 (i) is involved in the catalysis (ii) is not involved in disulfide bond formation and (iii) cysteine 26 is implicated in disulfide bridge formation and not in the Aq-1599 catalytic site. The model of the tridimensional structure of Aq-1599 confirms these results as the catalytic cysteine (Cys 93) is in the same environment than the catalytic cysteine in SUD (Fig. 1B). Moreover, the estimated distance between the two cysteines in Aq-1599 is from 13.32 to 14.34 Å. This distance rules out a possible disulfide bridge between these two cysteines. In a same way, modelization of the dimeric organization using dimeric SUD as template suggests a similar dimeric organization for Aq-1599 than for SUD (data not shown). As in SUD, a disulfide bond between the two catalytic residues is not possible (estimated distance higher than 15 Å). In line with our previous results this modelization suggests that a disulfide bridge in Aq-1599 more probably occurs between dimeric proteins to form a higher oligomeric state.

100

150

200

250

Incubation time (min.) Fig. 3. Inactivation of Aq-1599 by iodoacetamide. Purified “as prep” Aq-1599 (C) or Aq-1599 pre-treated by DTT (>) was incubated at an ambient temperature in 100 mM TriseHCl (pH 7.6) with 20 mM of iodoacetamide reagent. Remaining rhodanese activity was determined and compared with that for Aq-1599 incubated without iodoacetamide.

3.4. Substrate specificity Various compounds were tested as sulfur donors. b-Mercaptopyruvate could not replace thiosulfate as sulfur donor, demonstrating that Aq-1599 is not a mercaptopyruvate sulfurtransferase. Kinetics were measured with thiosulfate and polysulfide as sulfur donors (Table 1). As it has been shown with RhdB1, and in contrast to Sud from W. succinogenes or GlpE from E. coli, Aq-1599 was active with both substrates. As for RhdB1 it appears that polysulfide sulfur was a very efficient sulfur donor. H2S production was also tested. Due to the high unspecific reaction with polysulfide in presence of DTT, the test was done in the presence of NaBH4 instead of KCN as described by Klimmeck et al. [15]. To detect H2S production, 100fold more enzymes was necessary compared to the kinetics of thiocyanate production, suggesting that this reaction was not physiological. Reduced E. coli thioredoxin 1 serves as sulfur-acceptor substrate for RhdB1 from A. aeolicus [17]. Aq-1599 may also have the ability to utilize dithiol proteins such as thioredoxin as sulfur acceptors. However, as for RhdB1, the amount and the stability of the proteins (thioredoxin and thioredoxin reductase) necessary in this test at 50  C meant that the determination of the kinetic parameters was impossible. Purified Aq-1599 presents low turn-over with thiosulfate or polysulfide as sulfur donor compared to RhdB1. However our results show that the two one-domain rhodaneses from A. aeolicus are specific for polysulfide.

Table 1 Steady state kinetic parameters of Aq-1599 (RhdB2) from A. aeolicus The values were obtained from direct experimental measurements fitted to the Michaelis-Menten equation. The values of apparent Km for polysulfide refer to polysulfide sulfur concentration. Activity

kcat (s
1)

Apparent Km (mM)

Thiosulfate:cyanide sulfurtransferase

400  26

Thiosulfate:borohydride reductase Polysulfide sulfur:cyanide sulfurtransferase Thioredoxin sulfurtransferase 3-mercaptopyruvate:cyanide sulfurtransferase

no activity 7335  302

1  0.3 (S2O2
3 ); 1,7  0.5 (CN
) nd <0.05 (S2
n )

15 no activity

nd nd

394

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

3.5. The aq-1599 gene belongs to an operon that is up-regulated in the presence of S To investigate the possible physiological role of the Aq-1599 protein, we analyzed the genetic environment of the aq-1599 gene. On the chromosome, this gene is preceded by three genes oriented in the same direction (Fig. 4A). The first gene of the cluster, aq-1603, encodes a putative protein homologue of the RaiA protein. The second gene, aq-1602 (annoted secF), encodes a protein-export membrane protein and the third, aq-1601 (annoted pilD), encodes a type IV prepilin peptidase. Interestingly, the aq-1603 gene overlaps the aq-1602 gene, which itself overlaps the aq-1601 gene, and only 27 bp separates aq-1601 from aq-1599. These four genes could therefore constitute an operon. Downstream of this putative operon there is a gene oriented in the opposite direction (aq-1598) that encodes a protein similar to dihydrouridine synthase-like (DUS-like) FMN-binding domain. To determine if the aq-1603, aq-1602, aq-1601 and aq-1599 genes belong to the same transcriptional unit, we carried out RT-PCR using RNA extracted from cells grown in the presence of S or thiosulfate and appropriate convergent primer pairs. As shown in Fig. 4B, a DNA fragment of the expected size was amplified using one primer inside aq-1603 and another one in aq-1602. This indicates that aq-1603 and aq-1602 are transcribed into the same messenger RNA. Amplification products were also obtained with couples of primers hybridizing inside aq-1602 and aq-1601, and inside aq-1601 and aq-1599. Altogether, these results clearly indicate that the four genes are co-transcribed. It is important to note that, even if amplification products were visible whether cells were grown in the presence of S or in the presence of thiosulfate, the intensity of the DNA fragments were always higher when cells were grown in the presence of S . Given the former result and since the Aq-1599 protein was only purified from A. aeolicus grown in the presence of S , we wondered if the expression of the aq-1599 gene, as well as of the other genes of the operon, could be regulated by S . We therefore did quantitative real-time reverse transcription PCR (qRT-PCR) using RNA

Fig. 4. (A) Representation of the aq-1603, aq-1602, aq-1601 and aq-1599 genes The different primers used for RT-PCR are represented by black arrow heads below the genes. Primers are aq1603-5 (a), aq1602-1 (b), aq1602-2 (c), aq1601-1 (d), aq1601-2 (e) and aq1599-2 (f). (B) Analysis of the transcription of the aq-1603, aq-1602, aq-1601 and aq-1599 genes by RT-PCR. RNAs were extracted from cells grown in the presence of thiosulfate (T) or elemental sulfur (S) and reverse transcribed. PCR amplifications were then performed using these cDNA as templates and the convergent primer pairs indicated below the figure.

extracted from A. aeolicus grown either in the presence of S or in the presence of thiosulfate and primer pairs that were specific to each gene. qRT-PCR was also done with a 16S specific primer pair to quantify the amount of 16S RNA in each sample. The relative transcript corresponding to each gene was then normalized to that of the 16S RNA. As shown in Fig. 5, for all four genes, the transcript level increased when cells were grown in the presence of S . Ratios of induction by S are 1.3 for the aq-1603 gene, almost 2 for the aq-1602 and aq-1599 genes and 4.2 for the aq-1601 gene. These results indicate not only that expression of the aq-1599 gene is indeed induced in the presence of S but that it is also the case for the three genes that are located upstream. We can therefore conclude that aq-1603, aq-1602, aq-1601 and aq-1599 genes belong to the same transcriptional unit and that this unit is up-regulated in the presence of S .

3.6. Adhesion Since aq-1601 and aq-1602 genes encode respectively a Pre-pilin peptidase, known to be required for maturation of pilin subunits of the type IV pili involved in bacterial adhesion, and for SecF, an essential component of the protein translocation across the cytoplasmic membrane to the periplasm, we experimented whether or not A. aeolicus could adhere to elemental sulfur. Elemental sulfur coated-glasses were inoculated with either thiosulfate- or sulfurgrown cells and then put in bottles under H2/CO2 atmospheres at 85  C for 16e18 h. Whatever the inoculum used, cells grew and adhered tightly to sulfur coated-glass (Fig. 6 A (b) and B (a)). When the same experiment was performed with thiosulfate-coated glasses, no significant adhesion was detected whatever the inoculum (Fig. 6 A (c), B (b)). The loss of adherence to thiosulfate is supported by the qRT-PCR results since lower amounts of aq-1601 are expressed in this growth condition. These results agree with the fact that S is, in contrast to thiosulfate, an insoluble substrate and it is reasonable to postulate that under thiosulfate conditions the cells adopted a swimming behaviour, instead of adhering to their substrate. Proteins of sulfur- and thiosulfate-grown cells were

Fig. 5. Analysis of the expression levels of the aq-1603, aq-1602, aq-1601 and aq-1599 genes by qRT-PCR. Transcript levels were determined by qRT-PCR from cells grown in thiosulfate (T) or elemental sulfur (S) and were expressed relatively to that of 16S rRNA. Values represent the mean of at least four measurements.

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

395

Fig. 6. Attachment of A. aeolicus on elemental sulfur. (A) The formation of bacterial biofilm on the walls of glass tubes is visualized by crystal violet staining after 16 h under H2/CO2 atmospheres at 85  C. (a) controls: 1: immobilized sulfur flower without bacteria, 2: immobilized thiosulfate without bacteria, 3: bacteria without substrate. (b) immobilized sulfur flower inoculated with either sulfur- (1) or thiosulfate (2) -grown cells; (c): immobilized thiosulfate inoculated with either sulfur- (1) or thiosulfate (2) -grown cells. (B) Quantitation of biofilm formation by A. aeolicus (a): immobilized sulfur flower þ bacteria; (b): immobilized thiosulfate þ bacteria; (c): thiosulfate alone; (d): sulfur flower alone; (e): bacteria alone. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

analyzed by SDS-PAGE and immunoblotting using antibodies against FliC from P. aeruginosa which has 44% of identity with FliC from A. aeolicus, the major component of the flagellar filament. A signal around 50 kDa corresponding to the expected size for the A. aeolicus FliC protein was detected in thiosulfate-grown cells (Fig. 7). This signal was absent from cells grown on sulfur, suggesting that either the flagellin was degraded or not synthesized, with loss of swimming motility.

Persephonella marina EX-H1, and Sulfurihydrogenibium azorense. Moreover, there was no periplasmic rhodanese in P. marina EX-H1. The coexistence of several rhodanese-like proteins in the same organism suggests a plethora of different physiological roles. As the metabolic transformations carried out in all species are

4. Discussion 4.1. Aq-1599 is a periplasmic single-domain rhodanese We have previously shown, that a sulfurtransferase activity is present in the cytoplasmic fraction of A. aeolicus grown on sulfur and, we have characterized a new sulfurtransferase enzyme [17]. In the present study, sulfurtransferase activity was detected in the periplasmic extract of A. aeolicus. This extract was “cytoplasm free” since no lactate dehydrogenase was detectable. Therefore, we can propose that enzymes required for sulfur transfer are also present in A. aeolicus periplasmic space. We have purified and characterized a periplasmic protein annotated as a hypothetical protein from A. aeolicus which catalyses transfer of the sulfane sulfur from thiosulfate to cyanide to form thiocyanate. According to this activity and its amino acid sequence, Aq-1599 belongs to the rhodanese (or sulfurtransferase) family and we propose to rename it RhdB2. It is the second single-domain sulfurtransferase characterized from hyperthermophilic bacteria and the first located in the periplasmic space. Moreover it is the only one-domain TST with a quaternary organization and with activity controlled by the presence of a disulfide bridge. Genome sequencing has shown that ORFs coding for rhodanese or the MST homologue are present in most eubacteria, archaea and eukaryota [36]. Several genes encoding for distinct “rhodanese-like” proteins are often found in the same genome, suggesting that the encoded proteins may have distinct biological functions. A. aeolicus, presents only four genes encoding rhodaneses (two multidomains rhdA1 and rhdA2, and two one-domains rhdB1 and rhdB2) which is not very much compared to ten genes in P. aeruginosa [37] and 18 predicted rhodanese domain proteins in Arabidopsis [38]. This particularity seems to be specific to Aquificales since we have identified only four rhodanese genes in

Fig. 7. Immunoblotting experiments of crude extract from A. aeolicus demonstrating the presence of flagella under thiosulfate conditions. Lane 1. Immunoblotting experiments of soluble crude extract from A. aeolicus cultivated on H2/S0 medium. 50 mg of protein was loaded on the gel before detection by immunoblotting using anti-FliC antibodies. Lane 2: Immunoblotting experiments of soluble crude extract from A. aeolicus cultivated on H2/NaS2O3 medium. 50 mg of protein was loaded on the gel before detection by immunoblotting using anti-FliC antibodies. Lane 3: Molecular mass markers (in kDa).

396

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

essentially the same, in Aquificales, most probably the same rhodanese is involved in various metabolic pathways. This suggests broad specificity for these proteins and a different picture of the kinetic structure of the early cell from that of “one enzymeeone reaction” view has made familiar. It is widely believed that specificity has increased during evolution, i.e. that the more specific enzymes evolved from less specific ancestral proteins [39]. 4.2. RhdB2 (Aq-1599) is a thermostable oligomeric ST Only few single-domain rhodaneses have been characterized in detail. The resolution of the 3D structure of Sud, a sulfurtransferase from W. succinogenes, shows that it is dimeric [16], and it probably functions as a dimer in solution. GlpE has also been described as a dimeric enzyme [13] but the 3D structure did not confirm this point [14]. In Sud, the oligomerization occurs via the a1 helix [16] which is present in RhdB2 (Aq-1599) but absent in RhdB1 and in GlpE. The two last structures solved were those of T. thermophilus and Arabidopsis thaliana rhodaneses [34,35]. These two enzymes are monomeric. The dimerization of RhdA from Azotobacter vinelandii has been also shown but only after mutations in the catalytic loop inducing an interdisulfide bridge [40] or when the enzyme was considerably over-expressed [31]. However in all cases, the active enzyme was the monomer [40,41]. Our results on RhdB2 from A. aeolicus show that it exists at least as monomer, dimer and oligomer at 25  C. 3D moldelization using SUD as template demonstrates that the catalytic cysteine is not involved in a disulfide bridge. We propose that as in Sud, the a1 helix is probably involved in the protein oligomerization of RhdB2. Moreover, as the supplementary cysteine is present in this part of the protein, we propose, in line with our results, a role of disulfide bridge in the oligomerization process. The crystal structures of many proteins from hyperthermophiles have been solved, and several factors responsible for their extreme thermostability have been proposed, including an increase in the number of ion pairs and hydrogen bonds, core hydrophobicity and packing density, as well as the oligomerization of several subunits and an entropic effect due to the relatively shorter surface loops and peptide chains [42]. Protein stability arises from a combination of many factors, each contributing to various extents in different proteins. It seems that there is not single dominating factor [42]. Comparative examination of the primary structure did not point to any obvious features that could explain the high thermostability of RhdB2 from A. aeolicus. Particularly, in contrast to what was observed in RhdB1 and in TTHA0613 from T. thermophilus HB8, the number of asparagine, glycine and hydrophobic residues is in the same range as those for mesophilic enzymes. A few enzymes from hyperthermophilic organisms are higher-order oligomers than their counterparts in mesophilic organisms and potential stabilizing role of increased subunit interactions via oligomerization has been suggested [42,43]. However, an involvement in rendering the proteins thermostable has also been pointed out for the disulfide bond in the [2Fee2S] ferredoxins from Aquifex [44]. This disulfide bond therefore represents yet another strategy of adaptation to high temperature. To our knowledge, Aquifex is the only organism in which proteins with 36% identity and the same activity show different mode of oligomerization stabilization. However, these underline the absence of a general model to explain the stability at high temperature. 4.3. Functional role of RhdB2 (Aq-1599) As for all enzymes belonging to the rhodanese family, the function of single-domain rhodanese in vivo is seriously debated [37]. When mercaptopyruvate was used as sulfur donor, no activity was detected with RhdB2, suggesting that it was not an MST. This

agrees with the amino acid composition of the active site loop, which is different from the characteristic motif of MST ie: CG(S/T) GVT with no charged residues in the loop [3]. In the same way, the Cd25 phosphatase domain and arsenate resistance role were excluded as in these enzymes an elongated seven amino acid active-site loop was present. The RhdB2 amino acid loop presents the motif of the catalytic domain of thiosulfate cyanide sulfurtransferase (TST) which is distributed among bacteria, archaea and eukaryota. RhdB2 catalyses sulfur transfer from thiosulfate and polysulfide. To date this is the only enzyme with RhdB1 that can use, in vitro, these different sulfur donors since Sud is inactive with thiosulfate [15] and to date the polysulfide sulfurtransferase activity of GlpE has not been demonstrated [13]. Members of the genus Aquifex have been obtained from marine hydrothermal systems [23] where sulfur is a predominant compound. We have previously shown that A. aeolicus can grow with elemental sulfur or thiosulfate [45]. Moreover, growth with elemental sulfur is more efficient even though it is insoluble whereas thiosulfate is soluble. Our present results demonstrate that A. aeolicus adheres to elemental sulfur and presents a flagellum under thiosulfate conditions. A. aeolicus is motile and its genome encodes for a monopolar polytrichious flagellum [23]. Interestingly, when it is grown in the presence of thiosulfate, the cells no longer adhere. Analysis of FliC production showed that non-adherent thiosulfate-grown bacteria produce the filament subunits, FliC, whereas sulfur-grown adherent bacteria did not, suggesting a negative control of the swimming motility of A. aeolicus when it detects sulfur as an electron acceptor. However, no homologues of the classical bacterial chemotaxis system have been identified in A. aeolicus that could highlight the switch in the bacterial motility. Although no studies have been reported, to our knowledge, of twitching motility or adherence of A. aeolicus, genome mining reveals the presence of open reading frames encoding a subset of Tfp (Type IV pili) components like the adhesins PilC1 (Aq-747) and PilC2 (Aq-1285), and pilin subunits PpdD1 (Aq-1432), FimZ (Aq-1433), PpdD2 (Aq-1434) and PpdD3 (Aq-1435) [23]. Pre-pilin peptidases are key players in the periplasmic maturation of the pilin subunits to be exported at the cell surface, to form the pili that allow tight adherence of the bacteria to surfaces [46]. Analysis of the expression of the genes at the vicinity of RhdB2 showed that aq-1601, encoding the prepilin peptidase PilD had its expression level increased (four fold) when cells were grown on sulfur. This result is in good agreement with the fact that, sulfur-grown cells exhibit strong attachment to the surface of sulfur-coated glass vials. Since the difference in the culture substrates induced a change in flagellin synthesis and also in the adherence of A. aeolicus, our results suggest a shift from planktonic lifestyle to an adherent behaviour depending on the sulfur source and probably on Aq-1599 substrate specificity. This role in acclimation process has never been demonstrated for rhodaneses but was postulated few years ago for a rhodanese like protein in Synechococcus sp. [47] and the mechanism involved in this process remains to be elucidated in A. aeolicus. Acknowledgments We gratefully acknowledge the contribution of Marielle Bauzan (Fermentation Plant Unit IMM, Marseilles, France) for growing the bacteria, Régine Lebrun (Proteomic Analysis Center, Marseilles, France) for N-terminal sequencing and mass determination, Yann Denis (IMM genomic facility, Marseilles, France) for helpful advice with real-time PCR and Marie Luz Cárdenas, Athel Cornish-Bowden, Marianne Guiral, Elisabeth Lojou, Pascale Tron (BIP-CNRS e Marseilles, France) and Vincent Méjean (LCB-CNRS - Marseilles, France) for helpful discussions.

M.-C. Giuliani et al. / Biochimie 92 (2010) 388e397

References [1] [2] [3] [4]

[5]

[6]

[7]

[8] [9]

[10]

[11]

[12] [13]

[14]

[15]

[16]

[17]

[18] [19] [20] [21] [22]

[23]

[24]

H. Beinert, A tribute to sulfur. Eur. J. Biochem. 267 (2000) 5657e5664. D. Kessler, Enzymatic activation of sulfur for incorporation into biomolecules in prokaryotes. FEMS Microbiol. 30 (2006) 825e840. D. Bordo, P. Bork, The rhodanese/Cdc25 phosphatase superfamily. Sequencestructure-function relations. EMBO Rep. 3 (2002) 729e746. J.H. Ploegman, G. Drent, K.H. Kalk, W.G. Hol, R.L. Heinrikson, P. Keim, L. Weng, J. Russell, The covalent and tertiary structure of bovine liver rhodanese. Nature 273 (1978) 124e129. J.H. Ploegman, G. Drent, K.H. Kalk, W.G. Hol, The structure of bovine liver rhodanese. II. The active site in the sulfur-substituted and the sulfur-free enzyme. J. Mol. Biol. 127 (1979) 149e162. B.T. Bui, F. Escalettes, G. Chottard, D. Florentin, A. Marquet, Enzyme-mediated sulfide production for the reconstitution of (2Fee2S) clusters into apo-biotin synthase of Escherichia coli. Sulfide transfer from cysteine to biotin. Eur. J. Biochem. 267 (2000) 2688e2694. A. Cereda, A. Carpen, G. Picariello, M. Iriti, F. Faoro, P. Ferranti, S. Pagani, Effects of the deficiency of the rhodanese-like RhdA in Azotobacter vinelandii. FEBS Lett. 581 (2007) 1625e1630. P. Cerletti, Seeking a better job for an under-employed enzyme: rhodanese. Trends Biochem. Sci. 11 (1986) 369e372. C.T. Lauhon, E. Skovran, H.D. Urbina, D.M. Downs, L.E. Vickery, Substitutions in an active site loop of Escherichia coli IscS result in specific defects in FeeS cluster and thionucleoside biosynthesis in vivo. J. Biol. Chem. 279 (2004) 19551e19558. S. Leimkühler, K.V. Rajagopalan, A sulfurtransferase is required in the transfer of cysteine sulfur in the in vitro synthesis of molybdopterin from precursor Z in Escherichia coli. J. Biol. Chem. 276 (2001) 22024e22031. M.D. Wolfe, F. Ahmed, G.M. Lacourciere, C.T. Lauhon, T.C. Stadtman, T.J. Larson, Functional diversity of the rhodanese homology domain: the Escherichia coli ybbB gene encodes a selenophosphate-dependent tRNA 2-selenouridine synthase. J. Biol. Chem. 279 (2004) 1801e1809. H. Adams, W. Teertstra, M. Koster, J. Tommassen, PspE (phage-shock protein E) of Escherichia coli is a rhodanese. FEBS Lett. 518 (2002) 173e176. W.K. Ray, G. Zeng, M.B. Potters, A.M. Mansuri, T.J. Larson, Characterization of a 12-kilodalton rhodanese encoded by glpE of Escherichia coli and its interaction with thioredoxin. J. Bacteriol. 182 (2000) 2277e2284. A. Spallarossa, J.L. Donahue, T.J. Larson, M. Bolognesi, D. Bordo, Escherichia coli GlpE is a prototype sulfurtransferase for the single-domain rhodanese homology superfamily. Structure 9 (2001) 1117e1122. O. Klimmek, V. Kreis, C. Klein, J. Simon, A. Wittershagen, A. Kroger, The single cysteine residue of the Sud protein is required for its function as a polysulfide-sulfurtransferase in Wolinella succinogenes. Eur. J. Biochem. 253 (1998) 263e269. Y.J. Lin, F. Dancea, F. Lohr, O. Klimmek, S. Pfeiffer-Marek, M. Nilges, H. Wienk, A. Kroger, H. Ruterjans, Solution structure of the 30 kDa polysulfide-sulfurtransferase homodimer from Wolinella succinogenes. Biochemistry 43 (2004) 1418e1424. M.C. Giuliani, P. Tron, G. Leroy, C. Aubert, P. Tauc, M.T. Giudici-Orticoni, A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus. Being single is not so simple when temperature gets high. FEBS J. 274 (2007) 4572e4587. M.W. Adams, Biochemical diversity among sulfur-dependent, hyperthermophilic microorganisms. FEMS Microbiol. Rev. 15 (1994) 261e277. R.M. Kelly, M.W.W. Adams, Metabolism in hyperthermophilic microorganisms. Antonie Van Leeuwenhoek 66 (1994) 247e270. G.J. Olsen, C.R. Woese, R. Overbeek, The winds of (evolutionary) change: breathing new life into microbiology. J. Bacteriol. 176 (1994) 1e6. K.O. Stetter, Extremophiles and their adaptation to hot environments. FEBS Lett. 452 (1999) 22e25. M. Brugna-Guiral, P. Tron, W. Nitschke, K.O. Stetter, B. Burlat, B. Guigliarelli, M. Bruschi, M.T. Giudici-Orticoni, [NiFe] hydrogenases from the hyperthermophilic bacterium Aquifex aeolicus: properties, function, and phylogenetics. Extremophiles 7 (2003) 145e157. G. Deckert, P.V. Warren, T. Gaasterland, W.G. Young, A.L. Lenox, D.E. Graham, R. Overbeek, M.A. Snead, M. Keller, M. Aujay, R. Huber, R.A. Feldman, J.M. Short, G.J. Olsen, R.V. Swanson, The complete genome of the hyperthermophilic bacterium Aquifex aeolicus. Nature 392 (1998) 353e358. M. Brugna, M.T. Giudici-Orticoni, S. Spinelli, K. Brown, M. Tegoni, M. Bruschi, Kinetics and interaction studies between cytochrome c3 and Fe-only

[25] [26] [27]

[28]

[29]

[30]

[31] [32]

[33]

[34]

[35]

[36] [37] [38]

[39] [40]

[41]

[42]

[43]

[44]

[45]

[46] [47]

397

hydrogenase from Desulfovibrio vulgaris Hildenborough. Proteins 33 (1998) 590e600. J. Papenbrock, A. Schmidt, Characterization of a sulfurtransferase from Arabidopsis thaliana. Eur. J. Biochem. 267 (2000) 145e154. G.L. Ellman, Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82 (1959) 70e77. E. Mortz, T.N. Krogh, H. Vorum, A. Gorg, Improved silver staining protocols for high sensitivity protein identification using matrix-assisted laser desorption/ionization-time of flight analysis. Proteomics 1 (2001) 1359e1363. G.A. O'Toole, R. Kolter, Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30 (1998) 295e304. J.F. Joanny, M. Castelnovo, in: G. Decher, J.B. Schlenoff (Eds.), Polyelectrolyte Adsorption and Multilayer Formation in Multilayer Thin Films, Wiley-VCH Verlag GmbH and Co.KGaA, Weinheim, 2003, pp. 87e97. J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22 (1994) 4673e4680. T. Schwede, J. Kopp, N. Guex, M.C. Peitsch, SWISS-MODEL: an automated protein homology-modeling server. Nucleic Acids Res. 31 (2003) 3381e3385. K. Arnold, L. Bordoli, J. Kopp, T. Schwede, The SWISS-MODEL Workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22 (2006) 195e201. M. Acosta, S. Beard, J. Ponce, M. Vera, J.C. Mobarec, C.A. Jerez, Identification of putative sulfurtransferase genes in the extremophilic Acidithiobacillus ferrooxidans ATCC 23270 genome: structural and functional characterization of the proteins. OMICS 9 (2005) 13e29. M. Hattori, E. Mizohata, A. Tatsuguchi, R. Shibata, S. Kishishita, K. Murayama, T. Terada, S. Kuramitsu, M. Shirouzu, S. Yokoyama, Crystal structure of the single-domain rhodanese homologue TTHA0613 from Thermus thermophilus HB8. Proteins 64 (2006) 284e287. G. Cornilescu, D.A. Vinarov, E.M. Tyler, J.L. Markley, C.C. Cornilescu, Solution structure of a single-domain thiosulfate sulfurtransferase from Arabidopsis thaliana. Protein Sci. 15 (2006) 2836e2841. E.G. Mueller, Trafficking in persulfides: delivering sulfur in biosynthetic pathways. Nat. Chem. Biol. 1 (2006) 185e194. R. Cipollone, P. Ascenzi, P. Visca, Common themes and variations in the rhodanese superfamily. IUBMB Life 59 (2007) 51e59. M. Bauer, J. Papenbrock, Identification and characterization of single-domain thiosulfate sulfurtransferases from Arabidopsis thaliana. FEBS Lett. 532 (2002) 427e431. M.L. Cárdenas, A. Cornish-Bowden, T. Ureta, Evolution and regulatory role of the hexokinases. Biochim. Biophys. Acta 1401 (1998) 242e264. F. Forlani, A. Carpen, S. Pagani, Evidence that elongation of the catalytic loop of the Azotobacter vinelandii rhodanese changed selectivity from sulphur- to phosphate-containing substrates. Prot. Eng. 16 (2003) 515e519. A. Cereda, F. Forlani, S. Lametti, R. Bernhardt, P. Ferranti, G. Picariello, S. Pagani, F. Bonomi, Molecular recognition between Azotobacter vinelandii rhodanese and sulphur acceptor protein. Biol. Chem. 384 (2003) 1473e1481. G.A. Petsko, Structural basis of thermostability in hyperthermophilic proteins, or “there's more than one way to skin a cat”. Methods Enzymol. 334 (2001) 469e478. C. Vieille, G.J. Zeikus, Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability. Microbiol. Mol. Biol. Rev. 65 (2001) 1e43. G. Mitou, C. Higgins, P. Wittung-Stafshede, R.C. Conover, A.D. Smith, M. K. Johnson, J. Gaillard, A. Stubna, E. Münck, J. Meyer, An Isc-type extremely thermostable [2Fe-2S] ferredoxin from Aquifex aeolicus. Biochemical, spectroscopic, and unfolding studies. Biochemistry 42 (2003) 1354e1364. M. Guiral, P. Tron, C. Aubert, A. Gloter, C. Iobbi-Nivol, M.T. Giudici-Orticoni, A membrane-bound multienzyme, hydrogen-oxidizing, and sulfur-reducing complex from the hyperthermophilic bacterium Aquifex aeolicus. J. Biol. Chem. 280 (2005) 42004e42015. D.N. Nunn, S. Lory, Product of the Pseudomonas aeruginosa gene pilD is a prepilin leader peptidase. Proc. Natl. Acad. Sci. 88 (1991) 3281e3285. D.N. Laudenbach, D. Ehrhardt, L. Green, A. Grossman, Isolation and characterization of a sulfur-regulated gene encoding a periplasmically localized protein with sequence similarity to rhodanese. J. Bacteriol. 173 (1991) 2751e2760.