- Email: [email protected]
Characterization of a PDR1 mutant allele from a clotrimazole-resistant sake yeast mutant with improved fermentative activity
JOURNAL OF BIOSCIENCE AND BIOENGINEERING Vol. 88, No. 1, 20-25. 1999
Characterization of a PDRl Mutant Allele from a Clotrimazole-Resistant Sake Yeast Mutant with Improved Fermentative Activity HIROKO MIZOGUCHI, MUTSUMI WATANABE, * AND AKIRA NISHIMURA Research & Development Department, Hakutsuru Sake Brewing Co. Ltd., 4-5-5 Sumiyoshiminami-machi, Higashinada-ku, Kobe 658-0041, Japan Received25 December199WAccepted26 March 1999 Clotrimazole-resistant mutants from various sake yeasts show improved fermentative activity in sake mash while retaining their parental advantages for sake making. These mutants also exhibit pleiotropic drug resistance (PDR) phenotypes. To investigate the relationship between the improvement of fermentative activity and PDR phenotypes, a PDRZ mutant allele (pdrl-hl76) encoding a transcription factor was cloned from a clotrlmazole-resistant mutant, HL176 (MA Ta/MA Ta), using PCR amplification. The nacleotide sequencesof pdrl-h176 and its wild allele were determined. The mutant allele contained a mlssensepoint mutation (L309S) that can confer a PDR phenotype on yeast. This amino acid substitution is located in the conserved motif II in the inhibitory domain of Pdrlp, and is very close to the cluster of three mutation points (P298A, R302Q, and M3081) described by Carvajal et al. (Mol. Gen. Genet., 256,406-415,1997) in laboratory strains. A PDRI wild allele of HL163, the parent strain of HL176, was replaced by pdrl-h176 using gene recombination at the homologous site. The resultant transformants (PDRZ/pdrl-hl7d) showed the same PDR phenotype as HL176, and they fermented sake mash efficiently even in the linal fermentation stage, while HL163 did not. The amino acid substitution (L309S) in pdrl-h176 was considered to be sufficient to improve the fermentative activity of sake yeast, in addition to conferring the PDR phenotype. [Key
words: clotrimazole, pleiotropic drug resistance,PDRI, sake yeast, improved fermentative activity] transporter-encoding genes including PDRS, YORl, and SNQ2 (12). PdrSp pumps out various drugs such as cycloheximide, cerulenin, chloramphenicol, sulfometuron methyl, and azole fungicides (14-16) while Yorlp extrudes oligomycin and anionic drugs like reveromycin A and acetic acid (17, 18). The SrVQ2 gene has been cloned and found to be responsible for resistance to a mutagen, 4-nitroquinoline-N-oxide (19). Some clinical Candida albicans isolates from AIDS patients with oropharyngeal candidasis who had been treated with high doses of fluconazole, an azole fungicide, for long periods showed PDR phenotypes and amplification of the mRNA levels for the CDRZ gene encoding an ABC transporter (20). Besides this, a well-characterized mechanism for azole resistance in filamentous fungi is increased energy-dependent efflux of azoles from the mycelium of laboratory-generated mutants (21). Amplification of the mRNA levels of the PDRS gene was observed in our CTZ-resistant mutants (9). The fact that they showed resistance to oligomycin besides various other drugs including CTZ suggests that in addition to the PDRS gene, YORI is simultaneously overexpressed in these mutants. A large number of PDR mutants have been isolated from Saccharomyces cerevisiae laboratory strains. Genetic and complementary studies have revealed that the majority of these mutants possess a single semidominant mutation at the PDRZ locus (10, 22). The PDRI gene encodes the transcription factor that controls the expression of many ABC transporter-encoding genes simultaneously. On the other hand, the PDR3 gene, a PDRI homologue, is regulated by Pdrlp and is autoregulated by its own product Pdr3p (23). In the work reported here, we cloned PDRI alleles
Sake fermentation is performed at lo-15°C and the final alcohol concentration reaches up to 20% (v/v). More than 3 weeks are usually needed to complete the fermentation. Sometimes, the fermentation becomes stuck in the final stage, lowering the quality of the resultant sake. Because of this, many studies have been done to isolate various mutant strains with improved fermentative activity (l-5). Clotrimazole (CTZ) is one of the azole fungicides that inhibit cytochrome P-450 lanosterol 14a-demethylase (EC 1.14.14.1) in the ergosterol biosynthesis pathway (6, 7). Sake yeast mutants resistant to CTZ have been isolated from several different parental strains. Most of them ferment sake mash faster and produce higher amounts of alcohol than their parent strains, while retaining their parental advantages for sake making (8, 9). These mutants have been found to be resistant not only to other azole fungicides but also to a wide range of unrelated cytotoxic compounds including cycloheximide, cerulenin, chloramphenicol, sulfometuron methyl, and oligomycin (9). Since the chemical structures of these compounds and their actions toward yeast cells differ widely among them, CTZ-resistant mutants display pleiotropic drug resistance (PDR) phenotypes. PDR phenomena in yeast have been extensively studied as models of the multidrug resistance of cancer cells (10-13). Multidrug resistance is one of the major obstacles to cancer chemotherapy. A common PDR mechanism is the overexpression of ATP-binding cassette (ABC) transporters, which function as drug extrusion pumps at the plasma membrane. The transcription factors of Pdrlp and Pdr3p control the expression of many ABC * Correspondingauthor. 20
VOL.
PDRI
88, 1999
from the CTZ-resistant sake yeast mutant HL176 (MA Ta/MA Ta) using PCR amplification and confirmed a unique missense point mutation that can confer a PDR phenotype on yeast. We also examined the relationship between this PDRl mutant allele, pdrl-h176, and the improved fermentative activity of HL176 in sake mash using gene substitution techniques. MATERIALS
AND METHODS
Strains, plasmids, and media The sake yeast S. cerevisiae Kyokai no. 1001 (KlOOl, MATa/MATa) was obtained from the Brewing Society of Japan. HL163, a non-urea producing strain, was isolated from KlOOl in our laboratory according to the method of Kitamoto et al. (24). HL176 is a CTZ-resistant mutant previously isolated (9) on SD medium (0.67% yeast nitrogen base without amino acids, 2% glucose) containing 20 mg/Z CTZ (Sigma Chemical Co., St. Louis, MO, USA) from HL163 treated with 3% ethyl methanesulfonate at 30°C for 1 h. An uracil auxotroph mutant, KlOOl-u3 (ura3/ura3), was isolated from KlOOl by resistance to 5fluoro-erotic acid according to the method of Boeke et al. (25). Escherichia coli strains, JM109 and JMllO, were employed as hosts for plasmid construction. The single-copy yeast shuttle plasmid vector pRS416 (26) was used to clone PDRI alleles. The E. coli plasmid vector pUCll9 was used for sequencing. The yeast integrationtype plasmid vector YIp5 (27) was employed for PDRZ allele gene substitution. The complete medium used for yeast was YPD medium (1% yeast extract, 2% peptone, 2% glucose). The medium was solidified with 2% agar if necessary to prepare plates. Transformation Frozen competent cells of JM109 (Takara Shuzo Co., Kyoto) and those of JMllO (Stratagene Cloning Systems Co., La Jolla, CA, USA) were used for E. coli transformation according to the method of Hanahan (28). Yeast strains were transformed by the lithium acetate method (29). Cloning of PDRI alleles Yeast genomic DNA was prepared by the method described by Rose et al. (30). PDRI alleles were isolated by PCR amplification from genomic DNAs of HL176 and HL163 using the following 5’ and 3’ terminal primers, respectively: CTATGTCG KTACGTAAATATCCG and TTGTCGACAGCTATT GTTTCGG. Both primers had an additional SaLI site (underlined). Amplified DNA fragments extending from nucleotide position -544 relative to the putative PDRI translation start site to 536 bp after the stop codon were inserted into the ,SalI site of pRS416. The resultant plasmids prepared from different colonies of E. coli transformants were independently introduced into KlOOl-u3 by transformation. Yeast transformants were selected by complementation of uracil auxotrophy. The drug resistance of each yeast transformant harboring an individual plasmid was examined as described below. PCR amplification was performed using LA-Taq (Takara Shuzo) as a DNA polymerase (31). Drug resistance tests Precultivated yeast cells (about 4 x lo6 cells) in SD medium were inoculated into 2 ml of SD medium containing an appropriate concentration of various drugs. The cells were cultivated at 30°C with shaking for l-2 d, and the growth of the yeast was observed. In the cases of oligomycin and chloramphenicol, 2% glycerol was used as a sole carbon source, and 0.1% peptone and 0.05% yeast extract were added
ALLELE
FROM
CTZ-RESISTANT
SAKE
YEAST
MUTANT
21
to the medium to enhance yeast growth (9). Nucleotide sequencing of PDRl alleles A 4.3-kb SaZI DNA fragment containing an entire PDRI gene from the pRS416 base plasmid described above was subcloned into the SalI site of pUC119. Deletion mutants of this plasmid were obtained using a Kilo-Sequence Deletion Kit (Takara Shuzo) after digestion with KpnI and XbaI. Both DNA strands were sequenced using an AutoCycle Sequencing Kit and an ALF Express DNA Sequencer (Amersham Pharmacia Biotech Co., Uppsala, Sweden). A pool of 2-3 clones containing each type of PDRI allele, mutant and wild, was sequenced to eliminate possible mistakes introduced during the PCR amplification step. To confirm a nucleotide change (T926C) in the open reading frame (ORF) of the PDRZ mutant allele, each PCR product amplified from genomic DNAs of HL176 and HL163 (described above) was purified by agarose electrophoresis and sequenced using two CyS-labelled primers. The sense and anti-sense primers were TGTCACTTCAAGGTATTGGTAAATG and GTT GCTCTAAATGCGTTATGTCGCA, respectively. PDRI allele gene substitution A deletion mutant plasmid (pUC-sPDR1, Fig. 2) used for sequencing, in which the coding sequence was truncated about 300 bp from the 5’ terminus and which had a mutation (T to C) at nucleotide position 926 with respect to the translation start site, was employed for the substitution of a PDRl allele of HL163. This plasmid was amplified in JMllO having the dam mutation, digested with Bsa BI, and introduced into HL163 by transformation. Transformants were selected on SD medium containing 0.1 mg/l cycloheximide. Gene substitution was confirmed by Southern blot analysis using Hybond-N nylon membrane and an ECL direct nucleic acid labeling and detection system (Amersham Pharmacia Biotech Co.) according to the maker’s directions. Genomic DNA was prepared from each transformant and digested with BstPI. A l.O-kb DNA fragment corresponding to a part of the PDRl gene (nucleotide positions 1626 to 2615 with respect to the translation start site) was amplified by PCR, and employed as a probe DNA. Northern blot analysis of the PDRS gene Northern blot analysis was performed as described previously (9). Total RNA was prepared according to the method of Jensen et al. (32). A 1.5-kb DNA fragment corresponding to a part of the PDR5 gene (nucleotide positions -121 to 1390 with respect to the translation start site) amplified by PCR, and a l.O-kb HindIII-XhoI DNA fragment of the ACTZ gene were used as DNA probes. A band of mRNA for the PDRS gene was detected by the same method as in the Southern blot analysis described above. Sake brewing tests Laboratory-scale sake brewing tests were carried out with various yeast strains in a manner essentially the same as that described by Kitamoto et al. (24), using the materials shown in Table 1. The temperature of the sake mash was maintained at 15°C through the entire fermentation period. Fermentation profiles were monitored by sampling a small portion of the mash periodically. After centrifugation, the gravity of the sample supernatant was determined by a density specific gravity meter (DA-300; Kyoto Electronics Co., Kyoto) and is expressed as the sake meter [(l/gravity - 1) x 14431. When sake meter values of the mash no longer increased (21 d from the start of the fermentation), the whole sake mash was centrifuged and the
22
MIZOGUCHI TABLE
Addition la 2 3
no.
ET AL.
J.
1. Raw materials used for sake brewing Amount of rice (g) for steaming koji 125 50 275 50 400 100
DNA binding -
275 425 750
t’298i
was obtained as freshly brewed sake. The general components of fresh sake were analyzed by the methods authorized by the National Tax Administration of Japan (33).
supernatant
RESULTS AND DISCUSSION Cloning of PDRI alleles To clarify the mutation point in the CTZ-resistant sake yeast mutants, PDRI alleles were cloned by PCR amplification, because genetic analysis of sake yeasts is very difficult to accomplish on account of their poor spore formation (34, 35). Genomic DNAs of the CTZ-resistant mutant HL176 and its parent strain HL163 were used as templates. Each amplified DNA fragment was inserted into the single-copy plasmid vector pRS416 and introduced into E. coli JM109 by transformation. Since most of the PDR1-resistant alleles are semi-dominant, and HL176 and HL163 are diploid strains for practical use, lo-15 plasmids for each template were prepared from different E. coli transformants. These plasmids were independently introduced into KlOOl-u3 by transformation, and yeast transformants were selected by complementation of uracil auxotrophy. Out of 15 yeast transformants with an individual plasmid containing a PDRI allele of HL176, 5 showed a PDR phenotype. They were resistant to cycloheximide, cerulenin, oligomycin, and CTZ. When they lost the uracil prototrophy on curing of the plasimd, their PDR phenotype disappeared. On the other hand, all 10 yeast transformants harboring a PDRZ allele of HL163 did not show any resistance to the above drugs. These results suggested that HL176 has a PDRI mutant allele (pdrl-h176) which is semi-dominant and can confer a PDR phenotype on yeast. Sequencing analysis of PDRI alleles Both strands of the whole DNA fragment (4266 bp) containing the pdrl-h176 ORF (3192 bp) were sequenced. As a control, a PDRI wild allele of HL163 was also sequenced in the same manner. The deduced amino acids sequences of both PDRI alleles of sake yeast were compared with those of S. cerevisiae laboratory strains (22). Among the laboratory strains, there are two types of PDRZ genes that can clear-
Strain
Origin
2.
Inhibitory
K30iQ
allele
Activation
309 L L L
M&l
1L309SI
F815S
1.1036W
FIG. 1. Locations of various mutations on Pdr lp. The depiction is modified from the original figure by Carvajal et al. (22); the mutation (L309S) of pdrl-hl76 (boxed) has been added. The single amino acid substitutions resulting from mutations that can confer PDR phenotypes and three domains of Pdrlp are shown below and above Pdrlp, respectively.
ly distinguish whether strains are of European or American origin (22). The PDRI gene of our sake yeast strains is similar to that of European strains except that amino acid residue 820, alanine, was replaced by a threonine as in American strains (Table 2). There were two amino acid residue differences between our sake yeast strains and the laboratory ones-443, glycine, and 855, leucine, were replaced by an arginine and a phenylalanine, respectively. When the nucleotide sequence of pdrl-h176 was compared with that of the PDRZ wild allele of HL163, one nucleotide replacement was found in the ORF region: T at position 926 was replaced by C, resulting in a change of amino acid residue 309 from leucine to serine (Table 2). This nucleotide change was confirmed by direct PCR sequencing of the genomic DNAs of HL176 and HL163. In the case of HL176, two overlapping peaks for T (wild) and C (mutant) appeared at the nucleotide position 926. In the other case of HL163, only one peak, T, was detected at the same position (data not shown). These data support our earlier finding that in pdrl-hI76 nucleotide T at 926 is replaced by C, and that HL176 is heterozygous (PDRl/pdrl-hl76) for the PDRI locus. Another nucleotide difference was observed in the 5’ non-coding region, in which A at position -361 from the translation start site was changed to G. However, PDRZ allele gene substitution experiments showed that this replacement is irrelevant to the PDR phenotype and improved fermentative activity (see below). Pdrlp belongs to a family of Gal4p-like transcription factors (22, 36), that have a ZnzCys6 motif in the region of the N-terminus. A modular structure conserved among Gal4p family members has been proposed on the basis of sequence-comparison studies (37, 38). There are three domains in Pdrlp: an N-terminal DNA binding domain containing a zinc finger motif, a central inhibitory domain consisting of eight conserved motifs, and a C-terminal acid-rich activation domain (22). The L309S substitution in pdrl-h176 is located in the conserved
Comparison of deduced amino acid sequences of PDRI PDRl
BIOENG.,
Water (ml)
a Precultured yeast cells (about 4 x lo9 cells) and lactic acid 0.8 g were added to the sake mash at the first addition.
TABLE
BIOSCI.
alleles in various strains
Amino acid residue 443 855 411 820 L A G T G L F K T R T R F K is depicted with a bold letter.
921 I IL125-2B” Europe PDRl FMll” USA PDRI T HL163 Sake yeast PDRI I HL176 Sake yeast pdrl-hl76 S I The amino acid substitution due to the mutation in pdrl-h176 a Data reported by Carvajal et al. (22). b,c N5 indicates a polyasparagine stretch, beginning at residue 1010, consisting of 5 consecutive asparagines; NIO indicates a similar 10 asparagines.
1010 N5b NlOE NSb NY
stretch of
VOL.
PDRI ALLELE
88, 1999
FROM
CTZ-RESISTANT
pUC-sPDR1
1
6.4 kb
N-terminal truncated pdrl-hl76
Mutation
SAKE
2
3
Gene
5
23
6
.-
6.0 kb ---) FIG. 4. Northern blot analysis of total RNA from transformants generated by substitutingpdrl-hl76 for a PDRI wild allele of HL163. Lane numbers are the same as indicated in Fig. 3.
recombination at BB site
12.4 kb FIG. 2. Design for substitution of a PDRI wild allele by pdrlh176. The N-terminal truncated pdrl-h176 is shown by a hatched arrow, in which the mutation point (L309S) is illustrated as an open circle. The PDRI wild allele is shown as a thick, open arrow. The yeast genomic sequence and pUCl19 are indicated with thick and thin lines, respectively. BB, BsaBI; BP, BstPI. 4
motif II in the inhibitory domain (Pig. l), and is very close to the cluster of three mutation points (P298A, K302Q and M3081) among five mutations previously described by Carvajal et al. (22) in laboratory strains. Although the mechanism by which these mutations modulate the activity of the transcription factor remains unclear, we concluded that the single L309S amino acid substitution in pdrl-hZ76 can be responsible for the PDR phenotype of the CTZ-resistant mutant HL176. PDRZ allele gene substitution Plasmids based on pRS416 were not sufficiently maintained in KlOOl-u3 during the entire fermentation period in sake mash, and no apparent improvement in the fermentative activity of transformants harboring pdrl-hZ76 was observed (data not shown). To obtain a stable transformant, a PDRI wild allele in HL163 was replaced by pdrl-hl76 utilizing gene recombination at the homologous site. 12
4
MUTANT
PDR5 -
point
ACT1 t-
YEAST
3
4
5
For this purpose, a deletion plasmid (pUC-sPDR1, Fig. 2) used for sequencing was employed. Yeast transformed with pUC-sPDR1, which was previously digested with BsaBI, was selected by cycloheximide-resistance caused by the recombination of pdrl-hl76, without conferring any selection marker on HL163. Two hybrid PDRl genes were generated on the same chromosome by the insertion of pUC-sPDR1 (Fig. 2). One had the same ORF as pdrl-h176 and an intact promoter region of a PDRI wild allele of HL163. The other had no promoter region and the ORF that was truncated about 300 bp from the translation start site. Therefore, the effect of the single amino acid substitution (L309S) in the ORF could be directly evaluated without the influence of the nucleotide replacement (A to G at -361 from the translation start site) located in the upper 5’ region of pdrlh176. Gene substitution was confirmed by Southern blot analysis. In four transformants (TF-2, TF-7, TF-17, and TF-23) out of 32 colonies appearing on the selection plates, 1 or 2 copies of pUC-sPDR1 were successfully inserted into a PDRI locus of the transformation host HL163 (Fig. 3). In both HL163 and the CTZ-resistant mutant HL176, a single 6.0-kb fragment was detected. +6
6
-6 Fermentation
FIG. 3. Southern blot analysis of transformants generated by substituting pdrl-h176 for a PDRI wild allele of HL163. Lane 1, Transformation host HL163 (PDRI/PDRl); lane 2, ‘F-2; lane 3, TF7; lane 4, TF-17; lane 5, TF-23; lane 6, CTZ-resistant mutant HL176 (PDRl/pdrl-hl76). TF-2, TF-7, TF-17, and TF-23 are the transformants (PDRl/pdrl-hl76).
time
(d)
FIG. 5. Fermentation profiles of transformants that generated by substituting pdrl-hl76 for a PDRI wild allele of HL163 in the final fermentation stage of the laboratory-scale sake brewing tests. *Sake meter, (l/gravity1) x 1443. Symbols: 0, transformation host HL163 (PDRl/PDRl); x, TF-2; 0, TF-7; A, TF-17; 0, TF-23; 0, CTZ-resistant mutant HL176 (PDRl/pdrl-hl76). TF-2, TF-7, TF-17, and TF-23 are the transformants (PDRl/pdrl-hl76).
24
MIZOGUCHI
ET AL.
J. BIOSCI. BIOENG.,
TABLE 3. Analysis of sake brewed with transformants generated by substitutingpdrl-hl76 for a PDRI wild allele of HL163 Straina
PDRI
alleles
TF-2 TF-7 TF-17 TF-23 HL163 HL176
PDRI, PDRI, PDRI, PDRI, PDRI, PDRI.
pdrl-hI76 pdrl-hl76 pdrl-hl76 pdrl-hl76 PDRI odrl-h176
msetJ$ Alcohol C-1 (%) 19.9 t-5.5 +5.2 19.6 +5.2 19.7 +4.6 19.7 -2.4 18.9 f5.5 19.7
Acidity (ml) 2.3 2.3 2.2 2.4 2.4 2.4
Amino acidity (ml) 3.1 3.2 3.2 3.4 3.7 3.2
a TF-2, TF-7, TF-17, and TF-23 are the transformants, while HL163 is the transformation host. HL176 is the CTZ-resistant mutant derived from HL-163. b Sake meter, (l/gravity1) x 1443.
Since HL163 is a diploid strain, in addition to the 6.0kb fragment either 12.4- or l&8-kb fragments were observed in the transformants. The 18.8kb fragment must have been generated by the tandem insertion of two copies of pUC-sPDR1 into the PDRI locus. In Northern blot analysis (Fig. 4), all four transformants showed strong mRNA bands for the PDRS gene, which is regulated by Pdrlp and encodes a representative ABC transporter, in the same manner as HL176. On the other hand, HL163 did not show any band for the PDRS gene. The transformants also showed completely the same PDR phenotype as HL176 and no detectable arginase activity like HL163 (data not shown) (9). The possibility of an additional mutation in the other PDRZ allele of the transformants was excluded by cloning and sequencing PDRI alleles from them. Sake brewing tests Laboratory-scale sake brewing tests with the transformants generated by substituting pdrl-h176 for a PDRI wild allele of HL163 were carried out to examine the effect of pdrl-h176 on fermentative activity. All four transformants fermented sake mash efficiently in the final fermentation stage in a similar manner to the CTZ-resistant mutant HL176 (9), whereas the transformation host HL163 did not (Fig. 5). The sake meter and alcohol concentration values in sake brewed with the transformants and HL176 were higher than those in sake made with HL163 (Table 3). The high amino acidity of HL163 may have been caused by stuck fermentation. These results supported our conclusion that a single amino acid substitution (L309S) in pdrl-h176 can be sufficient to improve the fermentative activity of sake yeast, in addition to conferring the PDR phenotype. Recently, a missense mutation (M3081) of the pdrl-2 allele (22) was also detected in another CTZ-resistant sake yeast mutant, Ffe13-9, which was previously isolated in our laboratory (9). Further studies to elucidate how a PDRI mutant allele modulates the fermentative activity of CTZ-resistant mutants are now in progress. REFERENCES 1. Oucbi, K. and Akiyama, H.: Non-foaming mutants of sake yeasts selection by cell agglutination method and by froth flotation method. Agric. Biol. Chem., 35, 1024-1032 (1971). 2. Hara, S., Sasaki, M., Obata, K., and Nojiro, K.: Isolation of ethanol-tolerant mutants from sake yeast Kyokai no. 7. J. Sot. Brew. Japan, 71, 301-304 (1976). (in Japanese) 3. Akita, O., Watanabe, T., Hasuo, T., Obata, T., and Hara, S.: Breeding of highly ethanol-tolerant sake yeasts selected by isoamyl alcohol tolerance. Hakkokogaku, 68, 95-100 (1990).
4. Kawamura, D., Kado, T., and Toh-e, A.: Breeding of sake yeast strains tolerant to low temperature. Hakkokogaku, 64, 25-27 (1986). 5. Kawamura, D., Yamasbita, T., and Tob-e, A.: Cloning and nucleotide sequence of a gene conferring ability to grow at a low temperature on Saccharomyces cerevisiae tryptophan auxotrophs. J. Ferment. Bioeng., 77, l-9 (1994). 6. Yamaguchi, H. and Iwata, K.: Antagonistic action of lipid components of membranes from Candida albiscans and various other lipids on two imidazole antimycotics, clotrimazole and miconazole. Antimicrob. Agents. Chemother., 12, 16-25 (1977). 7. Berg, D., Regel, E., Harenberg, H. E., and Plempel, M.: Bifonazole and clotrimazole. Their mode of action and the possible reason for the fungicidal behaviour of bifonazole. Arzneimittelforschung, 34, 139-146 (1984). 8. Hirohata, S., Watanabe, M., Nisbimura, A., and Kondo, K.: Brewing properties of clotrimazole-resistant mutants isolated from sake yeast. Seibutsu-kogaku, 72, 283-289 (1994). 9. Mizogucbi, H., Watanabe, M., Nisbimura, A., and Kondo, K.: Improvement of fermentative activity of sake yeast by giving resistance to clotrimazole. Seibutsu-kogaku, 76, 194-199 (1998). 10. Balzi, E. and Goffeau, A.: Multiple or pleiotropic drug resistance in yeast. Biochim. Biophys. Acta, 1073, 241-252 (1991). 11. Balzi, E. and Goffeau, A.: Genetics and biochemistry of yeast multidrug resistance. Biochim. Biophys. Acta, 1187, 152-162 (1994). 12. Balzi, E. and Goffeau, A.: Yeast multidrug resistance: the PDR network. J. Bioenerg. Biomembr., 27, 71-76 (1995). 13. Goffeau, A., Park, J., Paulsen, I. T., Jonniaux, J. L., Dinb, T., Mordant, P., and Saier, M. H., Jr.: Multidrug-resistant transport proteins in yeast: complete inventory and phylogenetic characterization of yeast open reading frames with the major facilitator superfamily. Yeast, 13, 43-54 (1997). 14. Balzi, E., Wang, M., Leterme, S., van Dyck, L., and Goffeau, A.: PDRS, a novel yeast multidrug resistance conferring transporter controlled by the transcription regulator PDRI. J. Biol. Chem., 269, 2206-2214 (1994). 15. Bissinger, P. H. and Kucbler, K.: Molecular cloning and expression of the Saccharomyces cerevisiae STSI gene product. J. Biol. Chem., 269, 4180-4186 (1994). 16. Hirata, D., Yano, K., Miyahara, K., and Miyakawa, T.: Saccharomyces cerevisiae YDRI, which encodes a member of the ATP-binding cassette (ABC) superfamily, is required for multidrug resistance. Curr. Genet., 26, 285-294 (1994). 17. Katzmann, D. J., Hallstrom, T. C., Voet, M., Wysock, W., Golin, J., Volckaert, G., and Moye-Rowley, W. S.: Expression of an ATP-binding cassette transporter-encoding gene (YORI) is required for oligomycin resistance in Saccharomyces cerevisiae. Mol. Cell. Biol., 15, 6875-6883 (1995). 18. Cui, Z., Hirata, D., Tsucbiya, E., Osada, H., and Miyakawa, T.: The multidrug resistance-associated protein (MRP) subfamily (Yrsl/Yorl) of Saccharomyces cerevisiae is important for the tolerance to a broad range of organic anions. J. Biol. Chem., 271, 14712-14716 (1996). 19. Servos, J., Haase, E., and Brendel, M.: Gene SNQ2 of Saccharomyces cerevisiae, which confers resistance to 4-nitroquinoline-N-oxide and other chemicals, encodes a 169 kDa protein homologous to ATP-dependent permeases. Mol. Cert. Genet., 236, 214-218 (1993). 20. Sanglard, D., Kucbler, K., Iscber, F., Pagani, J. L., Monod, M., and Bille, J.: Mechanisms of resistance to azole antifungal agents in Candida albicans isolated from AIDS patients involve specific multidrug transporter. Antimicrob. Agents. Chemother., 39, 2378-2386 (1995). 21. de Waard, M. A.: Molecular genetics of resistance in fungi to azole fungicides, p. 62-71. Zn Brown, T. M. (ed.), Molecular genetics and evolution of pesticide resistance (ACS symposium series, no. 645). American Chemical Society, Washington, D.C. (1996). 22. Carvajal, E., van den Hazel, H. B., Cybularz-Kolaczkowska, A., Balzi, E., and Goffeau, A.: Molecular and phenotypic
VOL.
23.
24. 25.
26. 27.
28. 29. 30.
88, 1999
PDRI ALLELE
characterization of yeast PDRl mutants that show hyperactive transcription of various ABC multidrug transporter genes. Mol. Gen. Genet., 256, 406-415 (1997). Delahodde, A., Delaveau, T., and Jacq, C.: Positive autoregulation of the yeast transcription factor Pdr3p, which is involved in control of drug resistance. Mol. Cell. Biol., 15, 4043-4051 (1995). Kitamoto, K., Oda-Miyazaki, K., Gomi, K., and Kumagai, C.: Mutant isolation of non-urea producing sake yeast by positive selection. J. Ferment. Bioeng., 75, 359-363 (1993). Boeke, J. D., LaCroute, F., and Fink, G. R.: A positive selection for mutants lacking orotidine-S-phosphate decarboxylase activity in yeast: 5-fluoro-erotic acid resistance. Mol. Gen. Genet., 197, 345-346 (1984). Sikorski, R. S. and Hieter, P.: A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevliae. Genetics, 122, 19-27 (1989). Strut& K., Stinchcomb, D. T., Scherer, S., and Davis, R. W.: High-frequency transformation of yeast: autonomous replication of hybrid DNA molecules. Proc. Natl. Acad. Sci. USA, 76, 1035-1039 (1979). Hanahan, D.: Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol., 166, 557-580 (1983). Ito, H., Fukuda, Y., Murata, K., and Kimura, A.: Transformation of intact yeast cells treated with alkali cations. J. Bacteriol., 153, 163-168 (1983). Rose, M.D., Winston, F., and Hieter, P.: Methods in yeast genetics: a laboratory course manual, p. 126-129. Cold Spring
FROM CTZ-RESISTANT
Harbor (1990). 31. 32.
33. 34.
35. 36.
37. 38.
Laboratory
SAKE YEAST MUTANT
Press, Cold Spring Harbor,
25
New York
Barnes,W.M.: PCR amplification of up to 35kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA, 91, 2216-2220 (1994). Jensen, R., Sprague, G. F., Jr., and Herskowitz, I.: Regulation of yeast mating-type interconversion: feedback control of HO gene expression by the mating-type locus. Proc. Natl. Acad. Sci. USA, 80, 3035-3039 (1983). Nishiya, T. (ed.): National Tax Administration of Japan prescript analysis methods with note (4th ed.), p. 7-33. Brewing Society of Japan, Tokyo (1993). (in Japanese) Nakazawa, N., Ashikari, T., Goto, N., Amachi, T., Nakajima, R., Harashima, S., and Oshima, Y.: Partial restoration of sporulation defect in sake yeasts, Kyokai no. 7 and no. 9, by increased dosage of the IMEI gene. J. Ferment. Bioeng., 73, 265-270 (1992). Suizu, T.: Studies on sporulation of sake yeast. Seibutsukogaku, 74, 115-123 (1996). Balzi, E., Chen, W., Ulaszewski, S., Capieaux, E., and Goffeau, A.: The multidrug resistance gene PDRI from Saccharomyces cerevisiae. J. Biol. Chem., 262, 16871-16879 (1987). Schjerling, P. and Holmberg, S.: Comparative amino acid sequence analysis of the C6 zinc cluster family of transcriptional regulators. Nucl. Acids Res., 24, 4599-4607 (1996). Poch, 0.: Conservation of a putative inhibitory domain in the GAL4 family members. Gene, 184, 229-235 (1997).
Characterization of a PDRl Mutant Allele from a Clotrimazole-Resistant Sake Yeast Mutant with Improved Fermentative Activity HIROKO MIZOGUCHI, MUTSUMI WATANABE, * AND AKIRA NISHIMURA Research & Development Department, Hakutsuru Sake Brewing Co. Ltd., 4-5-5 Sumiyoshiminami-machi, Higashinada-ku, Kobe 658-0041, Japan Received25 December199WAccepted26 March 1999 Clotrimazole-resistant mutants from various sake yeasts show improved fermentative activity in sake mash while retaining their parental advantages for sake making. These mutants also exhibit pleiotropic drug resistance (PDR) phenotypes. To investigate the relationship between the improvement of fermentative activity and PDR phenotypes, a PDRZ mutant allele (pdrl-hl76) encoding a transcription factor was cloned from a clotrlmazole-resistant mutant, HL176 (MA Ta/MA Ta), using PCR amplification. The nacleotide sequencesof pdrl-h176 and its wild allele were determined. The mutant allele contained a mlssensepoint mutation (L309S) that can confer a PDR phenotype on yeast. This amino acid substitution is located in the conserved motif II in the inhibitory domain of Pdrlp, and is very close to the cluster of three mutation points (P298A, R302Q, and M3081) described by Carvajal et al. (Mol. Gen. Genet., 256,406-415,1997) in laboratory strains. A PDRI wild allele of HL163, the parent strain of HL176, was replaced by pdrl-h176 using gene recombination at the homologous site. The resultant transformants (PDRZ/pdrl-hl7d) showed the same PDR phenotype as HL176, and they fermented sake mash efficiently even in the linal fermentation stage, while HL163 did not. The amino acid substitution (L309S) in pdrl-h176 was considered to be sufficient to improve the fermentative activity of sake yeast, in addition to conferring the PDR phenotype. [Key
words: clotrimazole, pleiotropic drug resistance,PDRI, sake yeast, improved fermentative activity] transporter-encoding genes including PDRS, YORl, and SNQ2 (12). PdrSp pumps out various drugs such as cycloheximide, cerulenin, chloramphenicol, sulfometuron methyl, and azole fungicides (14-16) while Yorlp extrudes oligomycin and anionic drugs like reveromycin A and acetic acid (17, 18). The SrVQ2 gene has been cloned and found to be responsible for resistance to a mutagen, 4-nitroquinoline-N-oxide (19). Some clinical Candida albicans isolates from AIDS patients with oropharyngeal candidasis who had been treated with high doses of fluconazole, an azole fungicide, for long periods showed PDR phenotypes and amplification of the mRNA levels for the CDRZ gene encoding an ABC transporter (20). Besides this, a well-characterized mechanism for azole resistance in filamentous fungi is increased energy-dependent efflux of azoles from the mycelium of laboratory-generated mutants (21). Amplification of the mRNA levels of the PDRS gene was observed in our CTZ-resistant mutants (9). The fact that they showed resistance to oligomycin besides various other drugs including CTZ suggests that in addition to the PDRS gene, YORI is simultaneously overexpressed in these mutants. A large number of PDR mutants have been isolated from Saccharomyces cerevisiae laboratory strains. Genetic and complementary studies have revealed that the majority of these mutants possess a single semidominant mutation at the PDRZ locus (10, 22). The PDRI gene encodes the transcription factor that controls the expression of many ABC transporter-encoding genes simultaneously. On the other hand, the PDR3 gene, a PDRI homologue, is regulated by Pdrlp and is autoregulated by its own product Pdr3p (23). In the work reported here, we cloned PDRI alleles
Sake fermentation is performed at lo-15°C and the final alcohol concentration reaches up to 20% (v/v). More than 3 weeks are usually needed to complete the fermentation. Sometimes, the fermentation becomes stuck in the final stage, lowering the quality of the resultant sake. Because of this, many studies have been done to isolate various mutant strains with improved fermentative activity (l-5). Clotrimazole (CTZ) is one of the azole fungicides that inhibit cytochrome P-450 lanosterol 14a-demethylase (EC 1.14.14.1) in the ergosterol biosynthesis pathway (6, 7). Sake yeast mutants resistant to CTZ have been isolated from several different parental strains. Most of them ferment sake mash faster and produce higher amounts of alcohol than their parent strains, while retaining their parental advantages for sake making (8, 9). These mutants have been found to be resistant not only to other azole fungicides but also to a wide range of unrelated cytotoxic compounds including cycloheximide, cerulenin, chloramphenicol, sulfometuron methyl, and oligomycin (9). Since the chemical structures of these compounds and their actions toward yeast cells differ widely among them, CTZ-resistant mutants display pleiotropic drug resistance (PDR) phenotypes. PDR phenomena in yeast have been extensively studied as models of the multidrug resistance of cancer cells (10-13). Multidrug resistance is one of the major obstacles to cancer chemotherapy. A common PDR mechanism is the overexpression of ATP-binding cassette (ABC) transporters, which function as drug extrusion pumps at the plasma membrane. The transcription factors of Pdrlp and Pdr3p control the expression of many ABC * Correspondingauthor. 20
VOL.
PDRI
88, 1999
from the CTZ-resistant sake yeast mutant HL176 (MA Ta/MA Ta) using PCR amplification and confirmed a unique missense point mutation that can confer a PDR phenotype on yeast. We also examined the relationship between this PDRl mutant allele, pdrl-h176, and the improved fermentative activity of HL176 in sake mash using gene substitution techniques. MATERIALS
AND METHODS
Strains, plasmids, and media The sake yeast S. cerevisiae Kyokai no. 1001 (KlOOl, MATa/MATa) was obtained from the Brewing Society of Japan. HL163, a non-urea producing strain, was isolated from KlOOl in our laboratory according to the method of Kitamoto et al. (24). HL176 is a CTZ-resistant mutant previously isolated (9) on SD medium (0.67% yeast nitrogen base without amino acids, 2% glucose) containing 20 mg/Z CTZ (Sigma Chemical Co., St. Louis, MO, USA) from HL163 treated with 3% ethyl methanesulfonate at 30°C for 1 h. An uracil auxotroph mutant, KlOOl-u3 (ura3/ura3), was isolated from KlOOl by resistance to 5fluoro-erotic acid according to the method of Boeke et al. (25). Escherichia coli strains, JM109 and JMllO, were employed as hosts for plasmid construction. The single-copy yeast shuttle plasmid vector pRS416 (26) was used to clone PDRI alleles. The E. coli plasmid vector pUCll9 was used for sequencing. The yeast integrationtype plasmid vector YIp5 (27) was employed for PDRZ allele gene substitution. The complete medium used for yeast was YPD medium (1% yeast extract, 2% peptone, 2% glucose). The medium was solidified with 2% agar if necessary to prepare plates. Transformation Frozen competent cells of JM109 (Takara Shuzo Co., Kyoto) and those of JMllO (Stratagene Cloning Systems Co., La Jolla, CA, USA) were used for E. coli transformation according to the method of Hanahan (28). Yeast strains were transformed by the lithium acetate method (29). Cloning of PDRI alleles Yeast genomic DNA was prepared by the method described by Rose et al. (30). PDRI alleles were isolated by PCR amplification from genomic DNAs of HL176 and HL163 using the following 5’ and 3’ terminal primers, respectively: CTATGTCG KTACGTAAATATCCG and TTGTCGACAGCTATT GTTTCGG. Both primers had an additional SaLI site (underlined). Amplified DNA fragments extending from nucleotide position -544 relative to the putative PDRI translation start site to 536 bp after the stop codon were inserted into the ,SalI site of pRS416. The resultant plasmids prepared from different colonies of E. coli transformants were independently introduced into KlOOl-u3 by transformation. Yeast transformants were selected by complementation of uracil auxotrophy. The drug resistance of each yeast transformant harboring an individual plasmid was examined as described below. PCR amplification was performed using LA-Taq (Takara Shuzo) as a DNA polymerase (31). Drug resistance tests Precultivated yeast cells (about 4 x lo6 cells) in SD medium were inoculated into 2 ml of SD medium containing an appropriate concentration of various drugs. The cells were cultivated at 30°C with shaking for l-2 d, and the growth of the yeast was observed. In the cases of oligomycin and chloramphenicol, 2% glycerol was used as a sole carbon source, and 0.1% peptone and 0.05% yeast extract were added
ALLELE
FROM
CTZ-RESISTANT
SAKE
YEAST
MUTANT
21
to the medium to enhance yeast growth (9). Nucleotide sequencing of PDRl alleles A 4.3-kb SaZI DNA fragment containing an entire PDRI gene from the pRS416 base plasmid described above was subcloned into the SalI site of pUC119. Deletion mutants of this plasmid were obtained using a Kilo-Sequence Deletion Kit (Takara Shuzo) after digestion with KpnI and XbaI. Both DNA strands were sequenced using an AutoCycle Sequencing Kit and an ALF Express DNA Sequencer (Amersham Pharmacia Biotech Co., Uppsala, Sweden). A pool of 2-3 clones containing each type of PDRI allele, mutant and wild, was sequenced to eliminate possible mistakes introduced during the PCR amplification step. To confirm a nucleotide change (T926C) in the open reading frame (ORF) of the PDRZ mutant allele, each PCR product amplified from genomic DNAs of HL176 and HL163 (described above) was purified by agarose electrophoresis and sequenced using two CyS-labelled primers. The sense and anti-sense primers were TGTCACTTCAAGGTATTGGTAAATG and GTT GCTCTAAATGCGTTATGTCGCA, respectively. PDRI allele gene substitution A deletion mutant plasmid (pUC-sPDR1, Fig. 2) used for sequencing, in which the coding sequence was truncated about 300 bp from the 5’ terminus and which had a mutation (T to C) at nucleotide position 926 with respect to the translation start site, was employed for the substitution of a PDRl allele of HL163. This plasmid was amplified in JMllO having the dam mutation, digested with Bsa BI, and introduced into HL163 by transformation. Transformants were selected on SD medium containing 0.1 mg/l cycloheximide. Gene substitution was confirmed by Southern blot analysis using Hybond-N nylon membrane and an ECL direct nucleic acid labeling and detection system (Amersham Pharmacia Biotech Co.) according to the maker’s directions. Genomic DNA was prepared from each transformant and digested with BstPI. A l.O-kb DNA fragment corresponding to a part of the PDRl gene (nucleotide positions 1626 to 2615 with respect to the translation start site) was amplified by PCR, and employed as a probe DNA. Northern blot analysis of the PDRS gene Northern blot analysis was performed as described previously (9). Total RNA was prepared according to the method of Jensen et al. (32). A 1.5-kb DNA fragment corresponding to a part of the PDR5 gene (nucleotide positions -121 to 1390 with respect to the translation start site) amplified by PCR, and a l.O-kb HindIII-XhoI DNA fragment of the ACTZ gene were used as DNA probes. A band of mRNA for the PDRS gene was detected by the same method as in the Southern blot analysis described above. Sake brewing tests Laboratory-scale sake brewing tests were carried out with various yeast strains in a manner essentially the same as that described by Kitamoto et al. (24), using the materials shown in Table 1. The temperature of the sake mash was maintained at 15°C through the entire fermentation period. Fermentation profiles were monitored by sampling a small portion of the mash periodically. After centrifugation, the gravity of the sample supernatant was determined by a density specific gravity meter (DA-300; Kyoto Electronics Co., Kyoto) and is expressed as the sake meter [(l/gravity - 1) x 14431. When sake meter values of the mash no longer increased (21 d from the start of the fermentation), the whole sake mash was centrifuged and the
22
MIZOGUCHI TABLE
Addition la 2 3
no.
ET AL.
J.
1. Raw materials used for sake brewing Amount of rice (g) for steaming koji 125 50 275 50 400 100
DNA binding -
275 425 750
t’298i
was obtained as freshly brewed sake. The general components of fresh sake were analyzed by the methods authorized by the National Tax Administration of Japan (33).
supernatant
RESULTS AND DISCUSSION Cloning of PDRI alleles To clarify the mutation point in the CTZ-resistant sake yeast mutants, PDRI alleles were cloned by PCR amplification, because genetic analysis of sake yeasts is very difficult to accomplish on account of their poor spore formation (34, 35). Genomic DNAs of the CTZ-resistant mutant HL176 and its parent strain HL163 were used as templates. Each amplified DNA fragment was inserted into the single-copy plasmid vector pRS416 and introduced into E. coli JM109 by transformation. Since most of the PDR1-resistant alleles are semi-dominant, and HL176 and HL163 are diploid strains for practical use, lo-15 plasmids for each template were prepared from different E. coli transformants. These plasmids were independently introduced into KlOOl-u3 by transformation, and yeast transformants were selected by complementation of uracil auxotrophy. Out of 15 yeast transformants with an individual plasmid containing a PDRI allele of HL176, 5 showed a PDR phenotype. They were resistant to cycloheximide, cerulenin, oligomycin, and CTZ. When they lost the uracil prototrophy on curing of the plasimd, their PDR phenotype disappeared. On the other hand, all 10 yeast transformants harboring a PDRZ allele of HL163 did not show any resistance to the above drugs. These results suggested that HL176 has a PDRI mutant allele (pdrl-h176) which is semi-dominant and can confer a PDR phenotype on yeast. Sequencing analysis of PDRI alleles Both strands of the whole DNA fragment (4266 bp) containing the pdrl-h176 ORF (3192 bp) were sequenced. As a control, a PDRI wild allele of HL163 was also sequenced in the same manner. The deduced amino acids sequences of both PDRI alleles of sake yeast were compared with those of S. cerevisiae laboratory strains (22). Among the laboratory strains, there are two types of PDRZ genes that can clear-
Strain
Origin
2.
Inhibitory
K30iQ
allele
Activation
309 L L L
M&l
1L309SI
F815S
1.1036W
FIG. 1. Locations of various mutations on Pdr lp. The depiction is modified from the original figure by Carvajal et al. (22); the mutation (L309S) of pdrl-hl76 (boxed) has been added. The single amino acid substitutions resulting from mutations that can confer PDR phenotypes and three domains of Pdrlp are shown below and above Pdrlp, respectively.
ly distinguish whether strains are of European or American origin (22). The PDRI gene of our sake yeast strains is similar to that of European strains except that amino acid residue 820, alanine, was replaced by a threonine as in American strains (Table 2). There were two amino acid residue differences between our sake yeast strains and the laboratory ones-443, glycine, and 855, leucine, were replaced by an arginine and a phenylalanine, respectively. When the nucleotide sequence of pdrl-h176 was compared with that of the PDRZ wild allele of HL163, one nucleotide replacement was found in the ORF region: T at position 926 was replaced by C, resulting in a change of amino acid residue 309 from leucine to serine (Table 2). This nucleotide change was confirmed by direct PCR sequencing of the genomic DNAs of HL176 and HL163. In the case of HL176, two overlapping peaks for T (wild) and C (mutant) appeared at the nucleotide position 926. In the other case of HL163, only one peak, T, was detected at the same position (data not shown). These data support our earlier finding that in pdrl-hI76 nucleotide T at 926 is replaced by C, and that HL176 is heterozygous (PDRl/pdrl-hl76) for the PDRI locus. Another nucleotide difference was observed in the 5’ non-coding region, in which A at position -361 from the translation start site was changed to G. However, PDRZ allele gene substitution experiments showed that this replacement is irrelevant to the PDR phenotype and improved fermentative activity (see below). Pdrlp belongs to a family of Gal4p-like transcription factors (22, 36), that have a ZnzCys6 motif in the region of the N-terminus. A modular structure conserved among Gal4p family members has been proposed on the basis of sequence-comparison studies (37, 38). There are three domains in Pdrlp: an N-terminal DNA binding domain containing a zinc finger motif, a central inhibitory domain consisting of eight conserved motifs, and a C-terminal acid-rich activation domain (22). The L309S substitution in pdrl-h176 is located in the conserved
Comparison of deduced amino acid sequences of PDRI PDRl
BIOENG.,
Water (ml)
a Precultured yeast cells (about 4 x lo9 cells) and lactic acid 0.8 g were added to the sake mash at the first addition.
TABLE
BIOSCI.
alleles in various strains
Amino acid residue 443 855 411 820 L A G T G L F K T R T R F K is depicted with a bold letter.
921 I IL125-2B” Europe PDRl FMll” USA PDRI T HL163 Sake yeast PDRI I HL176 Sake yeast pdrl-hl76 S I The amino acid substitution due to the mutation in pdrl-h176 a Data reported by Carvajal et al. (22). b,c N5 indicates a polyasparagine stretch, beginning at residue 1010, consisting of 5 consecutive asparagines; NIO indicates a similar 10 asparagines.
1010 N5b NlOE NSb NY
stretch of
VOL.
PDRI ALLELE
88, 1999
FROM
CTZ-RESISTANT
pUC-sPDR1
1
6.4 kb
N-terminal truncated pdrl-hl76
Mutation
SAKE
2
3
Gene
5
23
6
.-
6.0 kb ---) FIG. 4. Northern blot analysis of total RNA from transformants generated by substitutingpdrl-hl76 for a PDRI wild allele of HL163. Lane numbers are the same as indicated in Fig. 3.
recombination at BB site
12.4 kb FIG. 2. Design for substitution of a PDRI wild allele by pdrlh176. The N-terminal truncated pdrl-h176 is shown by a hatched arrow, in which the mutation point (L309S) is illustrated as an open circle. The PDRI wild allele is shown as a thick, open arrow. The yeast genomic sequence and pUCl19 are indicated with thick and thin lines, respectively. BB, BsaBI; BP, BstPI. 4
motif II in the inhibitory domain (Pig. l), and is very close to the cluster of three mutation points (P298A, K302Q and M3081) among five mutations previously described by Carvajal et al. (22) in laboratory strains. Although the mechanism by which these mutations modulate the activity of the transcription factor remains unclear, we concluded that the single L309S amino acid substitution in pdrl-hZ76 can be responsible for the PDR phenotype of the CTZ-resistant mutant HL176. PDRZ allele gene substitution Plasmids based on pRS416 were not sufficiently maintained in KlOOl-u3 during the entire fermentation period in sake mash, and no apparent improvement in the fermentative activity of transformants harboring pdrl-hZ76 was observed (data not shown). To obtain a stable transformant, a PDRI wild allele in HL163 was replaced by pdrl-hl76 utilizing gene recombination at the homologous site. 12
4
MUTANT
PDR5 -
point
ACT1 t-
YEAST
3
4
5
For this purpose, a deletion plasmid (pUC-sPDR1, Fig. 2) used for sequencing was employed. Yeast transformed with pUC-sPDR1, which was previously digested with BsaBI, was selected by cycloheximide-resistance caused by the recombination of pdrl-hl76, without conferring any selection marker on HL163. Two hybrid PDRl genes were generated on the same chromosome by the insertion of pUC-sPDR1 (Fig. 2). One had the same ORF as pdrl-h176 and an intact promoter region of a PDRI wild allele of HL163. The other had no promoter region and the ORF that was truncated about 300 bp from the translation start site. Therefore, the effect of the single amino acid substitution (L309S) in the ORF could be directly evaluated without the influence of the nucleotide replacement (A to G at -361 from the translation start site) located in the upper 5’ region of pdrlh176. Gene substitution was confirmed by Southern blot analysis. In four transformants (TF-2, TF-7, TF-17, and TF-23) out of 32 colonies appearing on the selection plates, 1 or 2 copies of pUC-sPDR1 were successfully inserted into a PDRI locus of the transformation host HL163 (Fig. 3). In both HL163 and the CTZ-resistant mutant HL176, a single 6.0-kb fragment was detected. +6
6
-6 Fermentation
FIG. 3. Southern blot analysis of transformants generated by substituting pdrl-h176 for a PDRI wild allele of HL163. Lane 1, Transformation host HL163 (PDRI/PDRl); lane 2, ‘F-2; lane 3, TF7; lane 4, TF-17; lane 5, TF-23; lane 6, CTZ-resistant mutant HL176 (PDRl/pdrl-hl76). TF-2, TF-7, TF-17, and TF-23 are the transformants (PDRl/pdrl-hl76).
time
(d)
FIG. 5. Fermentation profiles of transformants that generated by substituting pdrl-hl76 for a PDRI wild allele of HL163 in the final fermentation stage of the laboratory-scale sake brewing tests. *Sake meter, (l/gravity1) x 1443. Symbols: 0, transformation host HL163 (PDRl/PDRl); x, TF-2; 0, TF-7; A, TF-17; 0, TF-23; 0, CTZ-resistant mutant HL176 (PDRl/pdrl-hl76). TF-2, TF-7, TF-17, and TF-23 are the transformants (PDRl/pdrl-hl76).
24
MIZOGUCHI
ET AL.
J. BIOSCI. BIOENG.,
TABLE 3. Analysis of sake brewed with transformants generated by substitutingpdrl-hl76 for a PDRI wild allele of HL163 Straina
PDRI
alleles
TF-2 TF-7 TF-17 TF-23 HL163 HL176
PDRI, PDRI, PDRI, PDRI, PDRI, PDRI.
pdrl-hI76 pdrl-hl76 pdrl-hl76 pdrl-hl76 PDRI odrl-h176
msetJ$ Alcohol C-1 (%) 19.9 t-5.5 +5.2 19.6 +5.2 19.7 +4.6 19.7 -2.4 18.9 f5.5 19.7
Acidity (ml) 2.3 2.3 2.2 2.4 2.4 2.4
Amino acidity (ml) 3.1 3.2 3.2 3.4 3.7 3.2
a TF-2, TF-7, TF-17, and TF-23 are the transformants, while HL163 is the transformation host. HL176 is the CTZ-resistant mutant derived from HL-163. b Sake meter, (l/gravity1) x 1443.
Since HL163 is a diploid strain, in addition to the 6.0kb fragment either 12.4- or l&8-kb fragments were observed in the transformants. The 18.8kb fragment must have been generated by the tandem insertion of two copies of pUC-sPDR1 into the PDRI locus. In Northern blot analysis (Fig. 4), all four transformants showed strong mRNA bands for the PDRS gene, which is regulated by Pdrlp and encodes a representative ABC transporter, in the same manner as HL176. On the other hand, HL163 did not show any band for the PDRS gene. The transformants also showed completely the same PDR phenotype as HL176 and no detectable arginase activity like HL163 (data not shown) (9). The possibility of an additional mutation in the other PDRZ allele of the transformants was excluded by cloning and sequencing PDRI alleles from them. Sake brewing tests Laboratory-scale sake brewing tests with the transformants generated by substituting pdrl-h176 for a PDRI wild allele of HL163 were carried out to examine the effect of pdrl-h176 on fermentative activity. All four transformants fermented sake mash efficiently in the final fermentation stage in a similar manner to the CTZ-resistant mutant HL176 (9), whereas the transformation host HL163 did not (Fig. 5). The sake meter and alcohol concentration values in sake brewed with the transformants and HL176 were higher than those in sake made with HL163 (Table 3). The high amino acidity of HL163 may have been caused by stuck fermentation. These results supported our conclusion that a single amino acid substitution (L309S) in pdrl-h176 can be sufficient to improve the fermentative activity of sake yeast, in addition to conferring the PDR phenotype. Recently, a missense mutation (M3081) of the pdrl-2 allele (22) was also detected in another CTZ-resistant sake yeast mutant, Ffe13-9, which was previously isolated in our laboratory (9). Further studies to elucidate how a PDRI mutant allele modulates the fermentative activity of CTZ-resistant mutants are now in progress. REFERENCES 1. Oucbi, K. and Akiyama, H.: Non-foaming mutants of sake yeasts selection by cell agglutination method and by froth flotation method. Agric. Biol. Chem., 35, 1024-1032 (1971). 2. Hara, S., Sasaki, M., Obata, K., and Nojiro, K.: Isolation of ethanol-tolerant mutants from sake yeast Kyokai no. 7. J. Sot. Brew. Japan, 71, 301-304 (1976). (in Japanese) 3. Akita, O., Watanabe, T., Hasuo, T., Obata, T., and Hara, S.: Breeding of highly ethanol-tolerant sake yeasts selected by isoamyl alcohol tolerance. Hakkokogaku, 68, 95-100 (1990).
4. Kawamura, D., Kado, T., and Toh-e, A.: Breeding of sake yeast strains tolerant to low temperature. Hakkokogaku, 64, 25-27 (1986). 5. Kawamura, D., Yamasbita, T., and Tob-e, A.: Cloning and nucleotide sequence of a gene conferring ability to grow at a low temperature on Saccharomyces cerevisiae tryptophan auxotrophs. J. Ferment. Bioeng., 77, l-9 (1994). 6. Yamaguchi, H. and Iwata, K.: Antagonistic action of lipid components of membranes from Candida albiscans and various other lipids on two imidazole antimycotics, clotrimazole and miconazole. Antimicrob. Agents. Chemother., 12, 16-25 (1977). 7. Berg, D., Regel, E., Harenberg, H. E., and Plempel, M.: Bifonazole and clotrimazole. Their mode of action and the possible reason for the fungicidal behaviour of bifonazole. Arzneimittelforschung, 34, 139-146 (1984). 8. Hirohata, S., Watanabe, M., Nisbimura, A., and Kondo, K.: Brewing properties of clotrimazole-resistant mutants isolated from sake yeast. Seibutsu-kogaku, 72, 283-289 (1994). 9. Mizogucbi, H., Watanabe, M., Nisbimura, A., and Kondo, K.: Improvement of fermentative activity of sake yeast by giving resistance to clotrimazole. Seibutsu-kogaku, 76, 194-199 (1998). 10. Balzi, E. and Goffeau, A.: Multiple or pleiotropic drug resistance in yeast. Biochim. Biophys. Acta, 1073, 241-252 (1991). 11. Balzi, E. and Goffeau, A.: Genetics and biochemistry of yeast multidrug resistance. Biochim. Biophys. Acta, 1187, 152-162 (1994). 12. Balzi, E. and Goffeau, A.: Yeast multidrug resistance: the PDR network. J. Bioenerg. Biomembr., 27, 71-76 (1995). 13. Goffeau, A., Park, J., Paulsen, I. T., Jonniaux, J. L., Dinb, T., Mordant, P., and Saier, M. H., Jr.: Multidrug-resistant transport proteins in yeast: complete inventory and phylogenetic characterization of yeast open reading frames with the major facilitator superfamily. Yeast, 13, 43-54 (1997). 14. Balzi, E., Wang, M., Leterme, S., van Dyck, L., and Goffeau, A.: PDRS, a novel yeast multidrug resistance conferring transporter controlled by the transcription regulator PDRI. J. Biol. Chem., 269, 2206-2214 (1994). 15. Bissinger, P. H. and Kucbler, K.: Molecular cloning and expression of the Saccharomyces cerevisiae STSI gene product. J. Biol. Chem., 269, 4180-4186 (1994). 16. Hirata, D., Yano, K., Miyahara, K., and Miyakawa, T.: Saccharomyces cerevisiae YDRI, which encodes a member of the ATP-binding cassette (ABC) superfamily, is required for multidrug resistance. Curr. Genet., 26, 285-294 (1994). 17. Katzmann, D. J., Hallstrom, T. C., Voet, M., Wysock, W., Golin, J., Volckaert, G., and Moye-Rowley, W. S.: Expression of an ATP-binding cassette transporter-encoding gene (YORI) is required for oligomycin resistance in Saccharomyces cerevisiae. Mol. Cell. Biol., 15, 6875-6883 (1995). 18. Cui, Z., Hirata, D., Tsucbiya, E., Osada, H., and Miyakawa, T.: The multidrug resistance-associated protein (MRP) subfamily (Yrsl/Yorl) of Saccharomyces cerevisiae is important for the tolerance to a broad range of organic anions. J. Biol. Chem., 271, 14712-14716 (1996). 19. Servos, J., Haase, E., and Brendel, M.: Gene SNQ2 of Saccharomyces cerevisiae, which confers resistance to 4-nitroquinoline-N-oxide and other chemicals, encodes a 169 kDa protein homologous to ATP-dependent permeases. Mol. Cert. Genet., 236, 214-218 (1993). 20. Sanglard, D., Kucbler, K., Iscber, F., Pagani, J. L., Monod, M., and Bille, J.: Mechanisms of resistance to azole antifungal agents in Candida albicans isolated from AIDS patients involve specific multidrug transporter. Antimicrob. Agents. Chemother., 39, 2378-2386 (1995). 21. de Waard, M. A.: Molecular genetics of resistance in fungi to azole fungicides, p. 62-71. Zn Brown, T. M. (ed.), Molecular genetics and evolution of pesticide resistance (ACS symposium series, no. 645). American Chemical Society, Washington, D.C. (1996). 22. Carvajal, E., van den Hazel, H. B., Cybularz-Kolaczkowska, A., Balzi, E., and Goffeau, A.: Molecular and phenotypic
VOL.
23.
24. 25.
26. 27.
28. 29. 30.
88, 1999
PDRI ALLELE
characterization of yeast PDRl mutants that show hyperactive transcription of various ABC multidrug transporter genes. Mol. Gen. Genet., 256, 406-415 (1997). Delahodde, A., Delaveau, T., and Jacq, C.: Positive autoregulation of the yeast transcription factor Pdr3p, which is involved in control of drug resistance. Mol. Cell. Biol., 15, 4043-4051 (1995). Kitamoto, K., Oda-Miyazaki, K., Gomi, K., and Kumagai, C.: Mutant isolation of non-urea producing sake yeast by positive selection. J. Ferment. Bioeng., 75, 359-363 (1993). Boeke, J. D., LaCroute, F., and Fink, G. R.: A positive selection for mutants lacking orotidine-S-phosphate decarboxylase activity in yeast: 5-fluoro-erotic acid resistance. Mol. Gen. Genet., 197, 345-346 (1984). Sikorski, R. S. and Hieter, P.: A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevliae. Genetics, 122, 19-27 (1989). Strut& K., Stinchcomb, D. T., Scherer, S., and Davis, R. W.: High-frequency transformation of yeast: autonomous replication of hybrid DNA molecules. Proc. Natl. Acad. Sci. USA, 76, 1035-1039 (1979). Hanahan, D.: Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol., 166, 557-580 (1983). Ito, H., Fukuda, Y., Murata, K., and Kimura, A.: Transformation of intact yeast cells treated with alkali cations. J. Bacteriol., 153, 163-168 (1983). Rose, M.D., Winston, F., and Hieter, P.: Methods in yeast genetics: a laboratory course manual, p. 126-129. Cold Spring
FROM CTZ-RESISTANT
Harbor (1990). 31. 32.
33. 34.
35. 36.
37. 38.
Laboratory
SAKE YEAST MUTANT
Press, Cold Spring Harbor,
25
New York
Barnes,W.M.: PCR amplification of up to 35kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA, 91, 2216-2220 (1994). Jensen, R., Sprague, G. F., Jr., and Herskowitz, I.: Regulation of yeast mating-type interconversion: feedback control of HO gene expression by the mating-type locus. Proc. Natl. Acad. Sci. USA, 80, 3035-3039 (1983). Nishiya, T. (ed.): National Tax Administration of Japan prescript analysis methods with note (4th ed.), p. 7-33. Brewing Society of Japan, Tokyo (1993). (in Japanese) Nakazawa, N., Ashikari, T., Goto, N., Amachi, T., Nakajima, R., Harashima, S., and Oshima, Y.: Partial restoration of sporulation defect in sake yeasts, Kyokai no. 7 and no. 9, by increased dosage of the IMEI gene. J. Ferment. Bioeng., 73, 265-270 (1992). Suizu, T.: Studies on sporulation of sake yeast. Seibutsukogaku, 74, 115-123 (1996). Balzi, E., Chen, W., Ulaszewski, S., Capieaux, E., and Goffeau, A.: The multidrug resistance gene PDRI from Saccharomyces cerevisiae. J. Biol. Chem., 262, 16871-16879 (1987). Schjerling, P. and Holmberg, S.: Comparative amino acid sequence analysis of the C6 zinc cluster family of transcriptional regulators. Nucl. Acids Res., 24, 4599-4607 (1996). Poch, 0.: Conservation of a putative inhibitory domain in the GAL4 family members. Gene, 184, 229-235 (1997).