Characterization of a recombinant human calicivirus capsid protein expressed in mammalian cells

Virus Research 55 (1998) 129 – 141

Characterization of a recombinant human calicivirus capsid protein expressed in mammalian cells Maria A. Pletneva, Stanislav V. Sosnovtsev, Svetlana A. Sosnovtseva, Kim Y. Green * Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 9000 Rock6ille Pike, Building 7, Room 137, Bethesda, MD 20892, USA Received 10 December 1997; received in revised form 6 March 1998; accepted 12 March 1998

Abstract The capsid protein of the Hawaii strain of human calicivirus was expressed in the transient MVA/bacteriophage T7 polymerase hybrid expression system in order to examine its processing in mammalian cells. Selected amino acid modifications (an insertion, deletion, and substitution) at the predicted amino terminus of the capsid protein as well as the presence or absence of the ORF3 gene were examined for their effect on capsid expression. The protein was expressed efficiently in cell lines derived from three different species, with most of the expressed protein remaining localized within the cells. There was no evidence for N-linked glycosylation or myristylation of the 57 kDa capsid protein. Hawaii virus-like particles (HV VLPs), efficiently produced in the baculovirus expression system, were not observed in this expression system under the conditions in this study. © 1998 Published by Elsevier Science B.V. All rights reserved. Keywords: Human calicivirus; Calicivirus capsid; Calcivirus; Hawaii virus; Hawaii virus capsid; MVA/T7 system

1. Introduction Norwalk virus (NV) and other human caliciviruses (HuCV), members of the Caliciviridae family of positive-sense, single-stranded RNA viruses, are pathogens associated with epidemic gastroenteritis (Kapikian et al., 1996). Outbreaks can occur in families, schools, and social commu* Corresponding author. Tel.: + 1 301 4965811; fax: +1 301 496312; e-mail: [email protected]

nities via person-to-person contact or through the ingestion of contaminated food and water. Human caliciviruses cannot be propagated in cell culture and a practical laboratory animal model is not available (Kapikian et al., 1996). Therefore, many biological and molecular features of these viruses have not been well characterized. Sequence analysis of the NV, Southampton virus (SHV), and Lordsdale (LD) HuCV genomes demonstrated the presence of three long ORFs (Jiang et al., 1993; Lambden et al., 1993; Dingle et

0168-1702/98/$19.00 © 1998 Published by Elsevier Science B.V. All rights reserved. PII S0168-1702(98)00045-8

130

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

al., 1995). The first ORF (ORF1), beginning near the 5% end of the genome, encodes a nonstructural polyprotein that undergoes auto-proteolytic processing (Lui et al., 1996). The second ORF (ORF2) encodes the capsid protein, the major structural protein of the virus. A third ORF (ORF3), located at the 3% end of the genome, encodes a protein of unknown function. Although little is known about the replication of HuCV in cells, it is assumed, based on studies of other caliciviruses, that a viral subgenomic messenger RNA containing the ORF2 and ORF3 is produced in infected cells that serves as a template for the efficient translation of the capsid protein. There is suggestive evidence that the HuCV subgenomic RNA may be packaged into virus particles (Jiang et al., 1993) similar to that of an animal calicivirus, rabbit hemorrhagic disease virus (RHDV) (Meyers et al., 1991). Hawaii virus was first identified in 1977 in the stool of a volunteer who was challenged orally with a stool filtrate derived from an individual involved in a 1971 family outbreak of gastroenteritis that occurred in Honolulu, Hawaii (Thornhill et al., 1977). Sequence analysis of part of the HV genome, including that encoding the viral capsid protein, identified it as a member of the Calici6iridae that was genetically distinct from NV (Lew et al., 1994). Further molecular characterization of additional strains showed that many of the viruses associated with epidemic gastroenteritis segregated into two major genetic groups that have been designated genogroup I (‘NV-like’) or genogroup II (‘HV-like’ or ‘Snow Mountain virus-like’) (reviewed in Lambden and Clarke, 1995). We recently reported that the 57 kDa HV capsid protein self-assembles into virus-like particles (VLPs) when expressed by a baculovirus recombinant (Green et al., 1997). The baculovirus expression system has been important for providing an unlimited source of calicivirus capsid protein for use in structure and function studies and diagnostic assays (Jiang et al., 1992b). However, little is known about the expression and processing of HuCV capsid proteins in mammalian cells and the purpose of our present work was to develop such a system for the study of HuCV capsid proteins.

2. Materials and methods

2.1. Cells and 6iruses Human colon carcinoma (CaCo-2) cells, adenovirus-transformed primary human embryonic kidney (293) cells, African Green monkey kidney (CV-1) cells, and Crandell–Rees feline kidney (CRFK) cells were utilized in this study. CV-1, CRFK, and 293 cells were grown in minimum essential medium with Earle’s balanced salts (EMEM) supplemented with 10% fetal bovine serum (FBS), 1% amphotericin B, and 1% GASP (Quality Biological). CaCo-2 cells were grown in medium 199 supplemented with 10% FBS, 1% GASP, 1% amphotericin B, 1% nonessential amino acids, and 1% sodium pyruvate (Quality Biological). A host-restricted, avian adapted strain of vaccinia virus carrying the gene for bacteriophage T7 polymerase (MVA/T7 pol) (Wyatt et al., 1995) was used to infect all cell lines.

2.2. Construction of recombinant pTM-1 plasmid 6ectors DNA fragments were generated by PCR with synthetic oligonucleotides E296 (5%CTAATAGCGGCCGCATTACTGCACTCTTCTGCGCC3%) and E288 (5%GATGTGTTCGAAGTTTGAGCATGAAGATGGCGTCGAATG3%) as primers and plasmid pVL1393-HVORF2 (Green et al., 1997) as the template. Primer E296 was complementary to nt 1589–1608 of the HV ORF2 and contained an NotI restriction enzyme site, and primer E288 corresponded to nt 1–19 of the HV ORF2 HV with an engineered NspV restriction site upstream from the first ATG initiation codon (underlined). The fragments were cloned into the pCRII vector using the TA cloning system (Invitrogen) and the resulting plasmid was designated p2961. Stool samples from adult volunteers who were challenged orally with HV (Dolin et al., 1975) were the source of HV particles for viral RNA purification (Jiang et al., 1992a). cDNA was synthesized using the SuperScript Preamplification System for First Strand cDNA Synthesis (Gibco

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

131

Fig. 1. Organization of the ORF2 and ORF3 of the Hawaii virus RNA genome and construction scheme for recombinant pTM-1-based plasmids. The ORF2 only or the ORF2 and ORF3 of HV were engineered into the pTM-1 plasmid downstream from the T7 polymerase promoter (PT7) and a translational enhancing element from the EMC virus. Modifications of the amino terminal end of the predicted capsid protein encoded in ORF2 included: (1) the addition of two amino acids (pTMH-1); (2) an amino acid substitution of lysine to glutamine at the second position (pTMH-2); and (3) deletion of the first two amino acids (pTMH-3). The pTMH-5 plasmid contained the predicted authentic amino terminus for the capsid protein. Plasmid pTMH-6 and pTMH-7 both contained the authentic amino terminus of ORF2, but varied in the position of the stop codon in ORF3. The first ATG for each open reading frame is underlined.

BRL) and oligo(dT) as primer. The resulting cDNA served as a template for PCR-amplification using oligo(dT) and E289 (5%TCTCTCGCCCCCATGGGAACTGG3%), corresponding to nt 1561–1583 of ORF2 of HV, as primers. The resulting PCR fragment was cloned into the pCRII plasmid and the two selected plasmids were designated p3H18 and p3H19. The pFH34 plasmid, containing the ORF2, ORF3, and 3%-end part of the HV genome was constructed by ligation of the NcoI/NspV fragment from the p2961 plasmid and the NcoI/NotI fragment from p3H18 into NspV/NotI-linearized pQ14 plasmid (Sosnovtsev and Green, 1995). Plasmid p2961 served as a template for amplification of the HV capsid protein gene by PCR using primer M1 (5%TAAAAATCCATGGGAATGAAGATGGCG TCGAATGAC3%), that carried a cleavage site for the NcoI restriction enzyme upstream of the first ATG initiation codon (underlined) of the capsid protein gene and primer M2 (5%ATATATGGATCCTTACTGCACTCTTCTGCGCCCGTTCCAGTTCCCATAGGGGCGAGAGAATAG-

AATTG3%), that was complementary to nt 1551– 1608 of ORF2 of HV capsid protein gene with a cleavage site for BamHI and a silent point mutation (C“T) at nt 1572 of the gene. This mutation was introduced into the primer to abrogate an internal NcoI restriction site. The PCR product and pTM-1 plasmid (Moss et al., 1990) were digested with NcoI and BamHI and the appropriate DNA fragments were ligated and transformed into E. coli. The resulting plasmid, designated pTMH-1, carried the HV capsid protein gene with two additional amino acid codons for Met and Gly upstream of the first initiation codon, as shown in Fig. 1. To create plasmids pTMH-2 and pTMH-3, that encoded other modifications of the N-terminal sequence of the HV protein, primers M3 (5%TAAAAATCCATGGAGATGGCGTCGAATGAC3%) and M4 (5%TAAAAATCCATGGCGTCGAATGAC3%), respectively, were used in the PCR amplification instead of primer M1. The same cloning procedures were followed as described above. Primers M5 (5%TACATAGAAGACAACATG-

132

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

AAGATGGCGTCGAATGAC3%), corresponding to nt 1–21 of ORF2 of HV with a BbsI restriction site upstream of the first ATG initiation codon, and M6 (5%CTGTGAACGCGTTCCCAGCGAGTAGTACCT3%), complementary to nt 317 – 346 of ORF2 of HV, were used to amplify a 300 bp fragment at the 5% end of the HV capsid protein gene from p2961. This PCR fragment, cut with BbsI and MluI, was subsequently used in the construction of two new plasmids. The pTMH-1 plasmid, digested with NcoI and MluI restriction enzymes, was ligated with the BbsI/MluI-digested PCR fragment to produce the pTMH-5 plasmid that carried the ORF2 of HV with an authentic 5% end. For the construction of pTMH-6, the MluI/ BamHI digested fragment from the pFH34 plasmid that contained the HV ORF2 with two upstream amino terminal codons and an ORF3 with a stop codon at nt 661 and the BbsI/MluI-digested PCR fragment were ligated into the compatible NcoI and BamHI sites of the pTM-1 plasmid. Plasmid pTMH-7 was constructed by exchange of the SpeI/NotI fragments from p3H19 into the compatible sites of pTMH-6, resulting in a clone encoding the predicted authentic amino terminus of the capsid protein and an ORF3 with a stop codon beginning at nt 778. Sequence analysis of plasmid DNA was performed using the Sequenase 2.0 kit (United States Biochemical) and an updated version of the HV sequence has been deposited under accession number U07611. To confirm that the HV capsid gene was inserted without altering its reading frame, all plasmids were analyzed in the in vitro TNT coupled rabbit reticulocyte system (Promega) in the presence of [35S]-labeled methionine according to conditions specified in the manufacturer’s protocols, and the translation products were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) in an 8 – 16% gradient gel (Novex).

2.3. Direct sequence analysis of RT– PCR products Stool suspensions from two adult volunteers, designated Volunteer A and Volunteer B, who

underwent oral challenge with HV (Dolin et al., 1975), were extracted with 1,1,2-trichloro-1,2,2trifluoroethane (Genetron) (Curtin Matheson Scientific). Virus particles in the extracts were precipitated with 8% PEG (MW 6000), 0.5 M NaCl and the viral RNA was extracted with a QIAamp Blood Kit (Qiagen). A cDNA synthesis was performed using the SuperScript Preamplification System and PCR was performed using AmpliTaq DNA polymerase (GeneAmp, Perkin Elmer). The fragment containing ORF3 of HV was amplified most efficiently using primers E21 (5%GGTACCTCTGATGGTGCCAT3%), corresponding to nt 1312–1331 of ORF2 of HV, and E562 (5%AAAAGACAGAAATTTTCAAAGAAAGAAGAG3%), complementary to nt 793–822 of ORF3 of HV, for the Volunteer A sample, and primer E289 and oligo(dT) for the Volunteer B sample. In some experiments, the PCR fragments from the first round were further amplified using primers E21 and E562 and primers E289 and E562 for the Volunteer A and B samples, respectively. A nested PCR was performed on these reactions using primers E512 (5%ACAGTGGCAAACTCTGGTTCT3%), corresponding to nt 1477–1498 of ORF2 of HV, and E562 for the Volunteer A sample, and primers E533 (5%CAAGCTCAAATCCAAGCCACC3%), corresponding to nt 160–180 of ORF3 of HV, and E562 for the Volunteer B sample in order to obtain the final DNA fragments for direct sequence analysis using reagents in the dsDNA Cycle Sequencing System (Gibco BRL) and primer E562. In order to verify the sequence of the ORF3 obtained using the AmpliTaq enzyme for PCR, a new PCR reaction was performed with the TaKaRa LA Taq DNA polymerase system (LA PCR, Takara Shuzo). A first-round PCR was performed on the cDNA from both samples using primers E289 and oligo(dT), followed by amplification with a nested set of primers, E533 and E562. The PCR fragment was purified and sequenced directly as above using primer E563 (5%ACAGCAGCTGCACCAGCCACGATG3%), corresponding to nt 403–426 of the ORF3 of HV.

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

2.4. Infection and transfection A stock of recombinant MVA/T7 pol virus was prepared in primary chick embryo fibroblasts (CEF). Its titer as determined in CEF cells was 8× 108 focus forming units per ml (ffu/ml). Cell monolayers (90% confluent with approximately 106 cells per well in a 6-well tissue culture plate) were infected with MVA/T7 pol at an MOI of 1 and incubated for 1.5 h at 37°C. Cells were washed two times with Opti-MEM I (Gibco BRL) and a plasmid transfection mixture was added that consisted of lipofectin (Gibco BRL) reagent (10 ml) and approximately 1 mg of plasmid DNA in 1 ml Opti-MEM I. Following incubation at 37°C for 5 h, the transfection mixture was removed and cell culture medium was added.

2.5. Radiolabeling and immunoprecipitation A CRFK cell monolayer (approximately 90% confluent) was infected with MVA/T7 pol and then transfected with plasmid DNA as described above. Cells were incubated with radiolabeled [35S]methionine (Amersham) at 60 mCi/ml, or [9,10-3H]myristic acid (Amersham) at 100 mCi/m for 4–6 h at 24–30 h post-transfection. Culture fluids and cells were collected and analyzed by immunoprecipitation using pre- and post-immunization guinea pig hyperimmune serum prepared against baculovirus-expressed recombinant (r) HV VLPs (gpa-rHV) (Green et al., 1997) as well as pre- and post-challenge sera from an adult volunteer who participated in an HV challenge study (Dolin et al., 1975).

2.6. Localization of the HV capsid protein by immunoprecipitation CRFK cells were infected with MVA/T7 pol and transfected with pTMH-6 for analysis of the cellular location of the capsid expression by immunoprecipitation. In order to detect secreted HV capsid protein, the cell culture medium from the radiolabeled cells was collected after 6 h of radiolabeling and incubated with 50 ml of Pan-

133

sorbin cells (Calbiochem) for 1 h to reduce nonspecific binding. The Pansorbin was pelleted by centrifugation and the preabsorbed culture medium (300 ml) was incubated at 4°C overnight with an equal volume of radioimmunoprecipitation assay (RIPA) buffer (0.15 mM NaCl, 0.05 mM Tris–HCl (pH 7.2), 1% Triton X-100 and 1% sodium deoxycholate) containing 0.1% SDS and 15 ml of gpa-rHV. This mixture was then incubated at 4°C for 1.5 h with 25 ml of Pansorbin cells. The resulting complexes were washed three times with RIPA2% SDS buffer and suspended in 40 ml of SDS–PAGE sample buffer. Cell monolayers were washed with PBS and incubated for 2 h with 0.5 ml of a 1:100 dilution of gpa-rHV in PBS to bind HV protein expressed on the surface of cells. Antiserum was removed and cells were washed two times with PBS prior to lysis by RIPA-0.1% SDS buffer (0.7 ml per well). A 300 ml aliquot of the lysate was incubated for 1.5 h at 4°C with an equal volume of RIPA-0.1% SDS buffer and 25 ml of Pansorbin cells. The complexes were washed three times with RIPA-2% SDS buffer and suspended in 40 ml of SDS–PAGE sample buffer. A second set of MVA/T7 pol-infected and transfected CRFK cells was washed with PBS and lysed directly by RIPA-0.1% SDS buffer (0.7 ml per well). A 300 ml aliquot of the lysate was incubated overnight at 4°C with an equal volume of RIPA-0.1% SDS buffer and 15 ml of gpa-rHV. The mixture was then incubated for 1.5 h at 4°C with 25 ml of Pansorbin cells. The complexes were washed three times with RIPA2% SDS buffer and suspended in 40 ml of SDS–PAGE sample buffer. All samples were subjected to SDS–PAGE and autoradiography.

2.7. Treatment of the HV capsid protein with Endoglycosidases F and H CRFK cells infected with MVA/T7 pol were transfected with pTMH-6 and radiolabeled with [35S]methionine. The medium was removed and cells were lysed in RIPA-0.1% SDS buffer, 700 ml per well. Approximately 400 ml of the lysate

134

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

was incubated at 4°C overnight with an equal volume of RIPA-0.1% SDS buffer and 25 ml of gpa-rHV. The mixture was then incubated with 30 ml of Pansorbin cells for 1.5 h followed by washing three times with 0.5 ml of RIPA-2% SDS and once with 0.5 ml TE buffer. The complexes were resuspended in 0.4% SDS and boiled for 5 min to dissociate bound antigen from the Pansorbin. Following removal of the Pansorbin by centrifugation, the supernatant was divided into three portions. Two portions were diluted twofold with the appropriate endoglycosidase buffer (Boehringer Mannheim) and treated with either endoglycosidase F (Boehringer Mannheim) or endoglycosidase H (Boehringer Mannheim). The third aliquot was left untreated as a control. Incubation of the three samples was carried out at 37°C overnight. Samples were then combined with SDS –PAGE sample buffer and subjected to SDS –PAGE.

2.8. Enzyme-linked immunosorbent assay, immunofluorescence, Western blot, and immune electron microscopy At 38 h post-transfection, culture fluids or cell monolayers (frozen and thawed three times) were collected and analyzed for the presence of Hawaii virus capsid antigen by an enzyme-linked immunosorbent assay (ELISA) that was performed as described previously (Green et al., 1997). Cell monolayers in six-well plates were analyzed by an immunofluorescence assay (IFA) (Sosnovtsev and Green, 1995) that used gpa-rHV and fluorescein-conjugated anti-guinea pig antibodies (Cappel) for detection. In the Western blot assay, proteins in cell lysates were separated by SDS–PAGE, electro-transferred onto a nitrocellulose membrane (Schleicher and Schuell), and reacted with gpa-rHV antibodies. Bound gp antibodies were detected with a peroxidaseconjugated goat anti-guinea pig immunoglobulins conjugate, followed by development with the ECL chemiluminescent substrate system (Amersham). Immune electron microscopy (IEM) was performed as described by Kapikian et al. (1972).

3. Results

3.1. Cloning and analysis of plasmids containing the HV capsid protein gene Plasmids carrying the HV capsid protein gene (ORF2) under transcriptional control of the bacteriophage T7 RNA polymerase promoter and downstream of the translational enhancing elements of mouse encephalomyocarditis (EMC) virus were constructed (Fig. 1). Several modifications of the 5%-end of the capsid gene were engineered using PCR. In addition, we cloned and sequenced the remainder of the 3%-end of the HV genome in order to construct plasmids containing both the ORF2 and ORF3 of HV because it was not known whether the presence of the ORF3 product might affect the expression of ORF2 in mammalian cells. In the course of our sequence analysis of the HV genome, we observed a single base insertion in some ORF3 cDNA clones that resulted in an apparent premature stop codon. An RT–PCR reaction using AmpliTaq DNA polymerase was performed on HV RNA derived from two adult volunteers, designated Volunteers A and B, and the PCR products were sequenced directly. A population of RNA molecules in the HV genome derived from Volunteer A contained a single base insertion at nt 654 when compared to that from Volunteer B. This insertion resulted in a downstream stop codon beginning at nt 661 that would allow the synthesis of a truncated form of the predicted ORF3 product in the virus from Volunteer A when compared to that from Volunteer B. Of interest, two sequential stop codons were present in both forms of the ORF3 gene. PCR was repeated on both samples using TaKaRa LA Taq DNA polymerase, and the observed positions of the stop codons in the two samples were identical to that described above. The calculated molecular weight of the ORF3 product from the HV viral RNA derived from the stool of Volunteer A and B was 23 and 27 kDa, respectively, and each form of the ORF3 was engineered into an ORF2-containing plasmid (Fig. 1). The deduced amino acid sequence of the HV ORF3 from Volunteer B (contained in pTMH-7) was consistent in length (259 amino

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

135

Fig. 2. In vitro transcription and translation of the pTMH plasmids and immunoprecipitation analysis. (A) Plasmids pTMH-1, pTMH-2, pTMH-3, pTMH-5, pTMH-6, and pTMH-7 (lanes 1 – 6, respectively) were analyzed in a coupled transcription and translation reaction and the TNT products were subjected to SDS – PAGE. The 57 kDa protein corresponding in size to the HV capsid protein and the proteins corresponding in size to the predicted ORF3 products are indicated. (B) The radiolabeled TNT rabbit reticulocyte lysates derived from the coupled transcription and translation of pTMH-1 (lanes 1 – 5) or pTMH-6 (lanes 5 – 10) were reacted with either pre- (lanes 1 and 6) or post- (lanes 2 and 7) immunization guinea pig hyperimmune sera prepared against recombinant HV VLPs (gpa-rHV). The TNT lysates were reacted also with pre- (lanes 3 and 8) and post (lanes 4 and 9) infection sera from an adult volunteer who underwent oral challenge with Hawaii virus. Lanes 5 and 10 contain the nonprecipitated TNT lysates derived from pTMH-1 and pTMH-6 respectively, that were included as controls (C).

acids) with those from other Genogroup II HuCVs currently in GenBank and shared closest amino acid identity (68%) with the ORF3 from Melksham virus (Green et al., 1995). Recombinant DNA plasmids (1 mg each) were analyzed simultaneously in a T7 polymerasebased in vitro coupled transcription and translation reaction (TNT). Translation products were subjected to SDS–PAGE and a protein of approximately 57 kDa was produced in similar amounts for each plasmid (Fig. 2(A)). The 57 kDa protein generated from pTMH-1 and pTMH-6 was precipitated with gpa-rHV (Fig. 2(B), lanes 2 and 7), but was not precipitated efficiently with guinea pig pre-immune serum (Fig. 2(B), lanes 1 and 6). The 57 kDa protein was precipitated with pre- and post-challenge sera

from an adult volunteer infected with HV who was shown to have pre-existing antibodies to rHV VLPs at the time of challenge (Green et al., 1997) (Fig. 2(B), lanes 3, 4, 8 and 9). A smaller protein was observed in the TNT reactions for the two plasmids, pTMH-6 and pTMH-7 that contained ORF3 in addition to ORF2 (Fig. 2(A), lanes 5 and 6). The size of the smaller protein reflected the calculated size of the ORF3 protein encoded by each plasmid. This protein, however, was not precipitated with either gpa-rHV or infection serum (Fig. 2(B), lanes 7 and 9). Paired sera analyzed from two additional adult volunteers who underwent challenge with HV did not precipitate the putative ORF3 product derived from either pTMH-6 or pTMH-7 (data not shown).

136

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

3.2. Optimal conditions for expression of capsid protein in mammalian cells Mammalian cell lines from different species were selected for analysis in our present study and included human colon carcinoma (CaCo-2) cells, human kidney (293) cells, African Green monkey kidney (CV-1) cells, and Crandell-Rees feline kidney (CRFK) cells. An optimal number of cells expressing capsid protein was observed by IFA in all four cell lines when the MVA/T7 pol virus was used at a MOI of 1 and the plasmid DNA at a concentration of approximately 1 mg as illustrated in transfection experiments of the pTMH-1 plasmid (Fig. 3). At lower MOIs of vaccinia virus, fewer numbers of HV capsid-expressing cells were observed (data not shown). The highest efficiency of expression as determined by the total numbers of cells positive in the IFA and the intensity of fluorescent staining was consistently observed using CRFK cells. The kinetics for expression of the HV capsid protein in CRFK cell lysates were examined by Western blot analysis and showed that the protein began to accumulate at 24 h post-transfection, peaking in level of expression at 24 – 48 h, and

Fig. 4. Time course analysis of HV capsid protein expression in CRFK cells by Western Blot. CRFK cells were infected with MVA/T7 pol (MOI = 1) and transfected with pTMH-6. Cells were collected after 0, 1, 2, 3, 4, 5, and 6 days (lanes 1–7, respectively) and lysates were subjected to electrophoresis, blotted to nitrocellulose, and probed with gpa-rHV. A MVA/ T7 pol-infected CRFK cell lysate (lane 8) and a lysate prepared from non-infected CRFK cells incubated with pTMH-6 and lipofectin (lane 9) were included as controls. Lane 10 contains baculovirus-expressed rHV VLP protein.

decreasing by day 3 (Fig. 4). Titration of these cell lysates in an ELISA confirmed that the maximum level of capsid protein expression in CRFK cells was observed at 24–48 h post-transfection in the presence of MVA/T7 pol virus at an MOI of 1 (data not shown). The level of 57 kDa protein expression in the CV-1 cell lysates appeared highest at 24 h post-transfection while that for the CaCo-2 cells appeared highest at 48 h post-transfection as determined by Western blot analysis (data not shown). Similar results for the kinetics of the intracellular accumulation of protein were observed when MVA/T7 pol-infected cells (CRFK, CaCo-2, or CV-1) were transfected with the pTMH-2 or pTMH-3 plasmid (data not shown). Examination of the kinetics of protein expression in 293 cells was hampered by the cytopathic effect of the MVA/T7 pol virus infection.

3.3. Localization of HV capsid protein expression in mammalian cells Cell culture medium, total cell lysate and surface membrane-bound proteins were analyzed at 24–48 h post-transfection by an immunoprecipitation assay using gpa-rHV (Fig. 5). CRFK cells were infected with MVA/T7 pol and transfected with the pTMH-6 plasmid. Synthesized proteins were radiolabeled with [35S]methionine. The level of intracellular accumulation of a radiolabeled 57 kDa protein in the cell lysate from transfection with pTMH-6 plasmid (Fig. 5, lane 3) appeared greater than detected on the cell surface (Fig. 5, lane 2) and in the cell culture medium (Fig. 5, lane 1). Analysis of the radiolabeled cell lysates by immunoprecipitation with paired sera from three adult volunteers infected with HV failed to detect the expression of the truncated ORF3 product in transfected cells (data not shown). The predominantly intracellular expression of capsid protein was observed also for plasmids pTMH-1 and pTMH-5 in MVA/T7 pol-infected cells analyzed by immunoprecipitation (data not shown). Analysis by ELISA for the presence of HV antigen in the cell culture media of cell lines transfected with the pTMH-1, pTMH-2, pTMH3, pTMH-5, and pTMH-6 plasmids confirmed the very low level of secretion of capsid protein into

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

137

Fig. 3. Expression of HV capsid protein in various mammalian cell lines visualized by immunofluorescence. The following cells were infected with MVA/T7 pol (MOI= 1) and observed by immunofluorescence 24 h after transfection with the pTMH-1 plasmid: (A) 293 human kidney cells, (C) CaCo-2 human colon carcinoma cells, (E) CV-1 African green monkey kidney cells, and (G) Crandell-Rees feline kidney cells. Panels B, D, F, and H show the immunofluorescence of 293, CaCo-2, CV-1, and CRFK cells, respectively, that were infected with MVA/T7 pol only.

138

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

3.5. Translational modifications of the HV capsid protein in cells A PCGene computer search for consensus functional motifs in human calicivirus capsid proteins revealed the presence of three potential N-linked glycosylation sites in the HV capsid protein beginning at amino acid residues 19, 184, and 337. The HV capsid protein immunoprecipitated from pTMH-6 transfected CRFK cell lysates was treated with two different endoglycosidases, F (Fig. 6, lane 4) and H (Fig. 6, lane 5) and subjected to SDS–PAGE. There were no differences in the observed electrophoretic mobility of the treated capsid proteins as compared to the nontreated control (Fig. 6, lane 6). The PCGene computer program also predicted a potential myristylation site (lepvaGasiaa) corresponding to amino acid residues 29 through 39 of the HV capsid protein that was highly conserved among other human calicivirus capsid proteins. The pTMH-6-transfected MVA/T7 pol-infected Fig. 5. Localization of HV capsid protein by immunoprecipitation analysis. CRFK cells were infected with MVA/T7 pol and co-transfected with either pTMH-6 (lanes 1–3). MVA/T7 polinfected cells were included as controls (lanes 4–6). The immunoprecipitation was performed as described in the text with gpa-rHV in order to identify the presence of expressed HV capsid protein in cell culture medium (M), on the cell surface (S), or in an intracellular (I) compartment.

the medium. However, low levels of HV antigen were consistently detected by ELISA in the cell culture fluids from CRFK transfection experiments (data not shown).

3.4. Electron microscopy Cell culture fluids and cell lysates from transfection experiments with plasmids pTMH-1, pTMH2, and pTMH-3 in both CV-1 and CRFK cells collected on days one and two post-transfection were examined by direct EM. CRFK cell lysates from transfection experiments of plasmids pTMH-1, PTMH-5, pTMH-6, and pTMH-7 were also examined by IEM. No evidence for self-assembly of the HV protein into stable virus-like particles was observed under the conditions of these experiments.

Fig. 6. Effect of Endoglycosidase F or H treatment on the Hawaii virus capsid protein expressed in CRFK cells. Immunoprecipitated capsid protein from CRFK cells infected with MVA/T7 pol and transfected with pTMH-6 (lanes 4 – 6) was treated with endoglycosidase F (lane 4), endoglycosidase H (lane 5), or was left untreated (lane 6). Lysates of CRFK cells infected only with MVA/T7 pol (lanes 1 – 3) were included as controls.

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

CRFK cells were radiolabeled with [3H]-labeled myristic acid, but there was no indication that the Hawaii virus capsid protein was labeled with this acyl group (data not shown).

4. Discussion The HV capsid protein was produced by expression of the second ORF of the HV genome in a rabbit reticulocyte cell-free coupled transcription and translation system and in the MVA/T7 pol vaccinia virus transient expression system. Analysis of the expressed products showed that the second ORF encodes a protein with an estimated molecular weight of 57 kDa and that it shares antigenic similarity with both the native HV capsid protein and rHV VLPs. There was no evidence for N-linked glycosylation or myristylation of the 57 kDa capsid protein expressed in mammalian cells. The 57 kDa capsid protein expressed in the MVA/T7 pol system accumulated in four different mammalian cell lines of human, simian, or feline origin, suggesting that the mechanism for growth restriction is not directly related to a failure of mammalian cells to express the major structural viral protein. In the absence of a cell culture system, it was not possible to assess whether the level of capsid expression observed in the MVA/T7 pol transient system was similar to that occurring during authentic HV replication. However, it was of interest that the highest level of HV capsid expression was consistently observed in CRFK. These were the only cells in which HV capsid protein was readily detected in the cell culture medium, although the amount detected was small. It was not determined whether the presence of the capsid protein in culture medium was a result of authentic secretion through the cell membrane, or the release of intracellular protein due to the lysis of cells by the vaccinia virus. One possible explanation for the inefficient secretion of HV protein from the cell lines analyzed in this study could be the absence of other calicivirus proteins, such as nonstructural proteins, that may play a role in capsid protein processing and maturation during authentic viral infection. Alternatively, the cDNA clones exam-

139

ined in this study may have contained sequence errors that inhibited secretion from mammalian cells. However, the deduced amino acid sequence of the HV capsid protein encoded by the pTM-1based plasmids in our current study was identical to that of the HV ORF2 clones used to construct the recombinant baculoviruses that yielded efficient production of HV VLPs in our previous study. Similar patterns of predominantly intracellular expression and lack of secretion were observed in our studies of Norwalk virus capsid protein expression in mammalian cells (K.Y. Green, unpublished studies). Furthermore, expression studies of the RHDV capsid protein in the vaccinia system indicated that the capsid protein remained in an intracellular compartment (Bertagnoli et al., 1996). Several differences were observed between the transient vaccinia MVA/T7 pol recombinant and baculovirus expression systems in regard to the production of recombinant HV capsid protein. The capsid protein expressed in mammalian cells under the conditions in our present study did not form VLPs efficiently and the levels of observed protein expression were markedly lower in comparison to the baculovirus system (Green et al., 1997). However, the ability of the baculovirus system to generate calicivirus VLPs efficiently is currently not understood and could simply be a result of the ‘over-expression’ of protein. It will be of interest to examine whether engineering the HV ORF2 into the genome of a viral vector that replicates in mammalian cells will increase the level of the expressed HV capsid protein as compared to the transient expression system. It is also possible that proteolytic enzymes in the baculovirus expression system differ significantly from those in the MVA/T7 pol system. Expression of the Norwalk virus ORF2 and ORF3 together in the baculovirus system, produced not only a capsid protein of 58 kDa, but also a protein of 34 kDa, that was determined to be a cleavage product of the 58 kDa protein (Jiang et al., 1992b). In this study, we failed to detect a HV capsid cleavage product during the 6-day period of observation following transfection of mammalian cells. In addition, the HV capsid protein in the transient vaccinia system appeared similar in

140

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141

size to the protein in purified rHV VLPs produced in the baculovirus system. It is not yet known whether proteolytic processing plays a role in HuCV capsid maturation, as it does for certain animal caliciviruses (Sosnovtsev et al., 1998). Amino acid substitutions in the N-terminus of the capsid protein, such as the substitution of lysine to glutamine in the second position of the polypeptide chain or deletion of the first two residues, did not affect the observed level of protein expression. Thus, it is possible that the initiation of translation can occur efficiently at the second AUG of ORF2 both in the in vitro translation and MVA/T7 pol expression systems. Moreover, the presence of two additional amino acids upstream from the first ORF2 AUG initiation codon did not affect the observed levels of capsid expression. However, in the absence of a growth and replication system for HV, we could not determine whether the mutations analyzed in our present study would have an effect on viral replication in cells or capsid assembly. Studies with the subgenomic RNA of feline calicivirus (FCV) suggested an internal initiation mechanism for the expression of the ORF3 product (Herbert et al., 1996). A smaller protein of either 23 or 27 kDa was observed in translation reactions for two plasmids that contained HV ORF3 in addition to ORF2, confirming that the HV ORF3 product could be translated from a ‘subgenomic’-like RNA template in vitro. All human calicivirus genomes analyzed thus far have a − 1 frame shift at the region between the capsid gene and the ORF3 product, but it is not yet clear how the translation of ORF3 is regulated in cells. The putative ORF3 product expressed in either the in vitro translation system or in mammalian cells was not recognized by antibodies present in adult post-infection sera, suggesting that it is not highly immunogenic during natural infection. An intriguing finding in our present study was the evidence for differences in the dominant populations of viral RNA between viruses obtained from two adult volunteers infected with HV. The direct sequence analysis of PCR products confirmed that one of the volunteers shed a dominant

population of virus that contained a one base insertion in ORF3 that resulted in an apparently premature stop codon in the predicted ORF3 product. Both forms of the ORF3 were engineered into plasmids, but differences in the ORF3 product were not observed other than the size of the proteins produced in the TNT reactions. The co-expression of ORF3 and with ORF2 did not appear to affect the localization of the capsid protein in mammalian cells. Further studies are needed to address the function of this protein in the viral replication strategy and to determine whether variation in this gene plays a role in the natural history of this virus. The HV capsid protein produced in mammalian cells may serve as a model for further studies of a structural protein that is closer to its natural analog in wild type virus infection. The identification of the conditions under which capsid self-assembly occurs in mammalian cells may give insight into the mechanisms involved in the restriction of the HuCVs for growth in cell culture. An understanding of these mechanisms may prove useful in the development of a recovery system for the noncultivable caliciviruses in nonpermissive cells using recombinant plasmid DNA.

Acknowledgements We thank Dr Bernard Moss for providing the pTM-1 vector and the MVA/T7 pol virus and Dr Linda Wyatt for titration of the MVA/T7 pol virus in CEF cells. We thank Dr Albert Kapikian for valuable assistance with the electron microscopy and helpful discussions. We appreciate the technical support of Jose Valdesuso and Mariam Watson. We are grateful to Dr Alexander Pletnev and Dr Robert Chanock, Chief, LID, NIAID for their support of this work.

References Bertagnoli, S., Gelfi, J., Petit, F., Vantherot, J.F., Rasschaert, D., Laurent, S., Le Gall, G., Boilletot, E., Chantal, J., Boucraut-Baralon, C., 1996. Protection of rabbits against rabbit viral hemorrhagic disease with a vaccinia-RHDV recombinant virus. Vaccine 14, 506 – 510.

M.A. Pletne6a et al. / Virus Research 55 (1998) 129–141 Dingle, K.E., Lambden, P.R., Caul, E.O., Clarke, I.N., 1995. Human enteric Calici6iridae: the complete genome sequence and expression of virus-like particles from a genetic group II small round structured virus. J. Gen. Virol. 76, 2349 – 2355. Dolin, R., Levy, A.G., Wyatt, R.G., Thornhill, T.S., Gardner, J.D., 1975. Viral gastroenteritis induced by the Hawaii agent: jejunal histopathology and seroresponse. Am. J. Med. 59, 761 – 769. Green, S.M., Lambden, P.R., Caul, E.O., Ashley, C.R., Clarke, I.N., 1995. Capsid diversity in small round-structured viruses: molecular characterization of an antigenically distinct human enteric calicivirus. Virus Res. 37, 271 – 283. Green, K.Y., Kapikian, A.Z., Valdesuso, J., Sosnovtsev, S., Treanor, J.J., Lew, J.F., 1997. Expression and self-assembly of recombinant capsid protein from the antigenically distinct Hawaii human calicivirus. J. Clin. Microbiol. 35, 1909 – 1914. Herbert, T.P., Brierly, I., Brown, T.D.R., 1996. Detection of the ORF3 polypeptide of feline calicivirus in infected cells and evidence for its expression from a single, functionally bicistronic, subgenomic mRNA. J. Gen. Virol. 77, 123– 127. Jiang, X., Wang, M., Graham, D.Y., Estes, M.K., 1992a. Detection of Norwalk virus in stool by polymerase chain reaction. J. Clin. Microbiol. 30, 2529–2534. Jiang, X., Wang, M., Graham, D.Y., Estes, M.K., 1992b. Expression, self-assembly and antigenicity of the Norwalk virus capsid protein. J. Virol. 66, 6527–6532. Jiang, X., Wang, M., Wang, K., Estes, M.K., 1993. Sequence and genomic organization of Norwalk virus. Virology 195, 51– 61. Kapikian, A.Z., Wyatt, R.G., Dolin, R., Thornhill, T.S., Kalica, A.R., Chanock, R.M., 1972. Visualization by immune electron microscopy of a 27-nm particle associated with acute infectious nonbacterial gastroenteritis. J. Virol. 10, 1075 – 1081. Kapikian, A.Z., Estes M.K., Chanock, R.M., 1996. Norwalk group of viruses. In: Fields, B.N., Knipe, D.M., Howley,

.

141

P.M., et al. (Eds.) Virology. Lippincott – Raven, Philadelphia, PA, pp. 783 – 810. Lambden, P.R., Clarke, I.N., 1995. Genome organization in the Calici6iridae. Trends Microbiol. 3, 261 – 265. Lambden, P.R., Caul, E.O., Ashley, C.R., Clarke, I.N., 1993. Sequence and genomic organization of a human small round-structured (Norwalk-like) virus. Science 259, 516 – 519. Lew, J.F., Kapikian, A.Z., Valdesuso, J., Green, K.Y., 1994. Molecular characterization of Hawaii virus and other Norwalk-like viruses: evidence for genetic polymorphism among human caliciviruses. J. Infect. Dis. 170, 535 – 542. Lui, B., Clarke, I.N., Lambden, P.R., 1996. Polyprotein processing in Southampton virus: Identification of 3C-like protease cleavage sites by in vitro mutagenesis. J. Virol. 70, 2605 – 2610. Meyers, G., Wirblich, C., Thiel, H., 1991. Genomic and subgenomic RNAs of rabbit hemorrhagic disease virus are both protein-linked and packaged into particles. Virology 184, 664 – 676. Moss, B., Elroy-Stein, O., Mizukami, T., Alexander, W.A., Fuerst, T.R., 1990. New mammalian expression vectors. Nature 348, 91 – 92. Sosnovtsev, S., Green, K.Y., 1995. RNA transcripts derived from a cloned full-length copy of the feline calicivirus genome do not require VPg for infectivity. Virology 210, 383 – 390. Sosnovtsev, S.V., Sosnovtseva, S.A., Green, K.Y., 1998. Cleavage of the feline calicivirus capsid precursor is mediated by a virus-encoded protease. J. Virol. 72, 3051 – 3059. Thornhill, T.S., Wyatt, R.G., Kalica, A.R., Dolin, R., Chanock, R.M., Kapikian, A.Z., 1977. Detection by immune electron microscopy of 26- to 27-nm virus-like particles associated with two family outbreaks of gastroenteritis. J. Infect. Dis. 135, 20 – 27. Wyatt, L.S., Moss, B., Rozenblatt, S., 1995. Replication-deficient vaccinia virus encoding bacteriophage T7 RNA polymerase for transient gene expression in mammalian cells. Virology 210, 202 – 205.