Characterization of a second functional gene cluster for the catabolism of phenylacetic acid in Pseudomonas sp. strain Y2

Gene 341 (2004) 167 – 179 www.elsevier.com/locate/gene

Characterization of a second functional gene cluster for the catabolism of phenylacetic acid in Pseudomonas sp. strain Y2 David Bartolome´-Martı´n, Esteban Martı´nez-Garcı´a1, Victoria Mascaraque, Julio Rubio, Julia´n Perera*, Sergio Alonso2 Departmento de Bioquı´mica y Biologı´a Molecular, I, Facultad de Ciencias Biolo´gicas, Universidad Complutense de Madrid, Ciudad Universitaria, s/n. 28040 Madrid, Spain Received 1 December 2003; received in revised form 27 May 2004; accepted 21 June 2004 Available online 25 August 2004 Received by A.M. Campbell

Abstract Pseudomonas sp. strain Y2 is a styrene degrading bacterium that mineralises this compound through its oxidation to phenylacetic acid (PAA). We previously identified a complete gene cluster (paa1 cluster) for the degradation of phenylacetate, but, surprisingly, some paa1 deletion mutants were still able to catabolize styrene (STY) suggesting that this strain contained a second catabolic pathway. We report here the characterization of a second and novel paa2 gene cluster comprising 17 genes related to the catabolism of phenylacetate. We have identified a new gene (paaP) that is most likely involved in a transport process. Remarkably, the organization of the paa2 gene cluster is more similar to that of Pseudomonas putida KT2440 than to the paa1 gene cluster. Two new genes of undefined function were located inside the paa2 cluster. Sequence comparison between the paa2 genes and the paa1 and paa clusters of Pseudomonas sp. strain Y2 and P. putida KT2440, respectively, revealed a similar degree of divergence among the three sets of genes. Differences in the gene organization between paa1 and paa2 clusters of Pseudomonas sp. strain Y2 can be explained by an independent evolutionary history, probably associated with the adjacent sty genes. Deletion of either the first (paa1) or the second (paa2) gene cluster did not affect the ability of strain Y2 to grow in phenylacetate, whereas the deletion of both clusters led to the loss of this ability. The co-existence of two functional gene clusters for the degradation of phenylacetic acid in a bacterium has not been reported so far. D 2004 Elsevier B.V. All rights reserved. Keywords: Aromatic compounds catabolism; Gene cluster duplication; Biodegradation

1. Introduction Phenylacetic acid (PAA) is aerobically catabolized through a set of enzymatic reactions known as the PAA pathway. In the first step, PAA is activated to phenylacetylAbbreviations: bp, base pair(s); kb, 1000 bp; aa, amino acid(s); sty, gene(s) encoding protein(s) involved in the oxidation of styrene to phenylacetic acid; paa, gene(s) encoding protein(s) involved in the catabolism of phenylacetic acid; PAA, phenylacetic acid. * Corresponding author. Tel.: +34 91 3944145; fax: +34 91 3944672. E-mail address: [email protected] (J. Perera). 1 Present address: Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, MA 02115, USA. 2 Present address: Burnham Institute, La Jolla, CA 92037, USA. 0378-1119/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2004.06.042

coenzyme A (PA-CoA) in a reaction catalyzed by a phenylacetate-CoA ligase. PA-CoA is then the substrate of further degradation whose intermediates have been recently identified in Escherichia coli (Ismail et al., 2003). This PAA pathway is a central route in the catabolic network (phenylacetyl-CoA catabolon) of several structurally related aromatic compounds like styrene, 2-phenylethylamine, tropic acid or phenylacetyl esters and amides (Luengo et al., 2001). The genes that code for the PAA pathway, paa genes, have been completely identified and characterized in E. coli W (Ferra´ndez et al., 1998), in Azoarcus evansii (Rost et al., 2002; Mohamed Mel et al., 2002) and in two species of Pseudomonas, namely Pseudomonas putida U (Olivera et al., 1998) and Pseudomonas sp. strain Y2 (Alonso et al.,

168

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

2003). The occurrence of putative paa gene clusters can also be inferred in several other bacteria, as P. putida KT2440 (Luengo et al., 2001; Jimenez et al., 2002; and references therein). Pseudomonas sp. strain Y2 is a bacterium able to grow in styrene (STY) as the sole carbon and energy source. The styrene degradation pathway transforms the styrene into PAA (styrene upper catabolic pathway) that is further degraded through the styrene lower pathway (PAA catabolic pathway). The genes involved in the upper pathway are named sty genes and have been studied in Pseudomonas sp. strain Y2 (Velasco et al., 1998) and in a number of other Pseudomonads (O’Connor et al., 1995; Beltrametti et al., 1997; Panke et al., 1998; O’Leary et al., 2001). Recently, the characterization of the genes encoding the styrene lower pathway (paa genes, named paa1 cluster hereafter) of Pseudomonas sp. strain Y2 have been reported (Alonso et al., 2003), being the first styrene whole degradation pathway that has been genetically characterized. Although the paa1 cluster of Pseudomonas sp. strain Y2 is similar to that of P. putida U, some interesting differences were detected. The gene encoding the phenylacetate-CoA ligase (paaF) is

duplicated in the strain Y2 and the paaM porin encoding gene is absent. Moreover, paaN2, a gene analogous to paaN that is located between paaY and paaA in strain Y2 is absent in P. putida U (Alonso et al., 2003). Surprisingly, the paa1 deletion mutants of strain Y2 that were constructed during our initial studies were still able to grow either in styrene or in phenylacetate as the sole carbon and energy source, suggesting either that some paa sequences were duplicated in this bacterium or that strain Y2 contained an alternative catabolic pathway for phenylacetate. In this paper, we report the identification, isolation and characterization of a second functional paa2 gene cluster of Pseudomonas sp. strain Y2.

2. Materials and methods 2.1. Bacterial strains, plasmids, media and culture conditions Bacterial strains and plasmids used in this study are listed in Table 1. E. coli CC118 Epir was used for the

Table 1 Bacterial strains and plasmids used in this work Strain

Relevant genotype/phenotype

Reference

E. coli CC118 Epir

D(ara-leu) araD DlacX74 galE galK phoA20 thi-1 rpsE rpoB argE (Am) recA1 kpir lysogen FV endA1 hsdR17 (r K m K+ ) glnV44 thi-1 recA1 gyrA (NalR) relA1 D(lacIZYA-argF) U169 deoR (f80dlacD(lacZ)M15) F+ recA thi pro hsdR M + RP4D2-TcDMuDKm Tn7 Tp R Sm R kpir lysogen PAA+, STY+, ApR, CmR, KmR PAA , STY , ApR, CmR, KmR, TcR PAA+, STY+,ApR, CmR, TcR PAA+, STY+, ApR, CmR PAA+, STY+, ApR, CmR, KmR PAA+, STY+, ApR, CmR, KmR PAA+, STY+, ApR, CmR, KmR, SmR PAA+, STY+, ApR, CmR, TcR

(Herrero et al., 1990)

E. coli DH5aFV

E. coli S17-1 Epir Pseudomonas Pseudomonas Pseudomonas Pseudomonas Pseudomonas Pseudomonas Pseudomonas Pseudomonas

sp. sp. sp. sp. sp. sp. sp. sp.

strain strain strain strain strain strain strain strain

K1 K1-T2 T2 Y2 Y2-DGK Y2-ADKm Y2-H2DK2.5 Y2-J2DTc

Plasmid

Vector

pAV-I pAV-II pBGI pBTc pDel-II pDel-III pDel-IV pF2A11 pF2HS pF2K17 pF2-VI pK2.5AB pKFAKm pUC4K

pBluescript pUCP26 pKNG101 pBluescript pKNG101 pBluescript pBluescript pBluescript pBluescript pKNG101 pBluescript pBluescript pBluescript pBluescript pKNG101 pKNG101 pUC7

II II II II

KS+ KS+ KS+ KS+

II II II II

KS+ KS+ KS+ KS+

(de Lorenzo and Timmis, 1994) This work This work This work (Utkin et al., 1991) (Alonso et al., 2003) (Alonso et al., 2003) This work This work

Insert

Origin

Markers

Reference

4.20 kb; TcR 4.20 kb; TcR 2.65 kb 1.46 kb; TcR cassette 2.66 kb; TcR 4.42 kb; TcR 3.81 kb; TcR 11.36 kb; SmR 4.34 kb 18.00 kb; SmR 4.87 kb 2.65 kb; KmR 3.75 kb; KmR 1.24 kb; KmR cassette

ColE1 pMB1/1600 R6K ColE1 R6K ColE1 ColE1 ColE1 ColE1 R6K ColE1 ColE1 ColE1 ColE1 R6K R6K ColE1

ApR TcR SmR; sacB ApR; TcR SmR; TcR ApR ApR; TcR ApR; TcR ApR; TcR SmR; TcR; sacB ApR; SmR ApR ApR; SmR ApR; TcR KmR; SmR; sacB KmR; SmR; sacB ApR; KmR

Stratagenek (West et al., 1994) (Kaniga et al., 1991) This work This work This work This work This work This work This work This work This work This work This work This work This work (Taylor and Rose, 1988)

II KS+

II KS+

(Woodcock et al., 1989)

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

maintenance of plasmids with the R6K replication origin. Pseudomonas and E. coli strains were grown at 30 and 37 8C, respectively, in Luria–Bertani (LB) medium (Sambrook et al., 1989) unless otherwise indicated. M9 minimal medium (Miller, 1972) was used for growing the bacteria on phenylacetate as the sole carbon and energy source, which was added to a final concentration of 0.2% (w/v). Where needed, vitamins were added at 1 Ag/ml. Antibiotics were added at the following final concentrations: ampicillin (100 Ag/ml), kanamycin (50 Ag/ml), streptomycin (150 Ag/ ml), chloramphenicol (25 Ag/ml) and tetracycline (10 Ag/ml for E. coli and 150 Ag/ml for Pseudomonas). To counter select the bacteria harboring the sacB gene, sucrose was added at 300 mM. 2.2. Bacterial transformation and conjugation Competent cells of E. coli DH5aFV were prepared as previously described (Inoue et al., 1990), and transformed by the heat shock method (Sambrook et al., 1989). Selection of transformed cells was carried out in LB plates supplemented with the appropriate antibiotics. To transfer the pKNG101 derivative plasmids to Pseudomonas sp. strain Y2 by conjugation, E. coli S17-1Epir was used as donor strain. After incubating donor and recipient strains separately in liquid LB medium, a mixture of both strains (1:1, v/v) was prepared, washed twice with 140 mM NaCl and dispensed onto a sterile 0.22 Am filter placed on a LB plate. After 6 h incubation at 30 8C, the filter was removed, the grown cells were suspended in 1 ml of 140 mM NaCl and subsequently plated on appropriate selective media. 2.3. DNA manipulation, nucleotide sequence determination and sequence analysis DNA manipulation and other molecular biology techniques were performed essentially as described elsewhere (Sambrook et al., 1989). Southern blottings were carried out as previously reported (Sambrook et al., 1989), using digoxigenin-labelled DNA probes. Nucleotide sequences were determined by using a model 377 automated DNA sequencer (Applied Biosystem). Partial sequences were assembled by using the Seqman program (DNAstar, Lasergen). Definition of the open reading frames (ORF) and GC content analysis were done by using the Artemis sequence analysis software (Rutherford et al., 2000). Comparison of DNA and protein sequences was performed with the BLAST2, CLUSTALW and ALIGN programs available at the European Bioinformatics Institute (http://www.ebi. ac.uk/Tools/). When comparing protein sequences BLOSUM62 matrix was used. Prediction of putative j70 promoters was performed by using the server of the Berkeley Drosophila Genome Project (http://www.fruitfly. org/seq_tools/promoter.html). Scans for j54 binding site patterns were carried out by using the Fuzznuc program

169

available at the server of the European Bioinformatics Institute (http://srs.ebi.ac.uk/). To detect the Rho-independent transcriptional terminators, we developed a JAVA program that implements the TransTerm algorithm (Ermolaeva et al., 2000). The codon preference statistic was calculated for every ORF by using a JAVA program developed by us, which implements the algorithm described by Gribskov et al. (1984), and compared to the P. putida KT2440 Codon Usage Table downloaded from the Codon Usage Database (Nakamura et al., 2000). Topology prediction of transmembrane proteins was performed by using the TMHMM Server (http://www.cbs.dtu.dk/services/ TMHMM/). Several different nomenclatures are used in the literature for the genes responsible for phenylacetic acid degradation; in this work, we have used the consensus nomenclature proposed by Luengo et al. (2001). 2.4. Construction of Pseudomonas sp. strain K1, a paa1 deletion mutant of strain Y2 In a previous work, we isolated the paa1 gene region of Pseudomonas sp. strain Y2 (Alonso et al., 2003; Fig. 1). The substitution of the sequence between the two EcoRV sites by the kanamycin resistance cassette of pUC4K (Table 1) led to the loss of the paaXYN2ABCDEFGHIJKL genes and part of the paaF2 and paaN genes. This construction was cloned into pKNG101 plasmid vector, giving rise to pKFAKm plasmid (Table 1), and subsequently transferred to Pseudomonas sp. strain Y2 by conjugation using E. coli S17-1Epir (pKFAKm) as donor strain. The R6K origin of replication of pKFAKm is not functional and thus it is unable to replicate into Pseudomonas sp. strain Y2. Therefore, the selection of the conjugation mix on LB supplemented with chloramphenicol, kanamycin and sucrose allowed the isolation of a Pseudomonas sp. strain Y2-derived clone, named K1, that had integrated the kanamycin cassette into its chromosome by double homologous recombination (Fig. 1), simultaneously causing both the complete deletion of paaXYN2ABCDEFGHIJKL genes and the partial deletion of paaF2 and paaN genes. The paa1 region genetic structure of this K1 clone was confirmed by Southern blot analysis (Fig. 1). 2.5. Isolation and sequencing of the paa2 gene cluster The streptomycin cassette delivery plasmid was constructed in two steps (Fig. 2). First, the 2.65 kb SalI fragment containing the Pseudomonas sp. strain Y2 paaGHI genes (Fig. 1) was cloned into pBluescript II KS+ yielding plasmid pBGI (Table 1). The insert of the resultant construction was excised with BamHI and ApaI and cloned into pKNG101 (Table 1) digested with the same two enzymes, giving rise to pK2.5AB (Table 1; Fig. 2A). Analysis of this plasmid revealed that a small

170

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

Fig. 1. Scheme of the previously described paa1 gene cluster of Pseudomonas sp. strain Y2. Dashed rectangles represent the paaA, paaF and paaJK probes used in the Southern blot analysis of paa1 sequences of strain Y2. The SalI restriction fragments of the paa1 gene cluster detected using the paaA probe (7.6 and 2.4 kb), paaF probe (7.6 and 2.3 kb) and paaJK probe (1.0 kb) are marked. The locations of the kanamycin resistance cassette in the Y2-ADKm, Y2-DGK and K1 mutant strains are shown. The Y2-ADKm mutant was confirmed by Southern blot using the paaA probe (S1): the 3.64 kb band resulted from the integration of the kanamycin resistance cassette (1.24 kb) into the 2.4 kb band. The Y2-DGK mutation was confirmed by Southern blot analysis carried out with two different probes. Results obtained with the paaF probe (S2) could be explained by the deletion of the three SalI sites located between paaF and paaL that produces the change of the size of the band that contains paaF from 2.3 to 11.8 kb. The paaJK probe (S3) only revealed the 9.0 kb band, whereas the 1.0 kb band corresponding to the paaJK genes disappeared. The complete deletion of the paa1 cluster in Pseudomonas sp. strain K1 was confirmed by Southern blot using the paaJK probe (S4). The 1.0 kb band that is detected in the Southern blot of the strain Y2 is not detected in the K1 mutant; however, the unexpected 9.0 kb band that appeared in the wild type Y2 is still present in the K1 mutant, suggesting the existence of sequence duplications within the chromosome of this bacterium.

fragment of the parent vector, affecting the sacB gene, was lost. Thus, pK2.5AB, unlike pKNG101, was innocuous in presence of sucrose. This construction was transferred by conjugation to Pseudomonas sp. strain Y2DGK (Alonso et al., 2003; Table 1; Fig. 1), using E. coli S17-1Epir (pK2.5AB) as donor strain. Selection on LB medium with kanamycin and streptomycin led to the isolation of a Pseudomonas clone named Pseudomonas sp. strain Y2-H2DK2.5 that had integrated the entire pK2.5AB plasmid into its chromosome by single homologous recombination between the paaGHI sequence of the plasmid and its homologous region of the paa2 cluster (Fig. 2B). The genomic DNA of this clone was prepared and separately digested with KpnI and ApaI. Each restriction reaction was used to construct one genomic library in pBluescript II KS+ plasmid vector and E. coli DH5aFV. By selection in LB medium with ampicillin and streptomycin, two clones were isolated, one from each library, that harboured the pF2K17 and pF2A11 plasmids, respectively (Table 1; Fig. 2B). To sequence the inserts of both plasmids, a combined strategy of subcloning and primer design was carried

out. A number of 30 overlapping subclones were constructed for the sequencing of this region (not shown). The partial sequences were cured of the pKNG101 and paaGHI sequences that had been rescued together with the paa2 cluster, and assembled to obtain a 16,692 bp sequence that encompassed most of the paa2 gene cluster. However, an incomplete paaM gene was detected at one end of this region, suggesting that not all the genes belonging to the paa2 cluster had been cloned. Therefore, a chromosome walking strategy, based on the chromosomal integration and subsequent rescue of a tetracycline resistance cassette was performed to clone the remaining paa2 genes. One of the subclones prepared for the above-mentioned sequencing work contained the plasmid pF2HS that carried paaI2, paaJ2, paaK2, paaP2 and almost the whole paaL2 genes (Table 1; Fig. 2C). The tetA gene of pUCP26 plasmid (Table 1) was recovered as a 1.46 kb ClaI–PvuI fragment, polished with T4 polymerase and cloned into the unique EcoRV site of pBluescript II KS+, giving rise to pBTc plasmid (Table 1; Fig. 2C). The tetracycline resistance cassette was excised from this construction by double digestion

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

171

Fig. 2. (A) Map of the pK2.5AB plasmid used for the truncation and the isolation of the paa2 gene cluster. strA and strB encode streptomycin resistance. rep/ mob indicates the mobilization and replication region. Only relevant restriction sites are represented. (B) Integration of pK2.5AB into the paa2 region of Pseudomonas sp. strain Y2-DGK occurred by homologous recombination between some point inside the paaGHI genes (later sequencing work showed that recombination took place between the paaH and paaH2 genes), giving rise to a hybrid cluster (paa1 genes in white, paa2 genes in black, other genes in grey). Cloning of the DNA fragments that contained the streptomycin resistance genes allowed the isolation of plasmids pF2K17 and pF2A11 (only inserts are represented). Sequencing of these plasmids led to the identification of 18 putative genes, 14 of them homologous to the already reported paa1 genes. A truncated paaM gene was detected at the right end of this region. (C) Scheme of the plasmids used for the chromosome walking into the remaining sequence of the paa2 cluster. bla and tetA encode the ampicillin and tetracycline resistance, respectively. sacB encodes a levane sucrose activity that leads to cell death in presence of sucrose. The construction steps are detailed in Materials and methods. (D) Map of the result of the integration of the tetA resistance cassette into the paa2 region of Pseudomonas sp. strain Y2 by double homologous recombination. Tetracycline selection of a EcoRI genomic library led to the isolation of pF2VI plasmid (only insert is represented), carrying paaL2MN3 genes.

with PstI and ClaI, and cloned into pF2HS plasmid cut with the same two enzymes. The resultant plasmid, named pAV-I, carried the tetA gene between the truncated paaJ2 and paaP2 genes (Table 1; Fig. 2C). The insert of pAV-I was isolated with SacI and ApaI and cloned into pKNG101, giving rise to pAV-II (Table 1; Fig. 2C). This plasmid was transferred from E. coli S17-1Epir (pAV-II) to Pseudomonas sp. strain Y2 by biparental mating. Selection on LB medium supplemented with chloramphenicol, tetracycline and sucrose led to the isolation of a Pseudomonas clone named Pseudomonas sp. strain Y2-J2DTc that had integrated the tetracycline resistance cassette into the chromosomal paa2 region by double homologous recombination (Table 1; Fig. 2D). The genomic DNA of this bacterium was cut with EcoRI and used to construct a gene library in pBluescript II KS+ plasmid vector and E. coli DH5aFV. Selection on LB medium supplemented with

ampicillin and tetracycline led to the isolation of a clone carrying the recombinant plasmid named pF2-VI (Table 1; Fig. 2D). A sequence of 4870 bp of the insert of pF2-VI enlarged the already known data to a 21562 bp sequence that contained the whole paa2 gene cluster of Pseudomonas sp. strain Y2. The GeneBank accession number for the sequence reported in this paper is AJ579894. 2.6. Construction of paa2 deletion mutants derived from Pseudomonas sp. strains Y2 and K1 First, a 1203 bp KpnI–ApaI DNA fragment containing most of the PY01 gene was cloned into plasmid pBTc cut with these two enzymes, giving rise to plasmid pDel-II (Table 1; Fig. 3). Next, a 1758 bp PstI fragment comprising the 3V terminus of paaN3 and the 3V terminus of PY04 was

172

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

Fig. 3. (A) Scheme of the paa2 cluster of Pseudomonas sp. strain Y2. Genes related with PAA catabolism are in black. Other genes are in grey. Only relevant restriction sites are displayed. The paa2 specific, 9.0 kb SalI fragment detected with the paaJK probe is marked. (B) Plasmids used for the deletion of the whole paa2 cluster from Pseudomonas sp. strain Y2 to yield strain T2, and from strain K1 to give strain K1-T2 (see Materials and methods for details). (C) Southern blot of Pseudomonas sp. strain Y2 and the derived paa deletion mutants, using the paaJK probe. (D) Growth curves of Pseudomonas sp. strain Y2, K1 mutant and T2 mutant in M9 minimal medium supplemented with 0.2% (w/v) phenylacetate.

cloned into the unique PstI site of pDel-II, yielding plasmid pDel-III (Table 1; Fig. 3). The orientation of the recombinant product of this last cloning step was confirmed by restriction analysis. Finally, this plasmid was digested with BamHI and the 3810 bp fragment, containing part of PY01, the tetracycline resistance gene, part of paaN3 and part of PY04, was gel purified and cloned into the unique BamHI site of pKNG101. Transformation of E. coli CC118 Epir with the ligation mixture and the subsequent selection on LB plates supplemented with tetracycline and streptomycin, led to the isolation of a resistant clone that harboured a 10647 bp plasmid, named pDel-IV (Table 1; Fig. 3). This plasmid was transferred to E. coli S17-1Epir by electroporation and the transformed clone was used to mobilize the plasmid pDel-IV to both Pseudomonas sp. strain Y2 and Pseudomonas sp. strain K1 in two independent conjugation experiments. Selection on LB plates supplemented with tetracycline, chloramphenicol and sucrose led to the isolation of Pseudomonas derivatives that had integrated the tetracycline cassette into their chromosomes by double homologous recombination: clone T2 was obtained from Pseudomonas sp. strain Y2 and clone K1-T2 was derived

from Pseudomonas sp. strain K1 (Table 1). The deletion of the paa2 DNA region in these two clones was verified by Southern blot analysis (Fig. 3).

3. Results and discussion 3.1. Duplication of paa sequences: a second paa2 gene cluster in Pseudomonas sp. strain Y2? Southern blot analyses of SalI-digested chromosomal DNA of strain Y2 were performed using digoxigeninlabelled paa1 probes (Fig. 1). Surprisingly, besides the two SalI bands of 2.4 and 7.6 kb that were expected using a paaA probe, the analysis revealed an additional band of 12.2 kb. Moreover, when a paaF probe was used three positive bands appeared but only those of 2.3 and 7.6 kb, respectively, matched the expected fragments from the already known paaF and paaF2 genes, whereas the third 9.0 kb band could not be explained by the known sequence. Finally, Southern analysis performed with a paaJK probe yielded the expected 1.0 kb band from the paa1 gene cluster

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

173

plus an unexpected 9.0 kb positive band. All these results strongly suggested the occurrence of duplication of paa sequences in the genome of Pseudomonas sp. strain Y2.

cluster, although the possibility of an alternative phenylacetic acid degradation pathway, involving different genes, could not be completely ruled out at that moment.

3.2. Mutants in the paa1 gene cluster are still able to metabolize phenylacetic acid

3.3. Isolation and sequence analysis of the paa2 gene cluster

Two insertional mutants of the strain Y2, named Y2ADKm and Y2-DGK, carrying the kanamycin resistance cassette of pUC4K (Table 1), had been previously constructed for chromosome walking purposes (Alonso et al., 2003). Their genetic structure was confirmed by Southern blot analyses (Fig. 1). Unexpectedly, both mutants grew in M9 medium supplemented with either styrene or phenylacetic acid, showing that they were still able to use these compounds as the sole carbon and energy source. To confirm these results, a complete paa1 cluster deletion mutant, named K1, was made (see Materials and methods). When a Southern blot analysis was carried out on the K1 strain using the paaJK digoxigenin-labelled probe, the 1.0 kb SalI band corresponding to the paa1 gene cluster was not detected, whereas the 9.0 kb SalI band putatively assigned to the paa2 cluster was still present (Fig. 1). More important, although strain K1 lacked the paa1 cluster, it can grow as well as the wild type strain Y2 when cultured in M9 medium supplemented with phenylacetic acid (Fig. 3D). Altogether, the Southern blot analyses and the growth of the mutant strains in phenylacetic acid, supported the hypothesis of the occurrence of a second functional paa2 gene

The isolation of the paa2 gene cluster was achieved after two cloning steps. First, a streptomycin resistance cassette was integrated into the paa2 region by homologous recombination and then the cassette was rescued together with the surrounding DNA. Second, a chromosomal walking step was carried out into the next region using a tetracycline resistance cassette (see Materials and methods and Fig. 2). The analysis of overlapping clones and subclones yielded a sequence of 21,562 bp that allowed the characterization of the whole paa2 gene cluster of Pseudomonas sp. strain Y2. The sequence analysis of the paa2 gene region revealed the occurrence of twenty one ORFs that may encode putative products both related and unrelated to the phenylacetic acid catabolism (Table 2; Fig. 4). Two ORFs (PY01 and PY04) of undefined function are flanking the paa2 gene cluster and two genes (PY02 and PY03) never reported to date are in the middle of the cluster (see below). The rest of the genes are homologous to previously reported phenylacetate catabolic genes of Pseudomonas species. The identities between the individual paa2 genes and their homologs of either the paa region of P. putida KT2440 or the paa1 region of Pseudomonas sp. strain Y2 were rather

Table 2 ORFs and putative products of the paa2 region of Pseudomonas sp. strain Y2 ORFa

Location and lengthb

% GC

Product size and weight

Putative functionc

PY01 paaX2 paaY2 paaA2 paaB2 paaC2 paaD2 paaE2 paaF3 PY02 PY03 paaG2 paaH2 paaI2 paaJ2 paaK2 paaP2 paaL2 paaM paaN3 PY04 d

52Y1323 (1272 bp) 1325p2248 (924 bp) 2322p2921 (796 bp) 3160Y3930 (771 bp) 3942Y4733 (792 bp) 4738Y6255 (1518 bp) 6248Y6688 (441 bp) 6685Y7896 (1212 bp) 7991Y9310 (1329 bp) 9456p10040 (585 bp) 10044p10619 (576 bp) 10822Y11811 (990 bp) 11837Y12118 (282 bp) 12118Y12885 (768 bp) 12872Y13405 (534 bp) 13438Y14514 (1077 bp) 14629Y14937 (309 bp) 14934Y16496 (1563 bp) 16525Y17751 (1227 bp) 17787Y19841 (2055 bp) 19932pN21562 (N1631 bp)

68.00 65.15 65.66 67.96 67.17 70.02 68.02 69.96 64.69 66.49 66.14 62.52 64.89 67.96 69.66 64.53 62.45 65.77 66.99 68.42 55.99

423 aa, 46.66 kDa 307 aa, 34.88 kDa 199 aa, 21.31 kDa 256 aa, 27.54 kDa 263 aa, 28.78 kDa 505 aa, 53.18 kDa 146 aa, 15.61 kDa 403 aa, 42.42 kDa 439 aa, 49.33 kDa 194 aa, 20.74 kDa 191 aa, 21.01 kDa 329 aa, 37.83 kDa 93 aa, 10.44 kDa 255 aa, 28.92 kDa 177 aa, 19.33 kDa 358 aa, 39.44 kDa 102 aa, 11.10 kDa 520 aa, 54.87 kDa 408 aa, 44.83 kDa 684 aa, 73.04 kDa N542 aa, N58.63 kDa

ATP binding protein Transcriptional repressor Regulator Enoyl-CoA hydratase I Enoyl-CoA hydratase II 3-hydroxyacyl-CoA dehydrogenase Unknown Ketothiolase Phenylacetate-CoA ligase TetR family transcriptional regulator NAD (P) H dehydrogenase Ring oxidation complex. Protein 1 Ring oxidation complex. Protein 2 Ring oxidation complex. Protein 3 Ring oxidation complex. Protein 4 Ring oxidation complex. Protein 5 Membrane protein Phenylacetate permease Porin Ring opening enzyme Unknown

a b c d

ORFs related to the phenylacetic acid catabolism are in bold type. Coordinates correspond to the numbering of the reported paa2 sequence. Arrows indicate the ORF orientation. Lengths include the stop codon. Proposed function is based on the most similar proteins in public databases. Start codon of PY04 has not been reached in the sequencing work.

174 D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

Fig. 4. Comparison of the paa2 cluster of Pseudomonas sp. strain Y2 (middle) with the paa1 cluster of the same bacterium (bottom) and the paa gene cluster of P. putida KT2440 (top). Homologous sequences are identically drawn. Arrows indicate the sense of transcription. P. putida KT2440 gene nomenclature includes the identification system. PY01, PY02, PY03 and PY04 are putative genes not related with previously reported paa genes. The percentage of identity at DNA level of homologous genes is shown in rectangles.

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

high (Fig. 4), suggesting a similar divergence time among these three sets of genes. The organization of paa2 genes (Fig. 4) is almost identical to that of the paa genes of P. putida KT2440 (Nelson et al., 2002; Luengo et al., 2001; Jimenez et al., 2002) suggesting a close relationship between both clusters. On the other hand, when paa2 gene organization is compared to the previously reported paa1 cluster of strain Y2 (Alonso et al., 2003), several differences are detected (Fig. 4): (i) the paa2 region does not show any gene duplication (the paa1 cluster contains two copies of paaF); (ii) the paa2 cluster contains the paaN3 gene, a homolog of the paaN gene that is present in the paa1 cluster, but lacks a gene similar to paaN2, an analog to paaN also present in the paa1 cluster; (iii) the paa2 cluster contains a paaM gene that putatively codes for a porin and that is absent in the paa1 cluster; and (iv) the paa2 cluster is flanked by genes encoding activities unrelated to phenylacetate degradation, being a physically isolated functional genetic unit, in contrast with the paa1 cluster that is located next to the sty genes suggesting that most likely they share a common evolutionary history (see below). A short ORF (309 bp including the stop codon), named paaP2, is located upstream of paaL2 gene (Fig. 4). Searching of sequence databases revealed the existence of similar genes of unknown function, that are always located upstream of, and in most cases overlapping with, genes that encode sodium/solute symporter proteins similar to PaaL (Table 3). Particularly significant is the similarity of the paaP2 product with the product of the homologous PP3273 gene of P. putida KT2440, which is also located upstream of the paaL gene of this bacterium (Fig. 4). A more detailed analysis of the DNA region upstream the paaL gene of the paa1 cluster of strain Y2 showed the occurrence of a

175

previously unreported ORF that has been named paaP and that exhibits the same characteristics as paaP2 (Table 3). The length and location of paaP are similar to those of paaP2 and their encoded products present a 56.9% of identity. The analysis of the codon usage of paaP2, and in a lesser extent that of paaP, revealed no substantial differences with the codon usage of the rest of the genes of the paa1 and paa2 clusters of strain Y2 (data not shown), suggesting that both paaP and paaP2 genes actually encode protein products. Furthermore, RNA analysis of cells growing in phenylacetic acid suggested the presence of a paaP transcript (preliminary results). The arrangement of paaP2 and paaL2 strongly suggests that both genes may form a functional unit involved in the uptake of phenylacetic acid. Similarly, paaP and paaL may constitute another unit with the same function. Finally, the analysis of the amino acid sequence of PaaP2 and PaaP proteins revealed the occurrence of two putative transmembrane regions in good agreement with that hypothesis (data not shown). Two genes, PY01 and PY04, are flanking the paa2 cluster (Fig. 4 and Table 2). The PY01 protein is similar to ATP-binding proteins associated with substrate transport systems unrelated to phenylacetic acid catabolism. The PY04 is a longer ORF (the sequence work did not reach its methionine initiation codon) whose putative protein product did not show significant similarity with any protein in databases. Both its GC content and its codon usage are significantly different from those of the paa2 genes, suggesting that PY04 is not part of the paa2 gene cluster. The occurrence of the PY02 and PY03 genes is a unique feature of the paa2 cluster of Pseudomonas sp. strain Y2 (Fig. 4). No homologous sequence to these genes has been reported in any of the paa clusters described to date. These two genes are very similar to the XAC2228 and XAC2229

Table 3 Names and features of genes homologous to paaP2 of Pseudomonas sp. strain Y2 trEMBL accession number

Gene name

Similarity

Organism

Downstream gene; distance

Function of the product of the downstream gene

Q88HTO

PP3273

97/102 (95.1%)

paaP

78/102 (76.5%)

Q89MS8

BLR4114

70/102 (68.6%)

yjcH or Z5667 or ECS5050 PSPTO1623

65/104 (62.5%)

PP3274/paaL, 4 bp; overlapping paaL, 4 bp; overlapping BLR4115, 4 bp; overlapping yjcG, 4 bp; overlapping PSPTO1624, 4 bp; overlapping yjcG, 4 bp; overlapping STY4471, 4 bp; overlapping PA3234, 4 bp; overlapping YPO0251, 4 bp; overlapping ppa 26 bp

phenylacetic acid transporter phenylacetic acid transporter putative symporter

Q8X576

Pseudomonas putida KT2440 Pseudomonas sp. strain Y2 Bradyrhizobium japonicum Escherichia coli O157:H7 Pseudomonas syringae Salmonella typhimurium Salmonella typhi

Q886F6 Q8ZKF7 Q8Z1R1 Q9HZ05 Q8ZJ72 Q8P3L3

yjcH or STM4274 STY4472 or T4180 PA3235 YPO0252 or Y0509 XCC4058

62/103 (60.2%) 62/104 (59.6%) 62/104 (59.6%) 61/103 (59.2%) 60/103 (58.3%) 63/105 (60.0%)

Pseudomonas aeruginosa PAO1 Yersinia pestis Xanthomonas campestris

putative transport protein sodium/solute symporter family protein putative SSS family transport protein sodium/solute symporter family protein probable sodium/solute symporter putative transmembrane transport protein solute/Na+ symporter

176

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

genes from Xanthomonas axonopodis (da Silva et al., 2002) and, in a lesser extent, to the PA1226 and PA1225 genes from Pseudomonas aeruginosa (Stover et al., 2000). In these three bacteria, both genes are located in completely different genetic environments; they are close together, although in P. aeruginosa they are divergently oriented (Fig. 5). Interestingly, none of these bacteria, except Pseudomonas sp. strain Y2, harbours a set of paa genes. Moreover, P. putida KT2440, whose paa cluster is the most similar to both paa1 and paa2 clusters of Pseudomonas sp. strain Y2, lacks a set of genes homologous to the PY02 and PY03 genes in its whole genome. These findings suggest a probably independent evolutionary history for both the paa2 cluster and the PY02/03 genes. Although it is still unknown whether and how PY02/03 genes could have been integrated within the paa2 cluster, the presence of inverted repeats in the region between PY02 and paaF3 (see below) could be the remnants of a recombination event that gave rise to the current gene arrangement of this genomic region. The study of the intergenic regions (Fig. 6) led to the identification of four putative j70 promoter-like sequences located upstream paaY2, paaA2, PY03 and paaG2, respectively. No other archetypical j70 or j54 promoter signatures were detected. Search for terminator signals revealed a palindromic sequence located downstream of paaK2, followed by a CNG region, that could act as a Rhodependent transcriptional terminator (Alifano et al., 1991). A RNA hairpin forming sequence between paaN3 and

PY04 could also act as a transcription termination signal. Moreover, two 40 bp inverted repeats were found between paaF3 and PY02 (Fig. 6). Overlapping with one of these repeats and with the end of PY02 a REP-like sequence has also been detected. Its structure (TCGCGGCTAAAGCCGCTCCTAC) (Fig. 6) is identical to the P. putida REP consensus sequence (Aranda-Olmedo et al., 2002), with the only exception of one change in the left inverted repeat (in black) that is compensated by a complementary change in the right repeat. Finally, an intergenic AT-rich inverted repeat is located between PY03 and paaG2, in the region where two putative promoters exist and overlapping with one of them, PG2 . Remarkably, the sequences of the putative promoters that are upstream paaA2 and paaG2 genes contain a 14 bp common pattern (Fig. 6) which is also present in the promoters that putatively drive the transcription of homologous genes of both the paa1 cluster of Pseudomonas sp. strain Y2 and the paa cluster of P. putida KT2440. In a previous work, we had suggested that this sequence could act as a signal involved into the regulation of the transcription of some paa1 operons (Alonso et al., 2003). This hypothesis gets additional support by the finding of very similar sequences in the promoters of the paa2 cluster. The role of this sequence in the regulation of the expression of the paa1 and paa2 gene clusters will be experimentally tested. The comparison among homologous intergenic regions of paa1 and paa2 clusters of strain Y2 and paa cluster of P. putida KT2440 revealed a much lower

Fig. 5. Scheme of the Pseudomonas sp. strain Y2 DNA region containing the PY02 and PY03 genes and DNA regions with homologous genes from Xanthomonas axonopodis (top) and P. aeruginosa PA01 (bottom). Percentages indicate the level of identity between homologous genes. Proposed functions for the products of X. axonopodis and P. aeruginosa PA01 genes are annotated. No relevant similarities were found between any pair of genes from these regions except those that are marked in the figure.

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

177

Fig. 6. Putative transcription signals of the paa2 gene cluster of strain Y2. Putative promoters (arrows) and transcriptional terminators (hairpins) are shown. The sequences of PA2 , PG2 , PY2 and PPY03 putative promoters and their score values produced by the prediction program (see Materials and methods) are shown (14 bp putative operator sites are underlined in PA2 and PG2 ). Inverted repeats in the paaF3-PY02 and PY03-paaG2 intergenic regions are detailed.

conservation degree than when homologous paa coding sequences were compared (data not shown). The arrangement of the paa2 genes and the postulated transcription control signals suggested that paa2 cluster is organized in four operons, namely paaY2X2, paaA2B2C2D2E2F3, paaG2H2I2J2K2 and paaP2L2MN3, respectively (Fig. 6). The co-transcription of these last four genes (paaP2, paaL2, paaM and paaN3) will be experimentally confirmed by further studies. The negative results of searching for putative transcription signals in the region between paaP2 and paaL2 and between paaP and paaL genes, together with the possible cooperation of the putative products of both genes in the transmembrane transport reinforces the possibility of a paaP2L2MN3 transcriptional unit. In a similar way, paaP, together with the genes located immediately downstream, may constitute a paaPLN operon in the paa1 gene cluster. Preliminary results of RNA analysis suggested the existence of a paaP–paaL transcript (data not shown). PY03 and PY02 are probably cotranscribed, giving rise to an independent operon. Details of the transcription of PY01 and PY04 could not been inferred from the sequence data. 3.4. Deletion of the paa2 gene cluster A double recombination event directed by sequences from PY01 and PY04 genes led to the deletion of the whole paa2 cluster and its substitution by a tetracycline resistance cassette (see Materials and methods and Fig. 3). This paa2 deletion was carried out both in strain Y2 and in strain K1, through two independent experiments. The clone obtained from Pseudomonas sp. strain Y2 as receptor strain was named T2, and the clone derived from the strain K1 was named K1-T2. The complete deletion of the paa2 DNA region in these two clones was verified by Southern blot analysis (Fig. 3C). When the ability of both clones to degrade phenylacetate was checked, we observed that the T2 clone was still able to use phenylacetic acid as the sole carbon and energy source, as the Y2 parental strain and the

K1 mutant did (data not shown), confirming the functionality of the paa1 gene cluster in Pseudomonas sp. strain Y2. However, the K1-T2 clone, that lacks both the paa1 and paa2 gene clusters, lost the ability to use phenylacetic acid as carbon source. Growth curves of the Pseudomonas sp. strain Y2 and the two single K1 and T2 mutants on phenylacetic acid as the sole energy and carbon source were compared (Fig. 3D). The growing rate of the T2 mutant is undistinguishable from that of the Y2 parental strain while the K1 mutant growth displays some minor differences that will deserve further attention. These results show that both paa1 and paa2 clusters are independently functional for the catabolism of the phenylacetic acid in Pseudomonas sp. strain Y2. The existence of duplicated operons in bacteria is a rare event. Case examples are the followings: (i) the two copies of the tfd gene cluster for chlorophenol and chlorocatechol metabolism in Ralstonia eutropha are located on a catabolic plasmid, have a different G+C content and do not show a conserved gene organization, indicating an independent evolutionary origin (Laemmli et al., 2000); (ii) the cfx genes of R. eutropha code for several enzymes of the Calvin cycle, are duplicated and organized in two operons, one located in the chromosome and the other in a megaplasmid; both clusters display the same gene organization and their homologous genes are very similar (Windhovel and Bowien, 1990) suggesting that they derive from a common ancestor; (iii) the abm genes responsible of the aerobic catabolism of 2-aminobenzoate in Azoarcus evansii are organized in two identical copies of an 8-gene operon (Schuhle et al., 2001), suggesting that they are the result of a duplication process. The paa1 and paa2 gene clusters of Pseudomonas sp. strain Y2 display a more complex structural pattern: (i) the genes of the clusters are organized in several putative transcriptional units; (ii) most of the paa genes, but not all, have a copy in each cluster; (iii) paaF is duplicated into the paa1 cluster, each copy being part of a different putative operon. The individual genes of both sets are very similar, both to each other and when compared to

178

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179

paa genes of P. putida. However, the gene organization of both Pseudomonas sp. strain Y2 gene clusters is clearly different. The paa2 genes are organized very similarly to the paa genes of P. putida KT2440. The cluster has no repeated genes and only the occurrence of two foreign genes, PY02 and PY03, could reflect a particular event in its evolutionary history. In contrast, the Pseudomonas sp. strain Y2 paa1 cluster shows a more complex gene arrangement most likely due to an independent and more complex evolutionary process. Moreover and most important, both paa1 and paa2 clusters are independently functional in the degradation of phenylacetate. Why or since when does Pseudomonas sp. strain Y2 keep two active, rather long gene regions for the degradation of phenylacetic acid, are open questions. The paa1 cluster, although still active, seems to be the result of a complex evolutionary history, as shown by the facts that paaM gene is lacking, paaF2 may be the result of duplication and rearrangement processes, and paaN2 could have been transferred from an analogous system (Alonso et al., 2003). Remarkably, the paa1 cluster is located next to the sty gene cluster that codes for styrene upper catabolic pathway in this bacterium. Furthermore, some preliminary data pointed to a crossed regulation pattern between both the sty and the paa genes. The possibility that these two gene clusters would have had a common evolutionary history as a higher order sty-paa1 cluster encoding the activities for the complete styrene degradation pathway and that in this form they were transferred as a unit, probably by horizontal transfer, into an ancestor phenylacetate degrading bacterium carrying the paa2 cluster is a very attractive hypothesis.

Acknowledgements This work has been supported by grants from the Spanish Ministerio de Ciencia y Tecnologı´a (BMC2000-0125-C04031) and from the Comunidad de Madrid (07M/0080/2000). D. Bartolome´-Martı´n is the recipient of a fellowship from the Spanish Ministerio de Educacio´n, Cultura y Deporte. E. Martı´nez-Garcı´a has been supported by a post-doctoral fellowship from the Comunidad de Madrid. We are grateful to Eduardo Dı´az for his continuous help and to Jose´ Luis Garcı´a for his encouragement and advice and for the critical review of the manuscript.

References Alifano, P., Rivellini, F., Limauro, D., Bruni, C.B., Carlomagno, M.S., 1991. A consensus motif common to all Rho-dependent prokaryotic transcription terminators. Cell 64, 553 – 563. ´ lamo, M., Dı´az, E., Garcı´a, J.L., Alonso, S., Bartolome´-Martı´n, D., del A Perera, J., 2003. Genetic characterization of the styrene lower catabolic pathway of Pseudomonas sp. strain Y2. Gene 319C, 71 – 83. Aranda-Olmedo, I., Tobes, R., Manzanera, M., Ramos, J.L., 2002. Speciesspecific repetitive extragenic palindromic (REP) sequences in Pseudomonas putida. Nucleic Acids Res. 30, 1826 – 1833.

Beltrametti, F., Marconi, A.M., Bestetti, G., Colombo, C., Galli, E., Ruzzi, M., Zennaro, E., 1997. Sequencing and functional analysis of styrene catabolism genes from Pseudomonas fluorescens ST. Appl. Environ. Microbiol. 63, 2232 – 2239. da Silva, A.C., et al., 2002. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature 417, 459 – 463. de Lorenzo, V., Timmis, K.N., 1994. Analysis and construction of stable phenotypes in gram-negative bacteria with Tn5- and Tn10-derived minitransposons. Methods Enzymol. 235, 386 – 405. Ermolaeva, M.D., Khalak, H.G., White, O., Smith, H.O., Salzberg, S.L., 2000. Prediction of transcription terminators in bacterial genomes. J. Mol. Biol. 301, 27 – 33. Ferra´ndez, A., Min˜ambres, B., Garcı´a, B., Olivera, E.R., Luengo, J.M., Garcı´a, J.L., Dı´az, E., 1998. Catabolism of phenylacetic acid in Escherichia coli. Characterization of a new aerobic hybrid pathway. J. Biol. Chem. 273, 25974 – 25986. Gribskov, M., Devereux, J., Burgess, R.R., 1984. The codon preference plot: graphic analysis of protein coding sequences and prediction of gene expression. Nucleic Acids Res. 12, 539 – 549. Herrero, M., de Lorenzo, V., Timmis, K.N., 1990. Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria. J. Bacteriol. 172, 6557 – 6567. Inoue, H., Nojima, H., Okayama, H., 1990. High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23 – 28. Ismail, W., El-Said Mohamed, M., Wanner, B.L., Datsenko, K.A., Eisenreich, W., Rohdich, F., Bacher, A., Fuchs, G., 2003. Functional genomics by NMR spectroscopy. Phenylacetate catabolism in Escherichia coli. Eur. J. Biochem. 270, 3047 – 3054. Jimenez, J.I., Minambres, B., Garcia, J.L., Diaz, E., 2002. Genomic analysis of the aromatic catabolic pathways from Pseudomonas putida KT2440. Environ. Microbiol. 4, 824 – 841. Kaniga, K., Delor, I., Cornelis, G.R., 1991. A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109, 137 – 141. Laemmli, C.M., Leveau, J.H., Zehnder, A.J., van der Meer, J.R., 2000. Characterization of a second tfd gene cluster for chlorophenol and chlorocatechol metabolism on plasmid pJP4 in Ralstonia eutropha JMP134(pJP4). J. Bacteriol. 182, 4165 – 4172. Luengo, J.M., Garcı´a, J.L., Olivera, E.R., 2001. The phenylacetyl-CoA catabolon: a complex catabolic unit with broad biotechnological applications. Mol. Microbiol. 39, 1434 – 1442. Miller, J., 1972. Experiments in Molecular Genetics. Cold Spring Harbor, New York. Mohamed Mel, S., Ismail, W., Heider, J., Fuchs, G., 2002. Aerobic metabolism of phenylacetic acids in Azoarcus evansii. Arch. Microbiol. 178, 180 – 192. Nakamura, Y., Gojobori, T., Ikemura, T., 2000. Codon usage tabulated from international DNA sequence databases: status for the year 2000. Nucleic Acids Res. 28, 292. Nelson, K.E., Weinel, C., Paulsen, I.T., Dodson, R.J., Hilbert, H., Martins dos Santos, V.A., Fouts, D.E., Gill, S.R., Pop, M., Holmes, M., Brinkac, L., Beanan, M., DeBoy, R.T., Daugherty, S., Kolonay, J., Madupu, R., Nelson, W., White, O., Peterson, J., Khouri, H., Hance, I., Chris Lee, P., Holtzapple, E., Scanlan, D., Tran, K., Mowazzez, A., Utterback, T., Rizzo, M., Lee, K., Kosack, D., Moestl, D., Wedler, H., Lauber, J., Stjepandic, D., Hoheisel, J., Straetz, M., Heim, S., Kiewitz, C., Eisen, J., Timmis, K.N., Dusterhoft, A., Tummler, B., Fraser, C.M., 2002. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ. Microbiol. 4, 799 – 808. O’Connor, K., Buckley, C.M., Hartmans, S., Dobson, A.D., 1995. Possible regulatory role for nonaromatic carbon sources in styrene degradation by Pseudomonas putida CA-3. Appl. Environ. Microbiol. 61, 544 – 548.

D. Bartolome´-Martı´n et al. / Gene 341 (2004) 167–179 O’Leary, N.D., O’Connor, K.E., Duetz, W., Dobson, A.D., 2001. Transcriptional regulation of styrene degradation in Pseudomonas putida CA-3. Microbiology 147, 973 – 979. Olivera, E.R., Min˜ambres, B., Garcı´a, B., Muniz, C., Moreno, M.A., Ferra´ndez, A., Dı´az, E., Garcı´a, J.L., Luengo, J.M., 1998. Molecular characterization of the phenylacetic acid catabolic pathway in Pseudomonas putida U: the phenylacetyl-CoA catabolon. Proc. Natl. Acad. Sci. U. S. A. 95, 6419 – 6424. Panke, S., Witholt, B., Schmid, A., Wubbolts, M.G., 1998. Towards a biocatalyst for (S)-styrene oxide production: characterization of the styrene degradation pathway of Pseudomonas sp. strain VLB120. Appl. Environ. Microbiol. 64, 2032 – 2043. Rost, R., Haas, S., Hammer, E., Herrmann, H., Burchhardt, G., 2002. Molecular analysis of aerobic phenylacetate degradation in Azoarcus evansii. Mol. Genet. Genomics 267, 656 – 663. Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P., Rajandream, M.A., Barrell, B., 2000. Artemis: sequence visualization and annotation. Bioinformatics 16, 944 – 945. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, New York. Schuhle, K., Jahn, M., Ghisla, S., Fuchs, G., 2001. Two similar gene clusters coding for enzymes of a new type of aerobic 2-aminobenzoate (anthranilate) metabolism in the bacterium Azoarcus evansii. J. Bacteriol. 183, 5268 – 5278. Stover, C.K., Pham, X.Q., Erwin, A.L., Mizoguchi, S.D., Warrener, P., Hickey, M.J., Brinkman, F.S., Hufnagle, W.O., Kowalik, D.J., Lagrou,

179

M., Garber, R.L., Goltry, L., Tolentino, E., Westbrock-Wadman, S., Yuan, Y., Brody, L.L., Coulter, S.N., Folger, K.R., Kas, A., Larbig, K., Lim, R., Smith, K., Spencer, D., Wong, G.K., Wu, Z., Paulsen, I.T., 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406, 959 – 964. Taylor, L.A., Rose, R.E., 1988. A correction in the nucleotide sequence of the Tn903 kanamycin resistance determinant in pUC4K. Nucleic Acids Res. 16, 358. Utkin, I.B., Yakimov, M.M., Matveeva, L.N., Kozlyak, E.I., Rogozhin, I.S., Solomon, Z.G., Bezborodov, A.M., 1991. Degradation of styrene and ethylbenzene by Pseudomonas species Y2. FEMS Microbiol. Lett., 237 – 242. Velasco, A., Alonso, S., Garcia, J.L., Perera, J., Diaz, E., 1998. Genetic and functional analysis of the styrene catabolic cluster of Pseudomonas sp. strain Y2. J. Bacteriol. 180, 1063 – 1071. West, S.E., Schweizer, H.P., Dall, C., Sample, A.K., Runyen-Janecky, L.J., 1994. Construction of improved Escherichia–Pseudomonas shuttle vectors derived from pUC18/19 and sequence of the region required for their replication in Pseudomonas aeruginosa. Gene 148, 81 – 86. Windhovel, U., Bowien, B., 1990. On the operon structure of the cfx gene clusters in Alcaligenes eutrophus. Arch. Microbiol. 154, 85 – 91. Woodcock, D.M., Crowther, P.J., Doherty, J., Jefferson, S., DeCruz, E., Noyer-Weidner, M., Smith, S.S., Michael, M.Z., Graham, M.W., 1989. Quantitative evaluation of Escherichia coli host strains for tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic Acids Res. 17, 3469 – 3478.