Characterization of a stearoyl-acyl carrier protein desaturase gene from potential biofuel plant, Pongamia pinnata L.

Gene 542 (2014) 113–121

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Characterization of a stearoyl-acyl carrier protein desaturase gene from potential biofuel plant, Pongamia pinnata L. Aadi Moolam Ramesh, Vigya Kesari, Latha Rangan ⁎ Department of Biotechnology, Indian Institute of Technology Guwahati, Assam 781 039, India

a r t i c l e

i n f o

Article history: Received 16 November 2013 Received in revised form 13 March 2014 Accepted 25 March 2014 Available online 26 March 2014 Keywords: Carbon chain elongation Copy number Expression analysis Pongamia pinnata Stearoyl-acyl carrier protein desaturase (SAD)

a b s t r a c t A new full length cDNA clone encoding stearoyl-ACP desaturase (SAD) was isolated from seeds of Pongamia pinnata, an oil yielding legume plant. The cDNA clone (PpSAD) contained a single open reading frame of 1182bp coding for 393 amino acids with a predicted molecular mass of 45.04 kDa, and shares similarity with SAD from other plants. Characteristics of the deduced protein were predicted and analyzed using molecular homology modeling; its three dimensional structure strongly resembled the crystal structure of Ricinus communis (RcSAD). Southern blot analysis indicated that ‘sad’ is a multiple copy gene and was a member of a small gene family. Expression analysis using quantitative real-time PCR revealed that the gene showed marked distinct expression during different stages of seed developments. The results of the expression analysis in this study, combined with existing research, suggest that ‘sad’ gene may be involved in the regulation of plant seed growth and development. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Acyl-ACP desaturase enzymes catalyze the conversion of saturated fatty acids to unsaturated fatty acids by introducing the first double bond into saturated fatty acids. Different groups of enzymes involved in desaturation reaction have been identified in all eukaryotes, cyanobacteria and in some Bacillus bacteria as well (Bloomfield and Bloch, 1960; Fulco, 1974). Three types of desaturases are noticeable depending on the kind of compounds esterified to fatty acids (Murata and Wada, 1995). Desaturases identified in plants, animals and yeast are membrane-bound proteins with acyl chain attached to CoA or lipids. There are three types of fatty acid desaturase: acyl-CoA, acyl-ACP, and acyl-lipid desaturases. In plants and cyanobacteria, most desaturation reactions are catalyzed by acyl-lipid desaturases, which introduce unsaturated bonds into fatty acids that are in a lipid-bound form. Acyl-ACP desaturases are present in the plastids of plant cells and introduce the first double bond into fatty acids that are bound to acyl carrier protein (ACP) (Holloway, 1983; Maruta and Wada, 1995; Maruta et al., 1992). Acyl-CoA desaturases are present in animal, yeast and fungal cells, and they introduce unsaturated bonds into fatty acids that are bound to coenzyme A (CoA) (Macartney et al., 1994). The only known soluble desaturase is the plant stearoyl-ACP desaturase (SAD) specific to stearic acid localized in plastids. SAD catalyzes the desaturation of

Abbreviations: ACP, acyl carrier protein; DAF, days after flowering; PpSAD, Pongamia pinnata stearoyl-ACP desaturase. ⁎ Corresponding author. E-mail addresses: [email protected] (A.M. Ramesh), [email protected] (V. Kesari), [email protected], [email protected] (L. Rangan).

http://dx.doi.org/10.1016/j.gene.2014.03.047 0378-1119/© 2014 Elsevier B.V. All rights reserved.

stearoyl-ACP to oleoyl-ACP and plays a key role in determining the ratio of saturated fatty acids to unsaturated fatty acids in plants (Lindqvist et al., 1996) and this ratio is closely related to many functions of plants, especially with regard to acclimatization to low-temperature (Kodama et al., 1995). According to Edgar et al. (1994) the homologs of SAD are also present which involve in the formation of Δ6hexadecenoic acid (16:1Δ6) and oleic acid (18:1 Δ9) in the seed oil of Thunbergia alata. Although there are other desaturases (SAD homologs) in plants, the SAD catalyzed introduction of the first double bond at position nine in the FA carbon chain is the most important desaturation for the gel state to liquid crystal state transformation of membranes (Los and Murata, 1998). SAD also plays a key role in environmental changes like cold resistance in plants (Kodama et al., 1995; Tasseva et al., 2004), senescence regulation, resistance to fungal infection and mechanical damage (Kachroo et al., 2003; Lea, 2003). Many genes coding for SAD have been cloned from different plants (Carthamus tinctorius, T. alata, Ricinus communis, Solanum tuberosum) and the structure and functions of several SAD have been studied (Davydov et al., 2005; Lindqvist et al., 1996). Antisense expression of Brassica rapa SAD gene in Brassica napus led to dramatically increased stearate levels (up to 40%) in the seeds of transgenic B. napus (Knutzon et al., 1992). In the reverse, when the SAD gene from Lupinus luteus was overexpressed in tobacco, the transgenic tobacco contained very high level of oleic acid (up to 60%) in comparison with control plants (Zaborowska et al., 2002). These literatures imply that SAD gene promises to modify the composition of plant fatty acids. Pongamia pinnata (L.) Pierre, an arboreal legume, is a member of the subfamily Papilionoideae and family Leguminosae, native to tropics and

114

A.M. Ramesh et al. / Gene 542 (2014) 113–121

temperate Asia including part of India, China, Japan, Malaysia, and Australia. The plant has been synonymously known as Millettia pinnata, Pongamia glabra, and Derris indica; commonly it is referred as karanj, pongam, dalkaramch etc. Pongamia is drought resistant, semideciduous, nitrogen fixing leguminous tree (Nigel and Renee, 2008; Scott et al., 2008). The tree is well suited to intense heat and sunlight and its dense network of lateral roots and thick long tap roots make it drought tolerant (Bobade and Khyade, 2012). Historically, this plant has been used in India and neighboring regions as a source of traditional medicines, animal fodder, green manure, timber, fish poison and fuel. More importantly, P. pinnata has recently been recognized as a viable source of oil for the burgeoning biofuel industry (Kesari et al., 2008, 2009; Scott et al., 2008). Pongamia has received much attention because of its high content of seed oil (~28–39%, Kesari et al., 2012), which contains high amounts of C18 fatty acids, of which oleic acid and linoleic acid represent about 46 and 27.1%, respectively. Most research on P. pinnata has focused on techniques for extracting oil from seeds (Bobade and Khyade, 2012; Shweta et al., 2004). There were no reports till date on cloning of fatty acid genes in P. pinnata. As a first step towards understanding the reaction mechanism and the regulation of expression of fatty acid biosynthetic genes in Pongamia, we isolated and characterized a cDNA containing the complete coding region of the fatty acid gene (PpSAD), and analyzed its expression in different tissue types. 2. Materials and methods 2.1. Plant material and growth Seed sampled at different time intervals was collected from Sila forest range, North Guwahati, Assam, India. Collected samples were rinsed twice with 70% ethanol and immediately stored at − 80 °C for further experimental purposes. Seedlings were grown under green house conditions [16 h photoperiod at 28 ± 2 °C with a relative humidity of 75%; light intensity of 125 μmol m−2 S−1 was provided by fluorescent light (Philips India Ltd., Thane, India)] and the different tissues were collected from grown saplings for expression studies. 2.2. Genomic DNA and RNA isolation Genomic DNA was extracted from P. pinnata leaves according to the protocol described by Kesari et al. (2009). Extracted DNA was purified by ethanol precipitation, and the quality & quantity of the DNA were confirmed both spectrophotometrically and by resolving 0.8% agarose gel in 1 × Tris-acetated–EDTA buffer, followed by staining with ethidium bromide (0.5 mg/mL). Total RNA from different tissue types [root, leaf, stem, flower, cotyledon and different developmental stages of seeds (90-, 180-, 270-, 350DAF/Day after flowering)] was isolated by the guanidinium isothiocyanate method (Chomczynski and Sacchi, 1987) and recovered by ethanol and sodium acetate precipitation. The RNA quality and relative quantities were estimated by resolving 1 μg RNA on 1.2% agarose/formaldehyde gels with a final concentration of 0.22 M HCHO, followed by staining with ethidium bromide (0.5 mg/mL). Equal intensity of rRNA bands was taken as the criteria for equal quantity and uniform quality of the samples. 2.3. Complementary DNA cloning Double stranded, blunt-ended cDNA was prepared with a SMART cDNA library construction kit (BD Biosciences Clontech, Palo Alto, CA, USA) using 0.5 μg of poly(A)+ RNA which is separated according to the manufacturer's protocol (Oligotex mRNA mini kit, Qiagen; Cat. No. 70022) from total RNA; isolated from the early immature seeds of P. pinnata. The primers for Pongamia SAD were designed based on sequence information of the SAD cDNA clone (Accession no. NM_

001251324.1 in GenBank) of Glycine max. The forward primer SAD1-F (5′-GAAGCCATTCACTCCTCC-3′) was used together with the downstream primer SAD1-R (5′-TCAACTCGACCACTCAAG-3′) in conjunction with the SMART reverse and forward primers to amplify the SAD cDNA from the ds-cDNA population synthesized from the mRNA of the early immature Pongamia seeds. The cDNA insert (~ 1.6 kb) sub-cloned into a pGEM-T Easy vector (Promega, Madison, WI, USA) was sequenced by the dideoxy chain termination method using an automatic sequencer (ABI 777, Macrogen sequencing service, Korea). The nucleotide sequence presented in the current study has been assigned a GenBank accession number of KF192317. 2.4. Sequence analysis The DNA sequence obtained was compared with sequences deposited in the GenBank database using the Blastn program (Altschul et al., 1997). Sequence data of the corresponding cDNA from different species was analyzed using the ClustalX2.1 package (Thompson et al., 1997). The physicochemical properties of the deduced protein were predicted by Protparam (http://web.expasy.org/protparam/) (Gasteiger et al., 2005). Active sites of the protein sequence were analyzed with the PROSITE database. Protein domains were analyzed by SMART (Schultz et al., 1998). The sub-cellular location of the protein was predicted by the TargetP 1.1 Server (Olof et al., 2000). The secondary and 3D structures of the deduced protein were predicted by PredictProtein (Laszlo et al., 2013) and Swiss-Model respectively. Hydrophobicity analysis was performed on ProtScale (Kyte and Doolittle, 1982), and transmembrane topology prediction was performed using TMHMM Server version 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). The phylogenetic tree was constructed based on the method suggested by Dereeper et al. (2008). 2.5. Real-time RT-PCR For real-time RT-PCR, first-strand cDNA was synthesized from 3 μg of total RNA (from various tissues) using Superscript II, according to the manufacturer's protocol (Invitrogen, USA). The RNA quality and quantity were considered to measure the amounts of cDNA and were diluted 1:10 times (~ 300 ng). The reverse transcribed cDNA samples were used for real time-PCR, which was performed on an ABI StepOne sequence detection system (Applied Biosystems, USA). A PpSAD cDNA fragment (136 bp) was amplified with gene-specific primers SAD2-F and SAD2-R. Initially GAPDH gene expression was normalized with various tissues of Pongamia to confirm the constitutive expression pattern of the gene. P. pinnata GAPDH gene, amplified with the primers GAPDH-F and GAPDH-R, giving a product of 120 bp, was used as a reference for normalizing the PpSAD cDNA amounts (Table 1). Each PCR was performed in a 25 μL reaction mix containing 1 μL of template cDNA (~ 300 ng) or the standard, 1 × SYBR Premix Ex Taq (TaKaRa, Japan) and 0.3 μM of each primer. Thermal cycling conditions were: 95 °C for 10 s; 40 cycles of 95 °C for 5 s, 60 °C for 31 s; then 95 °C for 15 s, 60 °C for 20 s and 95 °C for 15 s for the dissociation stage. After the real-time PCR, the absence of unwanted by-products was confirmed

Table 1 Primer sequences used in the experiment. Details of the primer sequences used for amplifying the full length PpSAD gene from immature seeds and to verify the differential expression level of SAD gene in tissues of P. pinnata. Primer

Sequence (5′–3′)

SAD1-F SAD1-R SAD2-F SAD2-R GAPDH-F GAPDH-R

GAAGCCATTCACTCCTCC TCAACTCGACCACTCAAG TGGACAAGGGCATGGACTGC TGTTCTTTGGCAAGTCTGGC GCAGGAACCCTGAGGAGATC TTCCCCCTCCAGTCCTTGCT

A.M. Ramesh et al. / Gene 542 (2014) 113–121

by automated melting curve analysis (equal to melting temperature of the primer set) and agarose gel electrophoresis of the PCR product. The relative expression ratio of PpSAD gene was calculated based on real-time PCR efficiencies and the crossing point differences of each sample versus a control sample. PpSAD gene cDNA levels were normalized with those of GAPDH as a control in the same samples qualified in the same manner, and the final relative cDNA amounts of PpSAD gene were the means of three replicates. Statistical differences in expression between the mean values of the control and experimental samples were analyzed by one-way analysis of variance (ANOVA) by using SPSS (Statistical Product and Service Solutions) software. The variability of SD (Standard Deviation) is indicated by the error bars in the graphical representation of the data, which could determine whether differences are statistically significant.

115

2.6. Southern hybridization Ten micrograms of total genomic DNA (purified) was digested with EcoRI and HindIII (Fermentas), separated on 0.8% agarose gel. The gel was soaked in 0.5 M NaOH, 1.5 M NaCl for 30 min and blotted onto a Hybond N+ membrane (Amersham Biosciences, Buckinghamshire, U.K.). Probes for DNA blot were generated through PCR amplification of the cDNA inserts using the primers SAD-1F and 1R (Table 1). The probe was gel eluted using Qiagen gel extraction kit (Cat. No. 28704), following the manufacturer's protocol. Eluted probe (PpSAD) was diluted to a concentration of 25 ng in 45 μL of Tris–EDTA buffer (pH 8.0), denatured at 95 °C for 10 min. The denatured probe (~437 bp of PpSAD) was radio labeled with 32P-isotopes by using Amersham Rediprime random primer labeling kit (Cat. No. RPN 1633) and was purified using

Fig. 1. Nucleotide and deduced amino acid sequences of P. pinnata SAD. The start and stop codons were marked by arrows. The stop codon was also denoted by asterisk (*). The two amino acid sequence motifs are boldly underlined.

116

A.M. Ramesh et al. / Gene 542 (2014) 113–121

Fig. 2. Amino acid sequence alignment of PpSAD from Pongamia pinnata with SAD from various species. The alignments were performed using ClustalX (Thompson et al., 1997). Shading was performed by Multiple Sequence Alignment Editor and Shading Utility (Genedoc, version 2.6.002) in conservation mode. Black shading indicates residues that are 100% conserved and are identical in all sequences; gray shading indicates residues that are identical in most of sequences or functionally identical in all of them. The accession numbers and sources of the above proteins: Pongamia pinnata PpSAD (KF192317), Jatropha curcas JcSAD (DQ084491.1), Ricinus communis RcSAD (XM_002531843.1), Sesamum indica SiSAD (D42086.1), Glycine max GmSAD (NM_001251324.1), Phaseolus vulgaris PvSAD (JX853966.1), Cicer arietinum CaSAD (XM_004505093.1), Arachis hypogaea AhSAD (FJ230310.1) and Brassica napus BnSAD (AY642537.1).

Probequant G-50 column (Pharmacia Biotech, India) according to the manufacturer's instructions. The purified probes were probed to the filters and the hybridization was performed in 6× SSPE, 10% Denhardt's solution, 0.5% SDS, and 100 μg/mL denaturated salmon sperm DNA fragments overnight at 65 °C, and the filters were washed three times in 2× SSC, 0.5% SDS for 30 min at the same temperature. The filters were air dried, wrapped in Saran wrap, followed by autoradiography performed using X-ray films (X-OMARRM AR Scientific Imaging Film, Kodak, Rochester, NY, USA) that were exposed after pre-flushing once with γ-ray onto the filters. After keeping 1–2 days at − 80 °C the films were taken out in the dark room and placed in the developer solution for 8 min, further immersed into fixer for 3 min and dried to develop the signals. 3. Results 3.1. Characterization of the P. pinnata SAD cDNA cDNA containing the complete coding region of the SAD gene was cloned from immature seeds of the P. pinnata. The accession number of the PpSAD gene in NCBI GenBank is KF192317. Cloning and sequencing of a cDNA (SAD) revealed that the cDNA is 1509-bp long with a 63 bp of 5′ and 264 bp of 3′ non-coding sequences. Analysis of the sequence showed a possible open reading frame (ORF) with a start codon at position 64 bp and a stop codon at position 1509 bp. This 1182 bp ORF gives a deduced amino acid sequence of 393 residues

(Fig. 1). The A + T content and G + C content in the sequences were 56.40% and 43.60% respectively. The amino acid sequence deduced from the ORF revealed that the cDNA encodes protein 393 amino acids long. Blastn and Blastp analyses, combined with a multiple sequence alignment analysis showed that Pongamia SAD's nucleotide and amino acid sequences are highly homologous to those of SAD from other plants (Fig. 2). The closest nucleotide and amino acid sequences were from G. max (NM_001251324.1) with 98% identity to PpSAD deduced amino acid sequence and also shows high similarity to other dicot SAD sequences e.g. Phaseolus vulgaris (JX853966.1), Arachis hypogaea Table 2 Similarity matrix indicating percentage of PpSAD amino acid and nucleic acid sequences (open reading frame and untranslated sequences) conserved between species: Pongamia pinnata PpSAD (KF192317), Glycine max (NM_001251324.1), Phaseolus vulgaris (JX853966.1), Arachis hypogaea (FJ230310.1), Sesamum indica (D42086.1), Jatropha curcas (DQ084491.1), and Ricinus communis (XM_002531843.1). Sequences were aligned using ClustalX2.1 (Thompson et al., 1997) with default parameters. The untranslated region is composed of 63 nucleotides upstream of the start codon and 264 nucleotides downstream of the stop codon. Species

Protein

Nucleic acid ORF

3′ UTR

GmSAD PvSAD SiSAD AhSAD JcSAD RcSAD

97 95 86 90 85 84

97 93 78 86 81 80

81 80 58 49 46 48

PROCHECK PROCHECK SAVES SAVES QMEAN QMEAN VADAR Ramachandran Plot G-factor VERIFY3D ERRAT Q score Z-score Mean fractional volume

Above 90%—good model Values below −0.5*—unusual Percentage of residues with average 3D–1D score N0.2. Percentage of the protein for which the calculated error value falls below the 95% rejection limit QMEAN score of the whole model reflecting the predicted model reliability ranging from 0 to 1. −(2.00–2.50) Moderate range

Results

94.4% core, 5.2% allow, 0.0% generous, 0.3% disallowed 0.28 91.62 96.726 0.56 −2.43 48,122.6

Parameter

Table 3 Quality scores of modeled PpSAD protein using various structure validation tools.

Significance

Tools

A.M. Ramesh et al. / Gene 542 (2014) 113–121

117

(FJ230310.1), Sesamum indica (D42086.1), Jatropha curcas (DQ084491.1), R. communis (XM_002531843.1), Cicer arietinum (XM_004505093.1) and B. napus (AY642537.1). Despite high degree of homology in the coding region, the nucleotide sequence of PpSAD showed only 81, 80, 58, 49, 46, and 48% similarity at the 3′-UTRs to GmSAD, PvSAD, SiSAD, AhSAD, JcSAD and RcSAD respectively (Table 2). Active site analysis of PpSAD's 393 amino acids with the PROSITE database showed that this sequence contains a fatty acid desaturase family-2 signature (PS00574, SAvaqRIgvytakDYadILE) situated at amino acids 313 to 332 (Supplementary Fig. 1a). Protein domain (function) analysis of PpSAD by SMART (Simple Modular Architecture Research Tool) showed a domain of Acyl-ACP-Desaturase (65–371 amino acids); and fatty acid desaturase domain sequence starting at position 63 and ending at position 391 (Supplementary Fig. 1b). Hydrophobicity plot analysis of deduced amino acid sequences of PpSAD and other SADs showed that these enzymes are likely to be water-soluble proteins (Supplementary Fig. 2). Sub-cellular localization of the deduced PpSAD amino acid sequence using the PSORT tool revealed that it was localized in chloroplast (predicted scores from the 3–11, 1–31 amino acid regions are 0.09 & 8.92 respectively). Physicochemical property predictions of the deduced amino acid sequence indicated that the chemical formula of PpSAD is C2006 H3139 N549 O 597 S17, its molecular weight is 45.04 kDa, and its theoretical PI is 5.88. PpSAD's half-life at in vitro conditions is predicted to be approximately 30 h and its instability index (II) was computed to be 42.74 which are above 40, thus classifying Pongamia SAD as an unstable protein. Amino acid composition analysis of this protein showed that Leu (8.9%), Glu (8.4%), Ala (6.9%) Asp (6.1%), Arg (6.9%), Thr (6.6%), Lys (5.9%) and Ser (6.4%) are the most abundant residues. PpSAD contains 57 negatively charged residues (Asp + Glu) and 50 positively charged residues (Arg + Lys). Its grand average of hydropathicity (GRAVY) was estimated to be − 0.499, suggesting that this protein is hydrophilic. Secondary structure prediction by PredictProtein indicated that this protein is composed of 65.2% α-helix, 4.3% extended strand and 28.7% random coil. The programs SwissModel and Swiss-Pdb Viewer (Guex and Peitsch, 1997) were used to analyze PpSAD space configuration. The analysis result was shown in Supplementary Fig. 3A and the deduced three-dimensional model of PpSAD is very similar to crystal structure of RcSAD (Supplementary Fig. 3B). The three amino acids (Asp, Trp & His) which are highlighted in the molecules show iron binding sites of the PpSAD protein molecule. The quality scores obtained with different online tools for the modeled PpSAD protein suggest that the model is structurally good and all parameters are within the given range (Table 3). The tertiary structure algorithm predicted that PpSAD is a compact globular protein. A phylogenetic tree based on deduced amino acid sequences of PpSAD and other SADs from different flora was constructed to investigate the evolutionary relationships among various SADs. We selected a total of 23 stearoyl-ACP-desaturase amino acid sequences from the NCBI GenBank database and included PpSAD for a phylogenetic analysis. The results revealed that the phylogenetic tree grouped the SAD into three different clades (Clades-I, II & III) in which Clade-II was again divided into two clusters. Clade-I consists of Triticum aestivum (ADV59912), Oryza sativa (BAA07631), Zea mays (ABA40393), Ginkgo biloba (AEJ87846) & Elaeis guineensis (AAB41041). Cluster-I of Clade-II has oil species like B. napus (AY642537.1), Descurainia sophia (EF524186), Arabidopsis thaliana (NM_129933) & Camelina sativa (JN831159). Cluster-II of Clade-II shows complete plant species that belongs to Fabaceae/leguminous; in which P. pinnata (KF192317) is having close proximity with G. max (NM_001251324.1), Phaseolus lunatus (HQ171178) and Lotus corniculatus (DQ020280). Similarly A. hypogaea (FJ230310.1), Cicer areintinum (XM_004505093.1) and Medicago truncatula (XM_003612308) are grouping a bit far from the Pongamia. Clade-III consists of Sesamum indicum (D42086.1), Gossypium hirsutum (CAB75356), Vernicia fordii (GU363502), Triadica sebifera (ABN13874), Manihot esculenta (JX513389), J. curcas (DQ084491.1) and R. communis

118

A.M. Ramesh et al. / Gene 542 (2014) 113–121

Fig. 3. Dendrogram depicts the phylogenetic relationships of PpSAD with other leguminous/oil yielding SAD proteins. Phylogenetic tree was constructed based on the method suggested by Dereeper et al. (2008) with default parameters.

(XM_002531843.1) which do not belong to the legume family but are potential biofuel plants (Fig. 3). 3.2. RNA expression studies Real-time PCR was employed to confirm the expression patterns of SAD gene in different tissue types (roots, leaves, stem, flower, and cotyledon) and in different development stage seeds. This analysis revealed that the SAD gene displays tissue-specific expression patterns in P. pinnata. The expression level in seeds and in leaf was significantly higher than in other tissues. In addition, comparative analysis among seeds in different development stages showed that the expression levels of the SAD gene differed markedly among different stage seeds. The expression levels in seeds increased along with seed development; it was lowest in 90 DAF and was highest in 350 DAF. Thus, quantitative analysis showed that the expression levels of the PpSAD gene differed markedly among tissues but shows constitutive expression levels. This comparison of PpSAD gene expression strategy in the different tissue levels revealed that the pattern of PpSAD gene expression is consistent in all tissues and the same is increased with seed developmental stages. The results show that the relative expression ratios of the PpSAD gene were significantly different in different tissue types, which is less than 5% (p b 0.05) (Fig. 4A–B). 3.3. Southern blotting analysis of the gene PpSAD We performed a Southern blot analysis to identify the genomic organization of the PpSAD gene. P. pinnata genomic DNA was digested with restriction enzymes EcoRI and HindIII; neither enzyme has a cutting position inside the PpSAD gene. Two hybridizing bands were observed in each lane which suggested that other closely related isoenzyme genes

encoding SAD families may occur in the whole genome. However hybridization at high stringency revealed several hybridizing bands, demonstrating that potential numbers of genes are present. The results indicated that there were at least two copies (multiple copies) of the gene, which correspond to the SAD desaturase family (Fig. 5). 4. Discussion Fatty acids are synthesized by the sequential addition of C2 units, resulting in C16 to C18 fatty acids. The first fatty acid desaturation step is catalyzed by a plastidial stearoyl-ACP desaturase (Iba et al., 1993; Thelen and Ohlrogge, 2002). Fatty acid desaturases are usually membrane bound and utilize complex lipid substrates such as phosphatidylcholine or monogalactosyldi-acylglycerol (Harwod, 1996). An exception is the stearoyl-ACP desaturase that is soluble and localized in the chloroplast stroma and catalyzes the insertion of a cis double bond between carbons 9 and 10 of C18:0-ACP to form C18:1-ACP (Sobrado et al., 2006; Thelen and Ohlrogge, 2002; Voelker and Kinney, 2001). Many genes encoding for SAD have been cloned from different plants and the structure and function of several SAD proteins have been studied (Chi et al., 2011; Craig et al., 2008; Guo et al., 2011; Liu et al., 2009; Luo et al., 2009; Shanklin and Somerville, 1991; Shilman et al., 2011). While considerable information regarding the SAD protein and the SAD gene from other plants exists, until now relatively little was known about Pongamia SAD gene. In this study, we have isolated and characterized a full-length PpSAD cDNA from P. pinnata a key SAD gene involved in desaturation of saturated fatty acids. Multiple sequence alignment analyses were conducted to assess the homology of Pongamia SAD's nucleotide and amino acid sequences to desaturases from other organisms. Additionally computational methods were used to deduce the protein's active sites, physicochemical properties,

A.M. Ramesh et al. / Gene 542 (2014) 113–121

119

Fig. 5. Southern blotting analysis of gene PpSAD from P. pinnata. Ten micrograms of genomic DNA was digested with (1) EcoRI and (2) HindIII, separated in a 0.8% agarose gel and transferred to a membrane. The 32P-labeled 437-bp PCR fragment generated from the PpSAD coding sequence was used as the probe.

Fig. 4. Quantitative analysis of PpSAD expression in Pongamia pinnata. (A) Expression of PpSAD in different tissues analyzed by real-time PCR. Relative expression ratio of each sample is compared with the seed sample. (B) Temporal expression of PpSAD. Real time PCR was performed with cDNA isolated from seeds of early immature (90-DAF), early mature (180-DAF), late immature (270-DAF) and late mature (350-DAF). Relative expression ratio of each sample is compared with the sample at 350-DAF. GAPDH from Pongamia was used as internal control. The final relative cDNA amounts of PpSAD are means of three replicates. The relative expression ratios of PpSAD gene were significantly different at a p b 0.05.

structure and sub-cellular location. Computational analysis combined with studies of SAD from other prospective biofuel plants should contribute to our understanding of Pongamia SAD. PpSAD shares about 98% identity with other reported SAD proteins [G. max (NM_ 001251324.1)]. We strongly believe that the SAD gene that has been cloned is a full length cDNA, and homology sequence analysis was performed with other known similar sequences. The completed nucleotide sequence indicates that PpSAD cDNA encoded a polypeptide 393 amino acids with molecular weight of 45.04 kDa. The alignment of deduced amino acid sequence of Pongamia stearoyl-ACP-desaturase to deduced amino acid sequences of other SAD also indicates the presence of two sequence motifs, E-E-N-R-H and D-E-K-R-H which are normally found in stearoyl-ACP desaturases and other oxygen activating enzymes (Fox et al., 1993; Murphy, 1994). These amino acid sequences represent a biological motif used for the creation of reactive catalytic intermediates. Thus, the process of fatty acid desaturation may proceed via enzymatic generation of a high-valent iron-oxo species derived from the diiron cluster (Fox et al., 1993). In addition, PpSAD shows high identity to a conserved domain of ferritin-like structures, which suggests that PpSAD is a ferritin with a Fe–O–Fe center (Fox et al., 1994). According to Lindqvist et al. (1996) the six amino acids of E138, E176, H179, E229, E262 and H265 in SAD peptide are the ligands of ferritin's diiron. They are all located in the conserved domain of SAD. Sequence alignment of PpSAD with SAD from other plants revealed that PpSAD

contains two conserved domains which play crucial role in introducing the double bonds. These conserved regions suggest PpSAD likely to have the same function as other reported SAD proteins (Tong et al., 2007). Moreover the high identity of PpSAD to other plant SADs indicates that SADs have been highly conserved during evolution and further demonstrates their critical enzymatic roles in fatty acid synthesis in plants. Two kinds of protein conserved domains are found in the deduced amino acid sequence of PpSAD and the roles are as follows: Domain-1 is Acyl ACP desaturase, ferritin-like diiron-binding domain; is a muoxo-bridged diiron-carboxylate enzyme, which belongs to a broad superfamily of ferritin-like proteins and catalyzes the NADPH and O2dependent formation of a cis-double bond in acyl-ACPs (McKeon and Stumpf, 1982; Nagai and Bloch, 1966, 1968). Acyl-ACP desaturases are found in higher plants and a few bacterial species (Mycobacterium tuberculosis, Mycobacterium leprae, Mycobacterium avium, Streptomyces avermitilis, and Streptomyces coelicolor). In plants, soluble, plastid localized stearoyl-ACP desaturases carryout the ubiquitous desaturation process that introduces the first double bond into saturated fatty acids, resulting in the corresponding monounsaturated fatty acid. Members of this class of soluble desaturases are specific for a particular substrate chain length and introduce the double bond between specific carbon atoms (Holloway, 1983; Maruta and Wada, 1995; Maruta et al., 1992). Domain-2 is fatty acid desaturase involved at the end of the desaturation process, and converts saturated fatty acid to unsaturated fatty acids. According to Aadi et al. (2013) the total nuclear genome content of Pongamia is 2.66 pg. To know the gene copy number of the PpSAD gene within the Pongamia genome, a Southern hybridization was performed. The hybridization with the partial PpSAD cDNA displayed that 2–4 band signals were detected in the agarose gel containing the Pongamia genomic DNA digested with both EcoRI and HindIII separately. As the ORF region of the full length gene sequence does not show the restriction site for both enzymes (EcoRI & HindIII); so the multiple bands obtained after digestion could be due to the presence of restriction sites within an intron of the Pongamia genome. This banding pattern of the digested genomic DNA implied that at least 2 copies of the PpSAD gene might be present on the Pongamia genome as observed on other plant genome (Luo et al., 2006; Shah et al., 2000). According to Kosmas et al. (1998) four major hybridizing bands along with additional lesser extent bands to sad gene were detected in olive fruit

120

A.M. Ramesh et al. / Gene 542 (2014) 113–121

genome. It has been suggested that other closely related isoenzyme genes encoding SAD families may occur in the whole genome. The expression pattern of the PpSAD gene in different tissues may provide vital information regarding the key role in fatty acid biosynthesis. To determine the steady-state level PpSAD gene expression in different tissues of Pongamia, RT-PCR analysis was carried out using RNA samples extracted from various tissues including root, leaf, stem, flower, cotyledon, and four different stages of seeds (Supplementary Fig. 4). The analysis indicated that PpSAD was expressed in every tissue examined. Stronger expression of PpSAD was only detected in leaves and seed cotyledon and its expression levels were increased as seed developmental stages progressed. The higher level in seeds indicates that the SAD gene may be involved with growth and development, while the expression in leaves may be related to SAD's chloroplast location. Low level of expression was detected in root, stem and flower. Similar to Jatropha SAD, Elaies SAD, PpSAD is constitutively expressed in every tissue examined, including non-photosynthetic tissues, such as seed and root, suggesting that it may be active in all cells and tissues to produce polyunsaturated fatty acids for normal membrane functions (Okuley et al., 1994, Wallis and Browse, 2002), besides its presumed role in synthesizing PUFA in seed oil. It was reported that rape SAD is mainly expressed in developing seeds, but its expression level in flowers is also relatively high (Slocombe et al., 1994). These results serve as a foundation for further studies of the mechanisms regulating SAD gene expression and may eventually lead to the development of higher quality Pongamia genotypes. The well-studied pathway of fatty acid biosynthesis and characterization of genes involved in the fatty acid biosynthesis have greatly facilitated the genetic modification of higher plants for oil and fatty acid production, e.g. to increase the total oil content (Lardizabal et al., 2008), to alter the composition of fatty acids (Graef et al., 2009), or to produce new fatty acids for nutritional improvement (Cheng et al., 2010). However, it is clear that better understanding of regulatory processes of fatty acid biosynthesis and lipid metabolism and availability of more sophisticated genetic manipulation tools might be necessary for the successful engineering of potential biofuel crops for enhanced oil production. Current study is the first report on molecular cloning and characterization of full-length cDNA of P. pinnata stearoyl-acyl carrier protein desaturase. The deduced amino acid sequence showed a 98% homology to the G. max SAD and more than 84% to corresponding proteins from other species, including J. curcas and R. communis. These results serve as a foundation for further studies of mechanisms regulating SAD gene expression and may eventually lead to the development of higher quality Pongamia genotypes. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2014.03.047. Conflict of interest None of the authors have any conflict of interest to declare. Acknowledgments AMR wishes to thank Department of Science and Technology (DST) and Ministry of Human Resources Development (MHRD), Government of India for student fellowship. Thanks to the Forest Department officials of Sila Forest, North Guwahati for kind supply of study material. LR acknowledges DST, Government of India for funding the research (SR/ SO/PS-59/08). References Aadi, M.R., et al., 2013. Development of flow cytometric protocol for nuclear DNA content estimation and determination of chromosome number in Pongamia pinnata L., a valuable biodiesel plant. Applied Biochemistry and Biotechnology. http://dx.doi.org/10. 1007/s12010-013-0553-z.

Altschul, S.F., et al., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389–3402. Bloomfield, D.K., Bloch, K., 1960. Formation of Δ9-unsaturated fatty acids. Journal of Biological Chemistry 235, 337–345. Bobade, S.N., Khyade, V.B., 2012. Detail study on the properties of Pongamia pinnata (Karanja) for the production of biofuel. Research Journal of Chemical Sciences 2 (7), 16–20. Cheng, B., Wu, G., et al., 2010. Towards the production of high levels of eicosapentaenoic acid in transgenic plants: the effects of different host species, genes and promoters. Transgenic Research 19, 221–229. Chi, X.Y., et al., 2011. Genome-wide analysis of fatty acid desaturases in soybean (Glycine max). Plant Molecular Biology Reporter 29, 769–783. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid quanidinium thiocyanate–phenol–chloroform extraction. Annual Review of Biochemistry 162, 156–159. Craig, W., et al., 2008. Transplastomic tobacco plants expressing a fatty acid desaturase gene exhibit altered fatty acid profiles and improved cold tolerance. Transgenic Research 17, 769–782. Davydov, R., et al., 2005. Effect of substrate on the diiron (III) site in stearoyl acyl carrier protein delta 9-desaturase as disclosed by cryoreduction electron paramagnetic resonance/electron nuclear double resonance spectroscopy. Journal of Biochemistry 44, 1309–1315. Dereeper, A., et al., 2008. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Research 36, 465–469. Edgar, B., et al., 1994. cDNAs for isoforms of the Δ9-stearoyl-acyl carrier protein desaturase from Thinbergia alata endosperm. Plant Physiology 106, 807–808. Fox, B.G., et al., 1993. Stearoyl-acyl carrier protein Δ9 desaturase from Ricinus communis is a diiron-oxo protein. Proceedings of the National Academy of Sciences of the United States of America 90, 2468–2490. Fox, B.G., et al., 1994. Resonance raman evidence for a Fe–O–Fe center in stearoyl-ACP desaturase primary sequence identity with other diiron-oxo proteins. Journal of Biochemistry 33, 12776–12786. Fulco, A.J., 1974. Metabolic alterations of fatty acids. Annual Review of Biochemistry 43, 215–240. Gasteiger, E., et al., 2005. Protein identification and analysis tools on the ExPASy Server. In: John, M.W. (Ed.), The Proteomics Protocols Handbook. Humana Press, pp. 571–607. Graef, G., et al., 2009. A high-oleic-acid and low-palmitic-acid soybean: agronomic performance and evaluation as a feedstock for biodiesel. Plant Biotechnology Journal 7, 411–421. Guex, N., Peitsch, M.C., 1997. Swiss-Model and the Swiss-Pdb Viewer: an environment for comparative protein modeling. Electrophoresis 18, 2714–2723. Guo, Z.F., et al., 2011. Molecular cloning of two novel stearoyl-acyl desaturase genes from winterness wheat. Genes & Genomics 33, 583–589. Harwod, J.L., 1996. Recent advances in the biosynthesis of plant fatty acids. Biochimica et Biophysica Acta 1301, 7–56. Holloway, P.W., 1983. Fatty acid desaturation. In: Boyer, P.D. (Ed.), The Enzymes, vol. XVI. Academic Press, Orlando, FL, pp. 63–83. Iba, K., et al., 1993. A gene encoding a chloroplast-3 fatty acid desaturase complements alterations in fatty acid desaturation and chloroplast copy number of the FAD7 mutant of Arabidopsis thaliana. Journal of Biological Chemistry 268, 24099–24105. Kachroo, A., et al., 2003. Plastidial fatty acid signaling modulates salicylic acid- and jasmonic acid-mediated defense pathways in the Arabidopsis ssi2 mutant. The Plant Cell 15, 2952–2965. Kesari, V., et al., 2008. Systematic characterization and seed oil analysis in candidate plus trees of biodiesel plant, Pongamia pinnata (L.). Annals of Applied Biology 152, 397–404. Kesari, V., et al., 2009. PCR amplification of the genomic DNA from the seeds of Ceylon Ironwood, Jatropha and Pongamia. Biomass and Bioenergy 33, 1724–1728. Kesari, V., et al., 2012. High frequency direct organogenesis and evaluation of genetic stability for in vitro regenerated Pongamia pinnata, a valuable biodiesel plant. Biomass and Bioenergy 44, 23–32. Knutzon, D.S., et al., 1992. Modification of Brassica seed oil by antisense expression of a stearoyl-acyl carrier protein desaturase gene. Proceedings of the National Academy of Sciences of the United States of America 89, 2624–2628. Kodama, H., et al., 1995. Fatty acid desaturation during chilling acclimation is one of the factors involved in conferring low temperature tolerance to young tobacco leaves. Plant Physiology 107, 1177–1185. Kosmas, H., et al., 1998. Temporal and transient expression of stearoyl-ACP carrier protein desaturase gene during olive fruit development. Journal of Experimental Botany 49, 1661–1669. Kyte, J., Doolittle, R.F., 1982. A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology 157 (1), 105–132. Lardizabal, K., et al., 2008. Expression of Umbelopsis ramanniana DGAT2A in seed increases oil in soybean. Plant Physiology 148, 89–96. Laszlo, K., et al., 2013. Cloud prediction of protein structure and function with PredictProtein for Debian. BioMed Research International. http://dx.doi.org/10. 1155/2013/398969. Lea, M., 2003. Stress on avocado fruits regulates 9-stearoyl ACP desaturase expression, fatty acid composition, antifungal diene level and resistance to Colletotrichum gloeosporioides attack. Physiological and Molecular Plant Pathology 62, 277–283. Lindqvist, Y., et al., 1996. Crystal structure of Δ9 stearoyl-acyl carrier protein desaturase from castor seed and its relationship to other di-iron proteins. The EMBO Journal 15, 4081–4092. Liu, Z.J., et al., 2009. SAD, a stearoyl-acyl carrier protein desaturase highly expressed in high-oil maize inbred lines. Russian Journal of Plant Physiology 56, 709–715.

A.M. Ramesh et al. / Gene 542 (2014) 113–121 Los, D.A., Murata, N., 1998. Structure and expression of fatty acid desaturases. Biochimica et Biophysica Acta 1394, 3–15. Luo, T., et al., 2006. Characterization of a new stearoyl-acyl carrier protein desaturase gene from Jatropha curcas. Biotechnology Letters 28, 657–662. Luo, T., et al., 2009. Cloning and characterization of stearoyl-acyl carrier protein desaturase gene from Cinnamomum longepaniculatum. Plant Molecular Biology Reporter 29, 13–19. Macartney, A., et al., 1994. Acyl-CoA desaturases and the adaptive regulation of membrane lipid composition. In: Cossins, A.R. (Ed.), Temperature Adaptation of Biological Membranes. Portland Press, London, pp. 129–139. Maruta, N., Wada, H., 1995. Acyl-lipid desaturases and their importance in the tolerance and acclimatization to cold of cyanobacteria. Biochemical Journal 308, 1–8. Maruta, N., et al., 1992. Modes of fatty-acid desaturation in cyanobacteria. Plant and Cell Physiology 33, 933–941. McKeon, T.A., Stumpf, P.K., 1982. Purification and characterization of the stearoyl-acyl carrier protein desaturase and the acyl-acyl carrier protein thioesterase from maturing seeds of safflower. Journal of Biological Chemistry 257, 12141–12147. Murata, N., Wada, H., 1995. Acyl-lipid desaturases and their importance in the tolerance and acclimatization to cold of cyanobacteria. Biochemical Journal 308, 1–8. Murphy, D.J., 1994. Biogenesis, function and biotechnology of plant storage lipids. Progress in Lipid Research 33, 71–85. Nagai, J., Bloch, K., 1966. Enzymatic desaturation of stearyl acyl carrier protein. Journal of Biological Chemistry 241, 1925–1927. Nagai, J., Bloch, K., 1968. Enzymatic desaturation of stearyl acyl carrier protein. Journal of Biological Chemistry 243, 4626–4633. Nigel, C.V., Renee, J.G., 2008. Flavonoids and their glycosides, including anthocyanins. Natural Product Reports 25, 555–611. Okuley, J., et al., 1994. Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. Plant Cell 6 (1), 147–158. Olof, E., et al., 2000. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. Journal of Molecular Biology 300, 1005–1016. Schultz, J., et al., 1998. SMART, a simple modular architecture research tool: identification of signaling domains. PNAS 95, 5857–5864. Scott, P.T., et al., 2008. Pongamia pinnata: an untapped resource for the biofuels industry of the future. Bioenergy Research 1, 2–11.

121

Shah, F.H., et al., 2000. Temporal regulation of two isoforms of cDNA clones encoding delta 9-stearoyl-ACP desaturase from oil palm (Elaies guineensis). Plant Science 152, 27–33. Shanklin, J., Somerville, C., 1991. Stearoyl-acyl carrier-protein desaturase from higher plants is structurally unrelated to the animal and fungal homologs. Proceedings of the National Academy of Sciences of the United States of America 88, 2510–2514. Shilman, F., et al., 2011. Identification and molecular characterization of homologous Δ9stearoyl acyl carrier protein desaturase 3 genes from the allotetraploid peanut (Arachis hypogaea). Plant Molecular Biology Reporter 29, 232–241. Shweta, S., et al., 2004. Extraction of oil from Jatropha curcas L. seed kernels by enzyme assisted three phase partitioning. Industrial Crops and Products 20, 275–279. Slocombe, S.P., et al., 1994. Temporal and tissue-specific regulation of a Brassica napus stearoyl-acyl carrier protein desaturase gene. Plant Physiology 104, 167–1176. Sobrado, P., et al., 2006. Identification of the binding region of the [2Fe–2S] ferredoxin in stearoyl-acyl carrier protein desaturase: insight into the catalytic complex and mechanism of action. Biochemistry 45, 4848–4858. Tasseva, G., et al., 2004. Changes in the endoplasmic reticulum lipid properties in response to low temperature in Brassica napus. Plant Physiology and Biochemistry 42, 811–822. Thelen, J.J., Ohlrogge, J.B., 2002. Metabolic engineering of fatty acid biosynthesis in plants. Metabolic Engineering 4, 12–21. Thompson, J.D., et al., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882. Tong, L., et al., 2007. Cloning and characterization of a stearoyl-ACP desaturase gene from Jatropha curcas. Journal of Shanghai University 11 (2), 182–188. Voelker, T., Kinney, A.J., 2001. Variation in the biosynthesis of seed-storage lipids. Annual Review of Plant Physiology and Plant Molecular Biology 52, 335–361. Wallis, J.G., Browse, J., 2002. Mutants of Arabidopsis reveal many roles for membrane lipids. Progress in Lipid Research 41 (3), 254–278. Zaborowska, Z., et al., 2002. Yellow lupine gene encoding stearoyl-ACP desaturase— organization, expression and potential application. Acta Biochimica Polonica 49, 29–42.