Characterization of Clostridium perfringens isolates from healthy turkeys and from turkeys with necrotic enteritis

IMMUNOLOGY, HEALTH, AND DISEASE Characterization of Clostridium perfringens isolates from healthy turkeys and from turkeys with necrotic enteritis U. Lyhs,*1 P. Perko-Mäkelä,† H. Kallio,† A. Brockmann,* S. Heinikainen,‡ H. Tuuri,§ and K. Pedersen# *Ruralia Institute, Seinäjoki Unit, University of Helsinki, Kampusranta 9C, FI-60320 Seinäjoki, Finland; †Finnish Food Safety Authority Evira, Research and Laboratory Department, Production Animal and Wildlife Research Unit, PO Box 198, FI-60101 Seinäjoki, Finland; ‡Finnish Food Safety Authority Evira, Research Department and Laboratory, Veterinary Bacteriology, PO Box 92, FI-70701 Kuopio, Finland; §Seinäjoki University of Applied Sciences, Business School, Koulukatu 41, FI-60100 Seinäjoki, Finland; and #DTU National Food Institute, Mørkhøj Bygade 19, DK-2860 Søborg, Denmark ABSTRACT Clostridium perfringens is an important bacterial pathogen, especially in poultry, where it can lead to both subclinical and clinical disease. The aim of this study was to present data on pathological findings at outbreaks of necrotic enteritis (NE) in turkey production in Finland during the period from 1998 to 2012. Furthermore, C. perfringens isolates from healthy and diseased turkeys were characterized and their genetic diversity was investigated using pulsed-field gel electrophoresis (PFGE). Isolates (n = 212) from birds with necrotic gut lesions and from healthy flocks of 30 commercial turkey farms were characterized for the presence of cpa, cpb, iA, etx, cpb2, and cpe and netB genes. A total of 93 C. perfringens isolates, including 55 from birds with necrotic gut lesions and 38 from healthy birds from 13 different farms, were analyzed with PFGE. All contract turkey farmers (n = 48) of a turkey company that produces 99% of domestic turkey

meat in Finland were interviewed about background information, management at the farm, and stress factors related to NE outbreaks. Pulsed-field gel electrophoresis analysis with SmaI restriction enzyme resulted in 30 PFGE patterns among the 92 C. perfringens isolates of high diversity. Out of all isolates, 212 (100%) were α-toxin-positive and one isolate (0.5%) was both α- and β2 toxin-positive. Fourteen isolates (6.6%) were necrotic enteritis toxin B (NetB) positive; all were recovered from turkeys with NE. In none of the isolates obtained from healthy turkeys was the netB toxin identified. In conclusion, a high diversity of C. perfringens isolates from turkeys with different health status was shown. All isolates produced α toxin, whereas only low percentages of isolates carried the netB toxin gene. The role of the netB toxin in NE in turkeys needs to be further investigated.

Key words: Clostridium perfringens, turkey, necrotic enteritis 2013 Poultry Science 92:1750–1757 http://dx.doi.org/10.3382/ps.2012-02903

INTRODUCTION In broiler chickens, Clostridium perfringens has been known for decades as a pathogen responsible for necrotic enteritis, hepatitis, and cholecystitis (Parish, 1961). Necrotic enteritis (NE) exists in a clinical form with severe outbreaks and mortality and a subclinical form, which is mainly characterized by a reduced growth rate, impaired feed conversion ratio, and an increased condemnation rate. Clostridium perfringens is a member of the normal intestinal microflora in poultry, and conse©2013 Poultry Science Association Inc. Received November 12, 2012. Accepted March 9, 2013. 1 Corresponding author: [email protected]

quently, the mere presence of this bacterium in the intestine—even in high numbers—is not sufficient to provoke disease. The development of NE also depends on bacterial virulence factors, host-related factors, such as stress, and environmental, predisposing factors. Several such predisposing factors have been identified, among them high wheat, barley, or fish meal contents in the feed, and an underlying coccidiosis problem (Løvland and Kaldhusdal, 2001; Pedersen et al., 2003; Van Immerseel et al., 2004, 2009; Williams, 2005; Cooper and Songer, 2009). Necrotic enteritis is caused predominantly by C. perfringens type A, and to a lesser extent by type C (Songer, 1996; Nauerby et al., 2003; Cooper and Songer, 2009). Alpha-toxin has long been believed to be the critical virulence factor in NE (Al-Sheikhly and

1750

CHARACTERIZATION OF CLOSTRIDIUM PERFRINGENS

Truscott, 1977), but Keyburn et al. (2006) and Cooper et al. (2010) showed that α-toxin may not be an essential causative factor of NE. More recently, a novel toxin, NE toxin B (NetB), has been discovered and strongly associated with the pathogenesis of NE. The netB gene is located on a plasmid and encodes a poreforming toxin, which perforates the plasma membrane and thereby damages host cells (Keyburn et al., 2008, 2010). Some authors consider netB the most important bacterial virulence factor for development of NE, although both netB-positive and -negative strains have been found associated with NE (Timbermont et al., 2011). Genotyping studies on the basis of pulsed-field gel electrophoresis (PFGE) of isolates from Danish and Swedish farms from healthy and diseased flocks showed that healthy chickens carried several different C. perfringens clones within a flock and individual birds, whereas flocks suffering from NE only carried 1 or 2 clones (Engström et al., 2003; Nauerby et al., 2003). Necrotic enteritis in turkeys is much less described and seems to occur only in some countries. In Finland, NE is an important sporadic disease in turkey production, and recently the only reason for antimicrobial treatment in turkey farms. In this paper, we present data on pathological findings of outbreaks of NE in turkey production in Finland, along with characteristics of the isolates of C. perfringens, including their ability to produce alpha- and netB toxins. Furthermore, the genetic diversity of C. perfringens isolates from Finnish turkeys was investigated using PFGE.

MATERIALS AND METHODS Sampling, Bacterial Strains, and Culture Conditions In Finland, 48 contract farmers of a turkey company produce 99% of domestic turkey meat. The basic research material for the present study was obtained from 30 of these farms located in the area of Southwest Finland and South Ostrobothnia. Turkeys affected by a clinical NE outbreak were submitted for necropsy to the local Finnish Food Safety Authority Evira during the period from 1998 to 2012 and examined in the laboratory. Most of the examined birds with NE died before necropsy. In some cases birds which were sick or apparently healthy were killed immediately before postmortem examination. The designation “bird with NE” has been used for a bird dying due to NE before being sampled and also included sick birds which were killed before postmortem examination and sampling. Pathological/morphological and histopathological changes in the duodenum, jejunum, ileum, cecum, and liver were recorded and used as reference material for the present study and for isolation of C. perfringens. Altogether, 212 C. perfringens isolates from the intestines and the livers of turkeys were included in this study: 174 isolates were from birds with necrotic gut

1751

lesions and, as controls, 38 isolates from healthy flocks. All 30 farms were represented among all isolates with 8 farms providing healthy birds and 22 farms providing diseased birds. Of all farms, from 4 farms both healthy and NE flocks were received. However, only one farm provided both healthy and NE flocks during the same year. The isolates were obtained by plating intestinal material with a 1-µL eyeloop onto blood agar plates containing 5% defibrinated sheep blood and incubated anaerobically (AnaerobicCult A, Merck, Darmstadt, Germany) at 37°C for 24 to 48 h. Presumptive C. perfringens colonies were identified by characteristic colony morphology, double hemolysis, Gram staining, and catalase test. Strains were stored at −80°C in Brucella broth (Scharlau Chemie, Barcelona, Spain) containing 15% glycerol until further use.

Pathology At necropsy, inspection of the serosal and mucosal surfaces of the duodenum, jejunum, ileum, and cecum was performed. After removal of the gut contents, the presence of necrotic lesions in the duodenum, jejunum, ileum, and cecum was confirmed and scored upon postmortem examination following routine procedures. Samples from the intestines (3- to 5-cm pieces) and from the livers for bacteriological routine investigations of healthy and diseased turkeys and isolation of C. perfringens strains to be collected in the present study were taken from the duodenal loop, the jejunum at the Meckel’s diverticulum, the ileum, and the cecum (not from healthy birds). For sampling, the intestines were opened and the mucosa (with or without NE lesions) was scraped. From the livers, internal parenchyma was aseptically taken. Samples of the liver, the duodenum, the jejunum, the ileum, and the cecum were fixed in phosphate-buffered formalin for at least 24 h processed routinely and were embedded in paraffin. Sections of 4 µm were cut and stained with hematoxylin and eosin.

DNA Extraction of C. perfringens Isolates for PCR Toxin Typing A total of 212 isolates were prepared for toxin typing. Extraction of DNA from all C. perfringens isolates was performed using a boiling technique. Briefly, a few colonies of bacteria grown on a blood agar plate were suspended in 2 mL of sterile water to a suspension of McFarland No. 0.8–1.2. After measurement, 500 µL of the suspension were transferred into an Eppendorf tube and boiled for 10 min at 100°C. The DNA preparations were stored at −20°C until use.

PCR Toxin Typing Multiplex PCR for Major Toxin Typing. The isolates were characterized for the presence of cpa, cpb, iA, etx, cpb2, and cpe genes, which encode respectively

1752

Lyhs et al.

for α toxin (α), β toxin (β), iota toxin (ι), epsilon toxin (ε), beta2 toxin (β2), and enterotoxin using the multiplex PCR method by Baums et al. (2004). The PCR amplification was performed in 25-µL volumes containing 5 × Phire Reaction Buffer (Finnzymes, Vantaa, Finland), 10 mM dNTP mixture (Finnzymes), 1 U of Phire Hot Start DNA polymerase (Finnzymes), 10 pM of each primer (Table 1), 11.75 µL of distilled water, and 5 µL of template. The primers were synthesized by Oligomer Oy (Helsinki, Finland). The PCR primers and fragment lengths are listed in Table 1. The PCR was performed in a MiniOpticon System cycler (Bio-Rad Laboratories, Hercules, CA), and the conditions were one cycle of 95°C for 2 min 30 s, followed by 35 cycles at 95°C for 1 min; 55°C for 1 min, 72°C for 1 min 20 s, with the final step at 72°C for 2 min. The PCR product was loaded onto a 2% agarose gel (1.35% SeaKem LE Agarose and 0.65% NuSieve GTG Agarose, Cambrex Bio Science, Rockland, ME) containing 0.1 g∙mL−1 of ethidium bromide. A DNA molecular weight marker 100-bp low ladder (Sigma-Aldrich, St. Louis, MO) was included in each gel. The gel was photographed under UV light (Alpha DigiDoc, Alpha Innotech, San Leandro, CA). The PCR reaction for each sample was performed 3 times, and considered positive if the primer set gave a distinct band of the right size (Table 1). Single PCR for NetB Toxin Typing. The NetB was detected by the PCR method described by Keyburn et al. (2008), with a few modifications. The PCR amplification was performed in 28-µL volumes containing 5 × Phire Reaction Buffer (Finnzymes), 10 mM dNTP mixture (Finnzymes), 1 U of Phire Hot Start DNA polymerase (Finnzymes), 10 pM of primer (Table 1), 14.5 µL of distilled water, and 5 µL of template. The primers were synthesized by Oligomer Oy. The PCR was performed in a MiniOpticon System cycler, and the conditions were one cycle of 94°C for 1 min followed by 35 cycles at 94°C for 15 s; 55°C for 15 s, 72°C for 30 s, with the final step at 72°C for 12 min. The PCR prod-

ucts were loaded onto a 1.5% agarose gel, and the gels were run and photographed as described above. Reference Strains. Clostridium perfringens NCTC 3110 (for cpa, cpb, etx genes), NCTC 8084 (cpa, iA genes), Evira strain 352 (cpb2 gene, isolated from the small intestines of a pig), and 746 (cpe gene, isolated from a lamb) were used as positive controls in the multiplex PCR. As a negative control, Evira strain Clostridium sordellii (isolated from a pig) was used.

PFGE A total of 93 C. perfringens isolates, of which 55 were from birds with necrotic gut lesions and 38 from healthy birds, from 13 different commercial turkey farms were analyzed with PFGE. The farms were randomly coded A to M. The DNA plugs were prepared according to a PulseNet protocol (Ribot et al., 2006), with some modifications. Briefly, bacteria were grown on trypticase soy agar plates with 5% bovine blood overnight in anaerobic conditions. Cell suspensions were prepared in TE buffer (10 mM Tris, 1 mM EDTA, pH 8), and adjusted to an optical density of 1.8 to 1.9 at 610 nm. The cells were lysed with 5 mg/mL of lysozyme in 56°C for 10 min. Proteinase K was added to the suspensions before mixing with equal volumes of 1% SeaKem Gold agarose (Lonza Walkersville Inc., Walkersville, MD) containing 1% SDS, and dispensing into plug molds. The bacterial cells were lysed overnight with proteinase K. The plugs were washed twice overnight with TEN buffer (Tris-EDTA-NaCl) at 4°C. The DNA from the lysed cells was restricted twice with 20 U of SmaI (Fermentas, Burlington, Canada), first for 2 to 6 h and then for 3 to 16 h with fresh enzyme. The plugs were loaded into 1% SeaKem Gold agarose, and run in a Bio-Rad CHEF DRIII in 1 × HEPES buffer with 5.0 V/cm and pulse ramp from 0.5 to 40 s at 14°C for 18.5 h. XbaI digested Salmonella Braenderup H9812 was used as a molecular weight marker. The PFGE profiles were giv-

Table 1. Target toxin gene, PCR primers, and lengths of amplification products of Clostridium perfringens PCR Toxin gene

 

netB

NetB toxin gene

cpa

Alpha toxin gene

cpb

Beta toxin gene

cpe

Enterotoxin gene

etx

Epsilon toxin gene

iap

Iota toxin gene

cpb2

Beta 2 toxin gene

Primer

Sequence 5′-3′

AKP78 AKP79 CPA5L CPA5R CPBL CPBR CPEL CPER CPETXL CPETKR CPIL CPIR CPB2L CPB2R

GCTGGTGCTGGAATAAATGC TCGCCATTGAGTAGTTTCCC AGTCTACGCTTGGGATGGAA TTTCCTGGGTTGTCCATTTC TCCTTTCTTGAGGGAGGATAAA TGAACCTCCTATTTTGTATCCCA GGGGAACCCTCAGTAGTTTCA ACCAGCTGGATTTGAGTTTAATG TGGGAACTTCGATACAAGCA TTAACTCATCTCCCATAACTGCAC AAACGCATTAAAGCTCACACC CTGCATAACCTGGAATGGCT CAAGCAATTGGGGGAGTTTA GCAGAATCAGGATTTTGACCA

Length of amplification product (bp) 383 900 611 506 396 293 200

CHARACTERIZATION OF CLOSTRIDIUM PERFRINGENS

1753

en arbitrary numbers from 1 onward and analyzed with BioNumerics software (Applied Maths, Sint-MartensLatem, Belgium) using unweighted pair-group method with arithmetic averages (UPGMA) and dice similarity coefficient to create a similarity dendrogram.

Information on Farm Practices and Statistical Analyses All turkey farmers (n = 48) were interviewed about background information of the farm, their management and hygiene, feeding regimens, water systems, cleaning and disinfection, health status of the birds, diseases, and mortality rate, including NE and therapeutic use of antibiotics, use of brooding rings, and stress factors such as feed change, changes in management and environmental conditions, transfer of the birds, and any other nonspecific stress related to NE outbreaks according to the farmers. Statistical analyses on the basis of replies were carried out on associations between the different factors and NE by crosstabs. Associations were evaluated using χ2 and Fischer’s exact tests. All analyses were performed by means of IBM SPSS Statistics 19 (SPSS Inc., Chicago, IL).

RESULTS Clinical Signs Veterinarians at the farms observed that birds from affected flocks usually showed clinical signs consistent with NE, including a sudden increase in mortality observed in the flock (2–10%) at the age between 3 and 8 wk (average 4 wk). However, the conditions of the birds varied: birds with depression, ruffled feathers, and diarrhea suffering from dehydration and emaciation (cachexia) were seen, as well as healthy, well-nourished and feathered birds. A decrease in feed consumption and sometimes an increase in water consumption were observed. In most of the cases, the turkey males were more often affected.

Pathological Observations Macroscopically, the small intestines were both most frequently and severely affected. Small and demarcated lesions were most frequently found in the duodenal loop. However, in some cases hepatitis and choleocystitis was also observed. The unopened intestines were gas-filled and enlarged and their wall appeared thin. The intestinal contents were dark due to necrotic material. The opened intestines showed necrotic lesions of varying severity of the mucosa. In severe cases, the mucosa was covered with a typically thick greenish or yellowish diphtheric pseudomembrane (“Turkish towel”). This pseudomembrane extended throughout the small intestine or only in a localized area. In typical cases, histopathology confirmed a severe necrosis affecting the tips of the villi or the entire villi, together with a

Figure 1. Section showing necrotic lesion development in the distal ileum in a turkey from a field case of necrotic enteritis (NE). Original magnification: 400×. Typical changes in field cases of NE were characterized by diffuse and severe coagulative necrosis (N) of the mucosa. The demarcation area (DA) consists mainly of degenerated granulocytes and bacteria. V, viable tissue. Color version available in the online PDF.

demarcation zone of inflammatory cells, degenerated epithelial cells, fibrin, and colonies of clostridia-like, rod-shaped bacteria. However, the crypts were usually intact (Figure 1).

Toxinotyping by PCR All 212 isolates were α toxin-positive and one isolate (0.5%) was both α- and β2 toxin-positive. The netB gene was only identified in isolates from birds suffering from NE—14 out of 174 isolates (8%) from birds with NE—but in none of the 38 isolates from healthy birds (Table 3). However, this difference was not statistically significant (P = 0.079, Fischer’s exact test).

PFGE The PFGE analysis with SmaI restriction enzyme resulted in 31 PFGE profiles among the 93 C. perfringens isolates showing a high diversity with no obvious clusters (Figure 2). Sixteen (17%) of all isolates had a unique PFGE profile. Among the 55 isolates from birds suffering from NE, there were 20 different PFGE patterns (1–7, 9, 11–13, 15, 18, 20, 22, 24, 25, 27, 29, 30), and among the 38 isolates from healthy birds 16 different PFGE patterns (2, 6, 8, 11, 14, 16, 17, 19, 21, 23–24, 26, 28, 29, 31, 32) were distinguished. Nine PFGE patterns (2, 11, 12, 15, 19, 23–24, 28, and 29) were found in C. perfringens isolates from different farms (Table 2). Five PFGE patterns (2, 6, 11, 24, 29) were found among isolates both from healthy birds and

1754

Lyhs et al.

Figure 2. Dendrogram of pulsed-field gel electrophoresis (PFGE) patterns obtained from SmaI analysis of Clostridium perfringens isolates from Finnish turkeys with different health status (H: healthy, NE: necrotic enteritis).

birds suffering from NE (Table 2). The most prevalent PFGE pattern 11 was found at farms B and F in 2009, and at farm G in 2011 in isolates from healthy birds. The same PFGE pattern 11 was detected at farms D and H in 2011 from birds suffering from NE. At farm B, in 2008 both PFGE patterns 2 and 6 were detected in isolates from a bird suffering from NE, and in 2009 from a healthy bird. The PFGE pattern 29 was isolated from healthy birds at farms L and M in 2009, but in 2010 from birds with NE at farm H. The PFGE pattern 22 was found in a healthy bird in 2009 from farm E, in an NE bird in 2010 from farm C, and PFGE pattern 24 in a healthy bird in 2010 from farm H, in an NE bird in 2010 from farm A. Among netB-positive isolates, 4 different PFGE patterns (1, 9, 18, 30) were found. The PFGE pattern 30 was detected both in a netB-positive isolate and 2 netBnegative isolates.

Farm Practices and Statistical Analyses It was found that in the data based on the interviews, NE appeared less often in farms where brooding rings

were used (13%) than in farms where brooding rings were not used (60%). However, the difference was not statistically significant (P = 0.057). No other significant connections of the different factors to NE were found.

DISCUSSION In the present study, all C. perfringens isolates from turkeys were α toxin-positive. This is in agreement with other European studies of broilers (Engström et al., 2003; Nauerby et al., 2003; Heikinheimo and Korkeala, 2005; Gholamiandekhordi et al., 2006). Only one isolate was positive for the gene encoding the β2 toxin. Gholamiandekhordi et al. (2006) found 5 isolates out of 63 to be β2 toxin-positive, which indicates that the β2 toxin is not an important or essential virulence factor in the development of NE. To the authors’ knowledge, there is no information available about the diversity of C. perfringens isolates analyzed by PFGE from healthy turkeys or turkeys suffering from NE. In the present study, a high diversity of C. perfringens isolates from turkeys of different health status was shown. From 1 to 6 different PFGE profiles

1755

CHARACTERIZATION OF CLOSTRIDIUM PERFRINGENS

Table 2. Description of the Clostridium perfringens isolates collected from turkeys from 13 commercial Finnish farms during the period from 1998 to 20121 Farm (location of the farm)

Health status of birds

A (Southwest Finland)

NE NE NE NE NE NE NE NE NE NE Healthy Healthy Healthy Healthy Healthy NE NE NE NE NE NE NE NE NE NE NE Healthy Healthy Healthy Healthy Healthy Healthy Healthy NE NE NE Healthy Healthy NE Healthy Healthy Healthy Healthy Healthy Healthy Healthy Healthy Healthy  

B (South Ostrobothnia)

C (South Ostrobothnia)

D (South Ostrobothnia)

E (South Ostrobothnia) F (South Ostrobothnia) G (South Ostrobothnia) H (Southwest Finland)

I (Southwest Finland) J (Southwest Finland) K (Southwest Finland)

L (South Ostrobothnia) M (South Ostrobothnia) Total 1PFGE

PFGE type

No. of isolates

1 12 15 18 24 2 4 6 7 15 2 6 11 19 26 2 3 20 22 25 30 30 5 9 11 27 8 22 31 11 17 28 11 11 12 29 24 28 13 14 16 19 21 23 23 29 23 29  

10 2 2 2 1 1 1 1 1 1 3 1 3 1 1 2 1 1 1 1 2 1 3 1 5 1 1 1 1 1 1 1 9 8 3 2 2 1 1 1 1 1 1 3 1 1 1 1 93

Other toxins

NetB toxin

 

+ − – + – – – – – – – – – – – – – – – – – + – + – – – – – – – – – – – – – – – – – – – – – – – –

 

α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α, β2+ α α α α α α α α α

Year of strain isolation 2010 2011 2011 2010 2011 2008 2005 2008 2005 2010 2009 2009 2009 2009 2009 2010 2005 2005 2010 2006 2006 2006 2005 2006 2011 2005 2009 2009 2009 2009 2009 2009 2011 2011 2011 2010 2010 2010 1998 2009 2009 2009 2009 2009 2009 2009 2009 2009  

= pulsed-field gel electrophoresis; NE = necrotic enteritis.

were found in different turkey farms with NE. Other studies found that different isolates from a broiler flock suffering from NE are mostly of the same PFGE types (Nauerby et al., 2003; Gholamiandekhordi et al., 2006). However, in broiler flocks with subclinical NE, the genetic diversity may be higher (Johansson et al., 2010), which is in agreement with our findings. In the present study, sometimes the same PFGE profile was found in more than one farm, which indicates that these were either common clones or originated from the same source. In healthy turkeys, 1 to 2 different PFGE profiles were found in 6 of the farms included in this study, and 4 to 5 different PFGE profiles were

found in 3 farms. Nauerby et al. (2003) showed that healthy broilers carried several different C. perfringens clones within a flock. Gholamiandekhordi et al. (2006) found unrelated PFGE patterns among all isolates from healthy flocks (except 2 strains). Ten PFGE patterns were detected in C. perfringens isolates from birds of different health status from different farms located in different areas in different years (Table 2). Six PFGE patterns were identified both in healthy turkeys and turkeys suffering from NE, and 4 either from turkeys only with NE or only healthy turkeys. It can be speculated that strains might circulate at the same or different farms, but not always causing

1756

Lyhs et al.

the NE. Other factors must play a role in development of the disease. It also seems that an NE outbreak does not only depend on a certain C. perfringens strain. The C. perfringens NetB toxin was recently proposed as a new key virulence factor for the development of NE in broilers (Keyburn et al., 2008, 2010). Martin and Smyth (2009) found the netB gene in 7 out of 80 (8.8%) isolates obtained from chickens with no evidence of NE, whereas of the 12 isolates recovered from chickens with NE, 7 (58.3%) and 5 (41.7%) were netB-positive and netB-negative, respectively. Keyburn et al. (2010) reported that 70% (31/44) of the strains isolated from NE-affected birds were netB-positive, whereas only 2 out of 55 isolates from healthy chickens carried netB. Abildgaard et al. (2010) observed in a Danish study that, among 25 and 23 C. perfringens isolates recovered from NE and healthy chickens, 13 (52%) and 14 (61%) were netB-positive, respectively. In a study of Norwegian broilers, Johansson et al. (2010) detected netB in 91% (31/34) of isolates from NE and cholangiohepatitis lesions. Chalmers et al. (2008) described that 95% (39/41) of all C. perfringens isolates from broilers with NE carried netB and 35% (7/20) from healthy broilers. Thus, recent literature indicates a strong tendency that C. perfringens isolates from broilers with NE are netBpositive, whereas the majority of isolates from healthy birds are netB-negative. It is therefore interesting that in the present study, a relatively lower proportion of netB-positive isolates was found. Out of the 174 C. perfringens isolates being recovered from turkeys with NE, only 14 (8%) were netB-positive and 160 (92%) netBnegative. This finding is in accordance with Cooper and Songer (2010), showing that netB-negative strains also produced the disease in an experimental model. Thus, NetB production might not be an obligate requirement for induction of turkey NE. However, in none of the 38 isolates from healthy birds was the netB gene detected. Although this seems to suggest that NetB is also involved as a virulence factor for development of NE in turkeys, it should be emphasized that the apparent difference in occurrence of NetB among isolates from animals with and without NE was not statistically significant (P = 0.079; Table 3). Besides, the netB-positive isolates were recovered in only 4 farms. More isolates from a larger number of farms should be investigated

Table 3. Necrotic enteritis (NE) status and findings of necrotic enteritis toxin B (NetB) toxin in Clostridium perfringens isolates from Finnish turkeys Necrotic enteritis status Item NetB toxin positive NetB toxin negative Total

NE positive

NE negative

Total

14 160 174

0 38 38

14 198 212

to determine a relation between NetB and virulence to turkeys. Based on interviews of farmers, it seemed that the use of brooding rings may play a role in the occurrence of NE. However, even when the differences were large, no statistically significant evidence was found that the use of brooding rings in the farms had an effect on the outbreaks of NE. This is mainly due to the low response rate among the farmers. In conclusion, a high diversity of C. perfringens isolates from Finnish turkeys with different health status was shown. All isolates were α toxin positive, but only low percentages of isolates carried the netB toxin gene. The role of the netB toxin in NE in turkeys needs to be further investigated.

ACKNOWLEDGMENTS The C. perfringens positive and negative control strains for netB toxin typing were kindly provided by Leen Timbermont (University of Ghent, Belgium). The practical assistance from the personnel of Finnish Food Safety Authority Evira, Research and Laboratory Department, Production Animal and Wildlife Research Unit (Seinäjoki) and Veterinary Bacteriology (Helsinki) is gratefully acknowledged. The financial support from the Finnish Funding Agency for Technology and Innovation (TEKES) is gratefully acknowledged. We thank all turkey farmers taking part in this study.

REFERENCES Abildgaard, L., T. E. Sondergaard, R. M. Engberg, A. Schramm, and O. Højberg. 2010. In vitro production of necrotic enteritis toxin B, NetB, by netB-positive and netB-negative Clostridium perfringens originating from healthy and diseased broiler chickens. Vet. Microbiol. 144:231–235. Al-Sheikhly, F., and R. B. Truscott. 1977. The interaction of Clostridium perfringens and its toxins in the production of necrotic enteritis of chickens. Avian Dis. 21:256–263. Baums, C. G., U. Schotte, G. Amtsberg, and R. Goethe. 2004. Diagnostic multiplex PCR for toxin genotyping of Clostridium perfringens isolates. Vet. Microbiol. 100:11–16. Chalmers, G., H. L. Bruce, D. B. Hunter, V. R. Parreira, R. R. Kulkarni, Y.-F. Jiang, J. F. Prescott, and P. Boerlin. 2008. Multilocus sequence typing analysis of Clostridium perfringens isolates from necrotic enteritis outbreaks in broiler chicken populations. J. Clin. Microbiol. 46:3957–3964. Cooper, K. K., and J. G. Songer. 2009. Necrotic enteritis in chickens: A paradigm of enteric infection by Clostridium perfringens type A. Anaerobe 15:55–60. Cooper, K. K., and J. G. Songer. 2010. Virulence of Clostridium perfringens in an experimental model of poultry necrotic enteritis. Vet. Microbiol. 142:323–328. Cooper, K. K., J. R. Theoret, B. A. Stewart, H. T. Trinh, R. D. Glock, and J. G. Songer. 2010. Virulence for chickens of Clostridium perfringens isolated from poultry and other sources. Anaerobe 16:289–292. Engström, B. E., C. Fermer, A. Lindberg, E. Saarinen, A. Båverud, and A. Gunnarsson. 2003. Molecular typing of isolates of Clostridium perfringens from healthy and diseased poultry. Vet. Microbiol. 94:225–235. Gholamiandekhordi, A. R., R. Ducatelle, M. Heyndrick, F. Haesebrouck, and F. Van Immerseel. 2006. Molecular and phenotypical

CHARACTERIZATION OF CLOSTRIDIUM PERFRINGENS characterization of Clostridium perfringens isolates from poultry flocks with different disease status. Vet. Microbiol. 113:143–152. Heikinheimo, A., and H. Korkeala. 2005. Multiplex PCR assay for toxinotyping Clostridium perfringens isolates obtained from Finnish broiler chickens. Lett. Appl. Microbiol. 40:407–411. Johansson, A., A. Aspàn, M. Kaldhusdal, and B. E. Engström. 2010. Genetic diversity and prevalence of netB in Clostridium perfringens isolated from a broiler flock affect by mild necrotic enteritis. Vet. Microbiol. 144:87–92. Keyburn, A. L., J. D. Boyce, P. Vaz, T. L. Bannam, M. E. Ford, D. Parker, A. Di Rubbo, J. I. Rood, and R. J. Moore. 2008. NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog. 4:e26. Keyburn, A. L., S. A. Sheedy, M. E. Ford, M. M. Williamson, M. M. Awad, J. I. Rood, and R. J. Moore. 2006. Alpha toxin of Clostridium perfringens is not an essential virulence factor in necrotic enteritis in chickens. Infect. Immun. 74:6496–6500. Keyburn, A. L., X.-X. Yan, T. L. Bannam, F. Van Immerseel, J. I. Rood, and R. J. Moore. 2010. Association between avian necrotic enteritis and Clostridium perfringens strains expressing NetB toxin. Vet. Res. 41:21–28. Løvland, A., and M. Kaldhusdal. 2001. Severely impaired production performance in broiler flocks with high incidence of Clostridium perfringens-associated hepatitis. Avian Pathol. 30:73–81. Martin, T. G., and J. A. Smyth. 2009. Prevalence of netB among some clinical isolates of Clostridium perfringens from animals in the United States. Vet. Microbiol. 136:202–205. Nauerby, B., K. Pedersen, and M. Madsen. 2003. Analysis by pulsedfield gel electrophoresis of the genetic diversity among Clostridium perfringens isolates from chickens. Vet. Microbiol. 94:257–266.

1757

Parish, W. E. 1961. Necrotic enteritis in fowl (Gallus gallus domesticus). 1. Histopathology of the disease and isolation of a strain of Clostridium welchii. J. Comp. Pathol. 71:377–393. Pedersen, K., L. Bjerrum, B. Nauerby, and M. Madsen. 2003. Experimental infections with Clostridium perfringens strains in broiler chickens using isolator facilities. Avian Pathol. 32:403–411. Ribot, E. M., M. A. Fair, R. Gautom, D. N. Cameron, S. B. Hunter, B. Swaminathan, and T. J. Barrett. 2006. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog. Dis. 3:59–67. Songer, J. G. 1996. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 9:216–234. Timbermont, L., F. Haesebrouck, R. Ducatelle, and F. Van Immerseel. 2011. Necrotic enteritis in broilers: An updated review on the pathogenesis. Avian Pathol. 40:341–347. Van Immerseel, F., J. De Buck, F. Pasmans, G. Huyghebaert, F. Haesebrouck, and R. Ducatelle. 2004. Clostridium perfringens in poultry: An emerging threat for animal and public health. Avian Pathol. 33:537–549. Van Immerseel, F., J. I. Rood, R. J. Moore, and R. W. Titball. 2009. Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. Trends Microbiol. 17:32–36. Williams, R. B. 2005. Intercurrent coccidiosis and necrotic enteritis of chickens: Rational, integrated disease management by maintenance of gut integrity. Avian Pathol. 34:159–180.