Characterization of cytotoxicity-related gene expression in response to virulent Marek’s disease virus infection in the bursa of Fabricius

Research in Veterinary Science 94 (2013) 496–503

Contents lists available at SciVerse ScienceDirect

Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc

Characterization of cytotoxicity-related gene expression in response to virulent Marek’s disease virus infection in the bursa of Fabricius Cui-Ying Chen a, Qing-Mei Xie a,⇑, Yu Xue a, Jun Ji a, Shuang Chang b, Jing-Yun Ma a, Ying-Zuo Bi a a b

College of Animal Science, South China Agricultural University, Guangzhou 510642, People’s Republic of China US Department of Agriculture, Agricultural Research Service, Avian Disease and Oncology Laboratory, 3606 East Mount Hope Road, East Lansing, MI 48823, USA

a r t i c l e

i n f o

Article history: Received 7 May 2012 Accepted 19 October 2012

Keywords: Cytotoxic responses Marek’s disease virus The bursa of Fabricius

a b s t r a c t Cell-mediated cytotoxic responses are critical for control of Marek’s disease virus (MDV) infection and tumour development. However, the mechanisms of virus clearance mediated by cytotoxic responses in the bursa of Fabricius of chickens during MDV infection are not fully understood. In this study, the host cytotoxic responses during MDV infection in the bursa were investigated by examining the expression of genes in the cell lysis pathways. Partial up-regulation existed in the expression of the important cytolytic molecule granzyme A (GzmA), Fas, NK lysin and DNA repair enzyme Ape1, whereas little or no expression appeared in other cytolytic molecules, including perforin (PFN) and Fas ligand (FasL), and molecules involved in DNA repair and apoptosis in the bursa during MDV infection. These results suggest that less sustained cytotoxic activities are generated in the bursa of MDV-infected chickens. The findings of this study provide a more detailed insight into the host cytotoxic responses to MDV infection. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction Marek’s disease virus (MDV) is an oncogenic alpha-herpesvirus that causes transformation of lymphocytes, immunosuppression and development of tumour in chickens (Venugopal, 2000). MDV is a highly cell-associated virus with long and complex pathogenicity, which mainly involves three stages: cytolytic, latent, and neoplastic stages (Ross, 1999; Calnek, 2001). An early cytolytic infection, with MDV replication mainly in B cells, occurs in lymphoid organs such as thymus, spleen, and bursa of Fabricius and extends from 3–6 days post-infection (dpi). After the early cytolytic stage, the infection switches to a latent stage in the infected T cells. The latent stage is followed by the neoplastic stage, with transformation of T cells and development of lymphomas in chickens susceptible to MDV. Cell-mediated immune responses, including cytotoxic responses, are important in prevention of MDV infection due to the strictly cell-associated nature of the virus (Schat and Markowski-Grimsrud, 2001). Host cytotoxic responses against MDV-infected or transformed cells have been attributed to both cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells (Schat and Xing, 2000; Sarson et al., 2008). Previous studies have shown that antigen-specific CTLs are activated by a number of immediate

⇑ Corresponding author. Postal addresses: College of Animal Science, South China Agricultural University, 483 Wushan Road, Guangzhou 510642, People’s Republic of China. Tel./fax: +86 20 85280283. E-mail address: [email protected] (Q.-M. Xie). 0034-5288/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.rvsc.2012.10.014

early, early, and late MDV antigens, including viral glycoproteins (e.g., gB, gI), pp38, ICP4 and meq (Omar and Schat, 1997; Markowski-Grimsrud and Schat, 2002; Garcia-Camacho et al., 2003). Infection with MDV results in an early activation of NK cells (Schat and Xing, 2000). Higher NK cell activities and better immune responses to vaccination and MDV infection have been generated in MD resistant chicken lines (Sharma, 1981; Heller and Schat, 1987; Garcia-Camacho et al., 2003). It has been postulated that major histocompatibility complex (MHC)-based genetic resistance is, at least to a large extent, dependent on CTLs responses (Schat, 1996; Schat and Markowski-Grimsrud, 2001) and NK cell activities (Kaufman, 2000; Garcia-Camacho et al., 2003). Due to the potential importance of CTLs and NK cells in a protective host response to MDV highlighted by the more sustained cytotoxic responses in MD resistant and vaccinated chickens (Sarson et al., 2008), the details of the cytotoxic mechanisms need to be further elucidated. Virtually all of the measurable cell-mediated cytotoxicity delivered by CTLs and NK cells come from two major cell lysis pathways: the granule exocytosis pathway and Fas-mediated pathway (Russell and Ley, 2002; Chávez-Galán et al., 2009). Although the two pathways have not been well studied in chickens, they have been well characterized in mammalian species (Chávez-Galán et al., 2009; Pardo et al., 2009). The granule exocytosis pathway is believed to utilize perforin (PFN), which forms ‘pores’ in the target cell membrane to traffic the granzymes, such as Granzyme A (GzmA) and Granzyme B (GzmB), to appropriate locations in target cells, where they can cleave critical substrates that initiate DNA

C.-Y. Chen et al. / Research in Veterinary Science 94 (2013) 496–503

damage and apoptosis (Russell and Ley, 2002; Trapani and Smyth, 2002; Pardo et al., 2009; Lieberman, 2010). GzmA, an abundant serine protease in CTL and NK cell granules, seems to induce apoptosis by caspase-independent pathway (Beresford et al., 1999; Lieberman and Fan, 2003). A special target of GzmA is a 270–420 kDa SET (endoplasmic reticulum-associated) which contains the GzmA-activated DNase NM23-H1, the protein phosphatase PP2A inhibitor pp32, and three GzmA substrates—the nucleosome assembly protein SET, the base excision repair enzyme Ape1, and the DNA binding protein high mobility group-2 (HMG-2) (Beresford et al., 2001; Chowdhury and Lieberman, 2008). The cleavage of the nucleosome assembly protein SET and HMG-2 by GzmA interferes with DNA replication, transcription and repair. GzmA-mediated proteolysis of Ape1 also interferes with its known oxidative repair function for DNA (Fan et al., 2003). Furthermore, interacting with the SET complex, Poly (ADP-ribose) polymerase (PARP) has been proposed to deplete the cellular energy at the time of DNA fragmentation to further facilitate apoptosis (Trapani and Smyth, 2002; Pinkoski and Green, 2003). The Fas-mediated pathway involves crosslinking of the cell surface death receptor Fas expressed on target cells induced by cell surface Fas ligand (FasL) expressed on CTLs (Russell and Ley, 2002; Curtin and Cotter, 2003; Chávez-Galán et al., 2009; Hassin et al., 2011). Cross-linked Fas rapidly recruits and activates two specific proteins, Fasassociated death domain and caspases-8, to assemble the death-inducing signal complex (DISC). Upon activation, caspases8 directly and indirectly activates other members of caspases family, such as caspases-9 and caspases-3, which appear to be responsible for the cleavage of a number of structural and regulatory proteins, and hence resulting in the induction of apoptosis (Nicholson and Thornberry, 1997; Hassin et al., 2011). Although some cytotoxic response genes have been investigated in the spleen of MDV-infected chickens (Sarson et al., 2006, 2008), not much is known about the cytotoxic responses against MDV in the bursa of Fabricius of chickens. This is a unique primary lymphoid organ, which plays an important role in the process of MDV pathogenesis, since it provides an environment for a critical phase of MDV replication cycle, the cytolytic phase (Schat et al., 1980). Host cytotoxic responses characterized by cell infiltration and expression of the granule exocytosis pathway genes have been studied in the bursa of Fabricius in response to infectious bursal disease virus infection in chickens (Rauf et al., 2011). Moreover, we have previously reported the up-regulation of the GzmA gene after MDV infection (Chen et al., 2011), and the induction of this gene also occurred in chickens infected with infectious bronchitis virus (Wang et al., 2006). Given the paucity of information on the host cytotoxic responses to MDV in the bursa of Fabricius, the objective of this study was to investigate the expression of cytotoxicity-associated genes in this lymphoid organ during MDV infection. Analysis of the expression of these genes during MDV infection might help in understanding the mechanisms of cytotoxic responses against MDV. 2. Materials and methods Institutional and national guidelines for the care and use of animals were followed and all experimental procedures involving animals were approved by the Committee of Animal Experiments of South China Agricultural University (approval ID 201004152). All efforts were made to minimize pain and distress. 2.1. Experimental animals Specific pathogen-free (SPF) chickens were purchased from Guangdong Wen’s Foodstuffs Group Co. Ltd., housed in biosecurity isolators of the College of Animal Science under quarantine

497

conditions and negative pressure, and provided with water and commercial feed ad libitum. The chickens were free of maternal antibodies to MDV. 2.2. Virus strain Chickens were infected with the China standard J-1 virulent strain of MDV1 (Li et al., 2008; Xu et al., 2011), obtained from Yu Zhou (Beijing Institute of Animal Husbandry and Veterinary Science). 2.3. Experimental design 90 five day-old SPF chickens were randomly divided into two groups. 50 chickens were infected intraabdominally at five days of age with 1000 plaque-forming units (PFU) of the virulent MDV1 (J-1). The rest (n = 40) were uninfected controls. At 4, 7, 10, 14, and 21 dpi, five MDV-infected chickens were euthanized by CO2 inhalation and necropsied along with five uninfected controls. Bursal samples collected from each chicken were snap frozen in liquid nitrogen and then stored at 70 °C for further analysis. 2.4. RNA extraction Total RNA was extracted from the bursa with TRIZOL reagent (Invitrogen, USA), according to the manufacturer’s instructions. The RNA quality was assessed by formaldehyde agarose gel electrophoresis and was quantified spectrophotometrically. Highquality RNA with A260/A280 ratio between 1.8 and 2.0 and intact ribosomal 28S and 18S bands was used for real-time RT-PCR analysis. 2.5. Conventional RT-PCR Conventional RT-PCR for the detection of MDV meq gene in the bursal RNA preparations was done for initial screening. The cDNA was synthesized using a high fidelity PrimeScript RT-PCR kit (TaKaRa, Japan), according to the manufacturer’s instructions. The primer pair was specific for MDV meq gene (Table 1) and has been reported previously (Tian et al., 2011). PCR was performed to amplify the 1081 bp fragment of the meq gene under the following conditions: 30 cycles of denaturation for 10 s at 98 °C, annealing for 15 s at 58 °C, and extension for 70 s at 72 °C. The PCR products were analyzed by agarose gel electrophoresis using 1% gel containing ethidium bromide, and the bands were visualized under UV illumination for image capture. 2.6. Real-time RT-PCR Viral genes and cytotoxicity-related genes were quantified using standard curves in real-time RT-PCR assays. These genes and the endogenous reference gene glyceraldehyde-3-phosphatedehydrogenase (GAPDH) were PCR amplified, cloned and used as standard controls in order to generate standard curves using the same protocol as described previously (Abdul-Careem et al., 2006; Chen et al., 2011). After digestion with DNase I (TaKaRa, Japan) at 37 °C for 30 min, 2 lg of total RNA was used for reverse transcription reaction with the ReverTra AceÒ qPCR RT Kit (ToYoBo, Japan). Amplifications were performed with 1 ll cDNA in a total volume of 20 ll with FastStart SYBR Green Master (Rox) (Roche, Sweden) and conducted in the Stratagene Mx3005P QPCR system (Stratagene, Netherlands). Each real-time RT-PCR assay was run along with a dilution series of the standard that served as the calibrator. A control without template was also included in each run. The thermal profile for real-time RT-PCR was performed at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. All reactions were performed in triplicate. The primers

498

C.-Y. Chen et al. / Research in Veterinary Science 94 (2013) 496–503

Table 1 Primers used for conventional RT-PCR and real-time RT-PCR. Gene symbol

Ape 1 Fas FasL GAPDH pp38 GzmA HMG-2 meq meq* NK-Lysin PARP PFN SET *

Primer sequences (50 –30 ) Forward

Reverse

ATCGATCCCATCTGAGCTGT TGTGTGCAGAATGCAAGTCA CAGTGTCAGCTTCCTGGTGA CCTCTCTGGCAAAGTCCAAG GTGATGGGAAGGCGATAGAA CAATCTGAAGGGAGGCAGAG ACCACCATCTGCATTCTTCC ACGCTAGCTTTGTCCTGTT GGCACGGTACAGGTGTAAAGAG GCAAGGGGATTAAATGCAGA GCAGGAAAAACAGCTGAAGG ATGGCGCAGGTGACAGTGA CGTTCAAGCCAGACACAGAA

GTATTGGAGGCGGTTGAGAC CTCACAATGTCAGGGACGTG CCTTTTTCACTGGCTTGCTC CATCTGCCCATTTGATGTTG CTTTCCCCGTAGAGCTACCC TTTGAGATCATCCCCAGAGG ACTCTTGCTCTTGGCACGAT GGAAACCACCAGACCGTAGA GCATAGACGATGTGCTGCTGAG GGATCATCGTTGTTTTGCAG GCATCGCTCTTGAACACAAA TGGCCTGCACCGGTAATTC CTCCCCTTCTTCATCATCCA

Size of PCR product (bp)

Reference, accession number

247 153 185 200 159 217 214 184 1081 202 225 390 189

NM_001184759.1 NM_001199487.1 NM_001031559.1 Adams et al., 2009 HQ638162.1 NM_204457.1 M80574 Abdul-Careem et al., 2006 Tian et al., 2011 DQ186291.1 NM_205263 Sarson et al., 2008 NM_001030691.1

The primer for conventional RT-PCR.

(listed in Table 1) were designed by Primer 3 software (http://frodo.wi.mit.edu/) based on published sequences. 2.7. Western blotting Protein extraction from the bursa of Fabricius was accomplished with KEYGEN total protein extraction kit (KeyGEN, China), according to the manufacturer’s instructions. The proteins were electrophoresed on a 10% sodium dodecyl sulphate-polyacrylamide (SDS) gel and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, USA) with a Mini Trans-Blot electrophoretic transfer cell (Bio-Rad Trans-Blot SD, USA). After incubating for 2 h at room temperature in blocking buffer TBST (20 mM Tris–HCl [pH 7.4], 150 mM NaCl, 0.1% Tween-20) containing 5% filter-sterilised bovine serum albumin to prevent nonspecific binding, membranes were incubated with polyclonal rabbit anti-human FasL (1: 200; predicted molecular weight: 36–43 kDa) (Bioss, China), b-actin (1:1000; predicted molecular weight: 42 kDa) (Bioss, China), GzmA (1:200) (11288-1-AP, ProteinTech, China) and PFN (Perforin 1 antibody, 1:100) (14580-1-AP, ProteinTech, China) antibodies at 4 °C overnight. The membranes were then washed three times with TBST buffer and incubated for 1 h at room temperature with the secondary antibodies goat polyclonal anti rabbit IgG (H+L)-HRP (Bioss, China). Immunoreactive bands were visualized by SuperSignal West Pico Chemiluminescent Substrate Trial Kit (Pierce, USA) and exposed to X-ray film. The intensity of each band was quantified using GeneTools software (version 3.07, SynGene). The intensity ratios between target proteins and b-actin were calculated as the indication of endogenous target proteins expression changes.

conventional RT-PCR determined that the meq transcript could be amplified in all tested RNA samples from MDV-infected chickens, but not from mock-infected controls (data not shown). The results of MDV meq and pp38 transcripts quantification from the bursa of MDV-infected chickens evaluated by real-time RT-PCR are illustrated in Fig. 1. We observed a consistent up-regulation in meq gene expression throughout the experimental period, and the meq transcripts observed at 21 dpi were significantly higher

2.8. Statistical analysis Quantification of expression of viral genes and cytotoxicityrelated genes by real-time RT-PCR was done using the same method as described previously (Abdul-Careem et al., 2006). All data were subjected to One-Way Analysis of Variance (ANOVA) followed by Tukey test using the statistical package SPSS 17.0 software (SPSS, Chicago, USA). Differences were considered as statistically significant at a P value of less than 0.05. All data are shown as mean ± standard errors (SE). 3. Results 3.1. MDV replication in the bursa of Fabricius of MDV-infected chickens The transcripts of the Meq and pp38 genes of MDV were examined in the bursa of chickens. Initial screening of bursal RNA by

Fig. 1. MDV transcripts in the bursa of Fabricius infected with virulent MDV1 (J-1) were analyzed by real-time RT-PCR. Chickens were infected with MDV1 and sampled at 4, 7, 10, 14 and 21 dpi. Mean Meq mRNA (A) and pp38 mRNA (B) expression relative to GAPDH mRNA expression was presented as mean ± SE. a,b,c,d Mean values with unlike letters were significantly different (P 6 0.05).

C.-Y. Chen et al. / Research in Veterinary Science 94 (2013) 496–503

compared to those observed at 4, 7, 10 and 14 dpi (P < 0.05) (Fig. 1A). The expression of pp38 was higher at 4 dpi, followed by a decline at 7 and 10 dpi, and then followed by an increase at 14 dpi, a decline for the rest of the experiment period (Fig. 1B). The pp38 transcripts observed at 4 dpi were significantly higher compared to those observed at 7, 10, 14 and 21 dpi (P < 0.05). Analysis of meq and pp38 genes indicated that our observations were in agreement with the proposed MDV pathogenesis model in which the cytolytic phase extended from 3–6 dpi, the latent phase began around 7–8 dpi (Calnek, 2001). 3.2. Expression of PFN, GzmA, NK lysin and molecules involved in DNA repair and apoptosis in the bursa of Fabricius of MDV-infected chickens As illustrated in Fig. 2, both PFN and GzmA mRNAs were upregulated when comparing MDV-infected to uninfected chickens over time, and were significantly up-regulated at 7 and 10 dpi (P < 0.05) (Fig. 2A–B), whereas no significantly differential expression of SET and PARP mRNAs was detected throughout the experimental period (Fig. 2E–F). GzmB expression was not detected in the bursa of MDV-infected and uninfected hosts (data not shown). The expression of Ape1 mRNA at 4 dpi was significantly higher in the bursa of MDV-infected chickens compared to the controls

499

(P < 0.05) (Fig. 2D). In contrast, HMG-2 mRNA was significantly down-regulated in the bursa of MDV-infected chickens at 10 dpi (P < 0.05) (Fig. 2C). Additionally, upon comparing MDV-infected to uninfected chickens, there was an increase in the expression of NK lysin mRNA throughout the experimental period and significantly up-regulated at 7, 10 and 21 dpi (P < 0.05) (Fig. 2G). To gain further insight into the regulation of granule exocytosis pathway by MDV infection, we examined the expression levels of PFN and GzmA proteins between the MDV-infected and uninfected chickens by Western blotting analysis. As shown in Fig. 3, infection with MDV led to strong expression of GzmA protein (a specific band with a molecular weight of approximately 60 kDa) in the bursa at 4 dpi (P < 0.05), and marginally higher expression in the bursa at 7, 10, 14 and 21 dpi. In contrast, there was slightly lower expression of PFN protein (a specific band with a molecular weight approximately 65 kDa) in the bursa between the MDV-infected and uninfected chickens at 4, 7 and 14 dpi, besides a marginal increase at 10 and 21 dpi. b-Actin protein was detected as a loading control. 3.3. Expression of Fas and FasL in the bursa of Fabricius of MDVinfected chickens To determine whether cytotoxic responses to MDV were mediated by Fas pathway, the expression of Fas and FasL in the bursa of

Fig. 2. Gene expression of GzmA, PFN, NK lysin and molecules involved in DNA repair and apoptosis in the bursa of Fabricius was analyzed by real-time RT-PCR. Chickens were infected with virulent MDV1 (J-1) and sampled at 4, 7, 10, 14 and 21 dpi. Expression values of GzmA (A), PFN (B), HMG-2 (C), Ape1 (D), SET (E), PARP (F) and NK lysin (G) were normalized against GAPDH and plotted over time. Gene expression in the bursa of Fabricius of MDV-infected chickens was illustrated by gray lines with square symbols, and expression in uninfected chickens as dark lines with triangle symbols.

500

C.-Y. Chen et al. / Research in Veterinary Science 94 (2013) 496–503

Fig. 3. Expression of GzmA and PFN in the bursa of Fabricius was analyzed by western blotting. Protein extractions were prepared from bursas of both non-infected and infected chickens over all the time points, fractionated by 10% SDS-PAGE before proteins were transferred to a PDVF membrane and immunoblotted by using antibodies specific for PFN or GzmA. A b-actin specific antibody was used to detect levels of b-Actin as a loading control. The intensity ratios between GzmA/PFN and b-actin were calculated as an indication of endogenous GzmA/PFN proteins expression changes.

Fig. 4. Expression of Fas and FasL in the bursa of Fabricius at 4, 7, 10, 14 and 21 dpi. (A) Real-time RT-PCR analysis of Fas and FasL expression levels. Expression values were normalized against GAPDH and plotted over time. Gene expression in the bursa of Fabricius of MDV-infected chickens was illustrated by gray lines with square symbols, and expression in uninfected chickens as dark lines with triangle symbols. (B) Western blot analysis of FasL protein expression in the bursa of Fabricius of chickens infected with MDV and controls at 4, 7, 10, 14 and 21 dpi. The intensity ratios between FasL and b-actin were calculated as an indication of endogenous FasL protein expression changes. b-Actin protein was detected as a loading control.

Fabricius of MDV-infected chickens was examined. As shown in Fig. 4A, the Fas mRNA was significantly higher at 21 dpi (P < 0.05) in the bursa of MDV-infected chickens when compared

to the controls, but was marginally different between the MDVinfected and uninfected chickens at other time points. On the contrary, there was a consistent up-regulation in FasL mRNA

C.-Y. Chen et al. / Research in Veterinary Science 94 (2013) 496–503

throughout the experimental period, and the FasL transcription was significantly increased at 7, 10 and 21 dpi (P < 0.05) in the bursa of MDV-infected chickens when compared to the controls (Fig. 4A). However, no corresponding significantly differential expression of FasL (a specific band with a molecular weight approximately 38 kDa) between the MDV-infected and uninfected chickens was detected by Western blotting analysis (Fig. 4B). b-Actin protein was detected as a loading control.

4. Discussion and conclusion Both CTLs and NK cells are key components of the host immune system that control viral infections and tumour development by acting through the granule secretory pathway and/or the Fas-mediated pathway (Chávez-Galán et al., 2009; Pardo et al., 2009). The CTL responses are hypothesized to be of paramount importance to the immune response during MDV infection (Markowski-Grimsrud and Schat, 2002). The bursa of Fabricius is a unique primary lymphoid organ for the development of avian B cells and generation of the immunoglobulin repertoire (Cooper et al., 1966), and also provides an important environment for a critical phase of MDV replication cycle, the cytolytic phase (Schat et al., 1980). Removal of the bursa results in a lower viraemia level, delayed MD mortality and an enhanced rejection of the tumor (Schat et al., 1980). In the present study, therefore, we profiled genes involved in the cell-mediated cytotoxic responses to MDV infection in the bursa of Fabricius at various time points representing the different phase of the MDV life cycle. Recent studies have demonstrated that granule-mediated cytolysis plays a crucial role in clearance of the virus in the context of many viral infections (Dobbs et al., 2005; Rauf et al., 2011). Granule-mediated cytolysis is undoubtedly the most important effector function of CD8+ T cells and NK cells (Lieberman, 2010). Although chicken NK cells have not been fully characterized, higher infiltration of CD8+ and CD4+ T cells has been detected in the bursa of MDV-infected chickens during the cytolytic and latent phase (Abdul-Careem et al., 2008). Moreover, the number of CD8+ T cells is significantly larger in the bursa of MDV-infected chickens than that in the controls during the latent phase (Abdul-Careem et al., 2008). CD8+ T cells have been hypothesized to have a role in clearing virally infected cells in the bursa, and partial CD4+ T cells may be involved in the cytotoxic responses against MDV in the bursa as well (Abdul-Careem et al., 2008). In this study, higher expression of GzmA and PFN mRNAs in the bursa of MDV-infected chickens was observed over time, especially strong at the latent phase, and the same results was also observed in the spleen of MDV-infected chickens (Sarson et al., 2008). While subsequent analysis using Western blotting revealed that bursal tissues from MDV-infected chickens contained higher GzmA but little or no stored PFN compared to the controls. PFN and GzmA, exclusively expressed by CTLs and NK cells, are two main lytic proteins in the granule secretory pathway, which is critical to induce apoptosis in virusinfected and transformed cells (Cullen and Martin, 2008), and PFN-deficient mice completely lack the ability to carry out granule-mediated apoptosis in response to viral infection and tumour antigens (Bolitho et al., 2007). Moreover, GzmA contribution to target cells apoptosis is critically dependent on PFN (Fan and Zhang, 2005). The bursas of MDV-infected chickens were found to be atrophied, especially at the latent phase in our study (data not shown), indicating that most MDV-infected B cells were significantly reduced or cleared from the bursa during the latent phase of MDV infection through other cell death pathways rather than granule-mediated cytolysis pathway. To further investigate the expression of the genes involved in the granule exocytosis pathway during MDV infection, we also

501

detected a list of genes associated with the activation of the SET complex using real-time RT-PCR. SET and HMG-2, two GzmA substrates, are cleaved during activation of the SET complex by GzmA, and no significantly increased expression was detected in the bursa probably due to little or no GzmA delivery into the cytosol and nucleus by PFN. On the contrary, there was a significant decrease in the expression of HMG-2 gene during the latent phase of MDV infection. Similarly, no differential expression of HMG-2 gene was also observed in the spleen of MDV infected chickens by Sarson et al. (2008). Ape1, a multifunctional component of the SET complex, having both endonuclease activity and the potential to repair oxidative damage to DNA and oxidative changes to transcription factors (Bennett et al., 1997; Evan et al., 2000; Fan et al., 2003), seemed to be cleaved during the cytolytic phase of MDV infection in our study. Previous studies have shown that GzmA specifically binds Ape1 and destroys its known oxidative repair function by proteolytic cleavage (Fan et al., 2003). Our data indicated that cleavage of Ape1 in targets in the bursa following CTLs attack during MDV infection, at least partially, occurs in the absence of GzmA. Furthermore, MDV infection did not result in differential expression of PARP gene, except for slight decrease at the latent phase. A lower expression of PARP during the latent phase of MDV infection has also been reported in the spleen tissue (Sarson et al., 2008). PARP activation results in expedited depletion of cellular energy reserves thereby facilitating the cell apoptosis, which occurs following the GzmA activation of the SET complex (Pinkoski and Green, 2003). In the present study, no PARP activation may be resulting from the SET complex not being activated by GzmA. The activation of SET complex in chicken cells should be investigated to understand host cytotoxic mechanisms mediated by PFN and GzmA during MDV infection. The findings presented in this study indicated that expression of cytotoxic effector proteins might be subject to stringent transcriptional and/or post-transcriptional control in the bursa during MDV infection. Previous studies in mice have supported that granzymes and PFN expression might be regulated at the post-transcriptional level (Fehniger et al., 2007; Chowdhury and Lieberman, 2008). However, regulation of granzyme and PFN expression has not been extensively studied in chicken cells. Additional studies will be required to assess the importance of the transcriptional and/or post-transcriptional regulation of cytotoxic effector proteins expression in the bursa during MDV infection. The Fas-mediated pathway is another well recognized mechanism of cell cytotoxicity which functions independently of PFN (Nagata and Golstein, 1995). Sparing expression of both FasL and Fas has been reported to contribute to the immune evasion of tumour cells (Curtin and Cotter, 2003). In our study, strong expression of FasL mRNA, but not of a corresponding differential protein, was observed throughout the experimental period, and higher Fas mRNA only occurred at 21 dpi. Little or no FasL and Fas expression might be explained as a prerequisite for the resistance to Fas-mediated apoptosis in MDV-infected or transformed cells. Decreased sensitivity to Fas-mediated apoptosis is a common trait shared by many tumour cells, which provides them with critical survival advantages, ultimately leading to malignant progression (Khong and Restifo, 2002; Chávez-Galán et al., 2009). Some studies have shown that the expression of Fas and FasL genes is regulated by a number of transcription factors, such as c-Jun, signal transducers and activators of transcription 1 and 3 (STAT1 and STAT3) (Xu et al., 1998; Ivanov et al., 2002). Whether Fas/FasL system is regulated at the transcriptional and/or post-transcriptional levels in the bursa during MDV infection remains to be elucidated by further research. Additionally, we observed that gene expression of NK lysin was up-regulated over time, especially during the latent phases of MDV infection. NK lysin is an anti-microbial and anti-tumour protein

502

C.-Y. Chen et al. / Research in Veterinary Science 94 (2013) 496–503

produced by both CTLs and NK cells (Hong et al., 2006). Previously, NK lysin has been observed to be enhanced in the early response of chicken lymphocytes to intestinal parasitic infection and during cytolysis of chicken tumour cell lines (Hong et al., 2006). Early induction activities of NK cells in chickens and chicken tumour cell lines following MDV infection have been recorded (Heller and Schat, 1987; Schat and Xing, 2000; Garcia-Camacho et al., 2003; Sarson et al., 2008). Up-regulated NK lysin might be attributed to NK cells which involved in mediating the cytotoxic response against MDV. In conclusion, the gene expression profiles observed in this study suggested less sustained cytotoxic responses generated in the bursa of Fabricius of MDV-infected chickens, since the granule exocytosis pathway and the Fas pathway were not effectively triggered by the activated effector cells. The cytotoxic responses to MDV observed in the bursa were characterized by the partially increased expression of GzmA, Fas, NK lysin and Ape1, but little or no expression of PFN, FasL and molecules involved in DNA repair and apoptosis. Further studies should shed more light on the function of these effectors and the mechanism of induction of the cytotoxic responses in the bursa of MDV- infected chickens.

Acknowledgements We thank Yu Zhou of Beijing Institute of Animal Husbandry and Veterinary Science for supplying the China standard J-1 strain of MDV1. This research was supported by the National Natural Science Foundation of China (Grant no. 31072152). C. Chen and Q. Xie conceived, designed this study, performed the experiments, carried out all statistical analysis and wrote the manuscript. Y. Xue participated in virus preparation and animal experiments. J. Ji and S. Chang supplied essential advice and critical reviews of this manuscript. Q. Xie, J. Ma and Y. Bi conducted the research. All authors read and approved the final manuscript. All authors have declared that no conflict of interest exists.

References Abdul-Careem, M.F., Hunter, B.D., Nagy, E., Read, L.R., Sanei, B., Spencer, J.L., Sharif, S., 2006. Development of a real-time PCR assay using SYBR green chemistry for monitoring Marek’s disease virus genome load in feather tips. Journal of Virology Methods 133, 34–40. Abdul-Careem, M.F., Hunter, B.D., Lee, L.F., Fairbrother, J.H., Haghighi, H.R., Read, L., Parvizi, P., 2008. Host responses in the bursa of Fabricius of chickens infected with virulent Marek’s disease virus. Virology 379, 256–265. Adams, S.C., Xing, Z., Li, J., Cardona, C.J., 2009. Immune-related gene expression in response to H11N9 low pathogenic avian influenza virus infection in chicken and Pekin duck peripheral blood mononuclear cells. Molecular Immunology 46, 1744–1749. Bennett, R.A.O., Wilson III, D.M., Wong, D., Demple, B., 1997. Interaction of human apurinic endonuclease and DNA poly merase beta in the base excision repair pathway. Proceedings of the National Academy of Sciences 94, 7166–7169. Beresford, P.J., Xia, Z., Greenberg, A.H., Lieberman, J., 1999. Granzyme A loading induces rapid cytolysis and a novel form of DNA damage independently of caspase activation. Immunity 10, 585–594. Beresford, P.J., Zhang, D., Oh, D.Y., Fan, Z., Greer, E.L., Russo, M.L., Jaju, M., Lieberman, J., 2001. Granzyme A activates an endoplasmic reticulum-associated caspaseindependent nuclease to induce single-stranded DNA nicks. The Journal of Biology Chemistry 276, 43285–43293. Bolitho, P., Voskoboink, L., Trapani, J.A., Smyth, M.J., 2007. Apoptosis induced by the lymphocyte effector molecule perforin. Current Opinion in Immunology 19, 339–347. Calnek, B.W., 2001. Pathogenesis of Marek’s disease virus infection. Current Topics in Microbiology and Immunology 255, 25–55. Chávez-Galán, L., Arenas-Del Angel, M.C., Zenteno, E., Chávez, R., Lascurain, R., 2009. Cell death mechanisms induced by cytotoxic lymphocytes. Molecular Immunology 6, 15–25. Chen, C.Y., Li, H.M., Xie, Q.M., Shang, H.Q., Ji, J., Bai, S.W., Cao, Y.C., Ma, Y.L., Bi, Y.Z., 2011. Transcriptional profiling of host gene expression in chicken liver tissues infected with oncogenic Marek’s disease virus. Journal of General Virology 92, 2724–2733. Chowdhury, D., Lieberman, J., 2008. Death by a thousand cuts: granzyme pathways of programmed cell death. Annual Review of Immunology 26, 389–420.

Cooper, M.D., Raymond, D.A., Peterson, R.D., South, M.A., Good, R.A., 1966. The functions of the thymus system and the bursa system in the chicken. The Journal of Experimental Medicine 123, 75–102. Cullen, S.P., Martin, S.J., 2008. Mechanisms of granule-dependent killing. Cell Death and Differentiation 15, 251–262. Curtin, J.F., Cotter, T.G., 2003. Live and let die: regulatory mechanisms in Fasmediated apoptosis. Cell Signaling 15, 983–992. Dobbs, M.E., Strasser, J.E., Chu, C.F., Chalk, C., Milligan, G.N., 2005. Clearance of herpes simplex virus type 2 by CD8+ T cells requires gamma interferon and either perforin- or Fas-mediated cytolytic mechanisms. Journal of Virology 79, 14546–14554. Evan, A.R., Limp-Foster, M., Kelly, M.R., 2000. Going APE over ref-1. Mutation Research 461, 83–108. Fan, Z., Beresford, P.J., Zhang, D., Xu, Z., Novina, C.D., Yoshida, A., Pommier, Y., Lieberman, J., 2003. Cleaving the oxidative repair protein Ape1 enhances cell death mediated by granzyme A. Nature Immunology 4, 145–153. Fan, Z., Zhang, Q., 2005. Molecular mechanisms of lymphocyte-mediated cytotoxicity. Cellular and Molecular Immunology 2, 259–264. Fehniger, T.A., Cai, S.F., Cao, X., Bredemeyer, A.J., Presti, R.M., French, A.R., Ley, T.J., 2007. Acquisition of murine NK cell cytotoxicity requires the translation of a pre-existing pool of granzyme B and perforin mRNAs. Immunity 26, 798–811. Garcia-Camacho, L., Schat, K.A., Brooks, R.J., Bounous, D.I., 2003. Early cell-mediated immune responses to Marek’s disease virus in two chicken lines with defined major histocompatibility complex antigens. Veterinary Immunology and Immunopathology 95, 145–153. Hassin, D., Garber, O.G., Meiraz, A., Berke, G., 2011. Cytotoxic T lymphocyte perforin and Fas ligand working in concert even when Fas ligand lytic action is still not detectable. Immunology 133, 190–196. Heller, E.D., Schat, K.A., 1987. Enhancement of natural killer cell activity by Marek’s disease vaccines. Avian Pathology 16, 51–60. Hong, Y.H., Lillehoj, H.S., Dalloul, R.A., Min, W., Miska, K.B., Tuo, W., Lee, S.H., Han, J.Y., Lillehoj, E.P., 2006. Molecular cloning and characterization of chicken NKlysin. Veterinary Immunology and Immunopathology 110, 339–347. Ivanov, V.N., Krasilnikov, M., Ronai, Z., 2002. Regulation of Fas expression by STAT3 and c-Jun is mediated by phosphatidylinositol 3-kinase-AKT signalling. The Journal of Biology Chemistry 277, 4932–4944. Kaufman, J., 2000. The simple chicken major histocompatibility complex: life and death in the face of pathogens and vaccines. Philosophical Transactions Royal Society London B 355, 1077–1084. Khong, H.T., Restifo, N.P., 2002. Natural selection of tumor variants in the generation of ‘tumor escape’ phenotypes. Nature Immunology 3, 999–1005. Li, J.H., Liu, C.J., Zhang, Y.P., Shi, W.S., Qu, P., Liu, A.L., Yan, F.H., 2008. Replication kinetics of Marek’s disease virus in chicken peripheral blood lymphocyte and feather tips. Chinese Journal of Preventive Veterinary Medicine 30, 879–884. Lieberman, J., 2010. Anatomy of a murder: how cytotoxic T cells and NK cells are activated, develop, and eliminate their targets. Immunological Reviews 235, 5– 9. Lieberman, J., Fan, Z., 2003. Nuclear war: the granzyme A-bomb. Current Opinion in Immunology 15, 553–559. Markowski-Grimsrud, C.J., Schat, K.A., 2002. Cytotoxic T lymphocyte responses to Marek’s disease herpesvirus-encoded glycoproteins. Veterinary Immunology and Immunopathology 90, 133–144. Nagata, S., Golstein, P., 1995. The Fas death factor. Science 267, 1449–1456. Nicholson, D.W., Thornberry, N.A., 1997. Caspases: killer proteases. Trends in Biochemical Sciences 22, 299–306. Omar, A.R., Schat, K.A., 1997. Characterization of Marek’s disease herpesvirusspecific cytotoxic T lymphocytes in chickens inoculated with a non-oncogenic vaccine strain of MDV. Immunology 90, 579–585. Pardo, J., Aguilo, J.I., Anel, A., Martin, P., Joeckel, L., Borner, C., Wallich, R., Müllbacher, A., Froelich, C.J., Simon, M.M., 2009. The biology of cytotoxic cell granule exocytosis pathway: granzymes have evolved to induce cell death and inflammation. Microbes and Infection 11, 452–459. Pinkoski, M.J., Green, D.R., 2003. Granzyme A: the road less traveled. Nature Immunology 4, 106–108. Rauf, A., Khatri, M., Murgia, M.V., Saif, Y.M., 2011. Expression of perforin-granzyme pathway genes in the bursa of infectious bursal disease virus-infected chickens. Developmental and Comparative Immunology 35, 620–627. Ross, N.L., 1999. T cell transformation by Marek’s disease virus. Trends in Microbiology 7, 22–29. Russell, J.H., Ley, T.J., 2002. Lymphocyte-mediated cytotoxicity. Annual Review of Immunology 20, 323–370. Sarson, A.J., Abdul-Careen, M.F., Zhou, H., Sharif, S., 2006. Transcriptional analysis of host responses to Marek’s disease viral infection. Viral Immunology 19, 747– 758. Sarson, A.J., Abdul-Careem, M.F., Read, L.R., Brisbin, J.T., Sharif, S., 2008. Expression of cytotoxicity-associated genes in Marek’s disease virus-infected chickens. Viral Immunology 21, 267–272. Schat, K.A., Calnek, B.W., Fabricant, J., 1980. Influence of the bursa of Fabricius on the pathogenesis of Marek’s disease. Infection and Immunity 31, 199–207. Schat, K.A., 1996. Immunity to Marek’s disease, lymphoid leukosis and reticuloendotheliosis. In: Davison, F., Payne, L.N., Morris, T.R. (Eds.), Poultry Immunology. Carfax Publishing Company, Abingdon, UK, pp. 209– 233.

C.-Y. Chen et al. / Research in Veterinary Science 94 (2013) 496–503 Schat, K.A., Xing, Z., 2000. Specific and nonspecific immune responses to Marek’s disease virus. Developmental and Comparative Immunology 24, 201–221. Schat, K.A., Markowski-Grimsrud, C.J., 2001. Immune responses to Marek’s disease virus. Current Topics in Microbiology and Immunology 225, 91–120. Sharma, J.M., 1981. Natural killer cell activity in chickens exposed to Marek’s disease virus: inhibition of activity in susceptible chickens and enhancement of activity in resistant and vaccinated chickens. Avian Disease 25, 882–893. Tian, M.X., Zhao, Y., Lin, Y., Zou, N.L., Liu, C., Liu, P., Cao, S.J., Wen, X.T., Huang, Y., 2011. Comparative analysis of oncogenic genes revealed unique evolutionary features of field Marek’s disease virus prevalent in recent years in China. Virology Journal 8, 121–131. Trapani, J.A., Smyth, M.J., 2002. Functional significance of the perforin/granzyme cell death pathway. Nature Reviews Immunology 2, 735–747.

503

Venugopal, K., 2000. Marek’s disease: an update on oncogenic mechanisms and control. Research in Veterinary Science 69, 17–23. Wang, X., Rosa, A.J., Oliverira, H.N., Rosa, G.J., Guo, X., Travnicek, M., Girshick, T., 2006. Transcriptome of local innate and adaptive immunity during early phase of infectious bronchitis viral infection. Viral Immunology 19, 768–774. Xu, S., Xue, C.Y., Li, J.P., Bi, Y.Z., Cao, Y.C., 2011. Marek’s disease virus type 1 MicroRNA miR-M3 suppresses cisplatin-induced apoptosis by targeting SMAD2 of the transforming growth factor beta signal pathway. Journal of virology 85, 276–285. Xu, X., Fu, X.Y., Plate, J., Chong, A.S.F., 1998. IFN-c induces cell growth inhibition by Fas-mediated apoptosis: requirement of STAT1 protein for up-regulation of Fas and FasL expression. Cancer Research 58, 2832–2837.