- Email: [email protected]
Characterization of DNA binding and ligand binding properties of the TetR family protein involved in regulation of dsz operon in Gordonia sp. IITR100
International Journal of Biological Macromolecules 141 (2019) 671–679
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: http://www.elsevier.com/locate/ijbiomac
Characterization of DNA binding and ligand binding properties of the TetR family protein involved in regulation of dsz operon in Gordonia sp. IITR100 Pooja Murarka, Preeti Srivastava ⁎ Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology Delhi, Hauz Khas, New Delhi 110016, India
a r t i c l e
i n f o
Article history: Received 27 June 2019 Received in revised form 13 August 2019 Accepted 3 September 2019 Available online 04 September 2019 Keywords: TetR family protein Desulfurization Ligand binding Fluorescence spectroscopy Circular dichroism
a b s t r a c t Gordonia sp. IITR100 is a biodesulfurizing bacterium which can metabolize dibenzothiophene (DBT) to 2 hydroxybiphenyl in four steps via the 4S pathway. The genes involved in the metabolism are present in the form of an operon, dszABC, which gets activated by a TetR family protein. Here, we report the detailed characterization of the DNA binding and ligand binding property of the TetR family protein. The protein was found to be conserved across other desulfurizing organisms. The protein was purified and was found to exist as dimer. The presence of ligand binding site was identified by docking studies and the structural changes in the protein upon ligand binding were determined by CD spectroscopy and tryptophan fluorescence. Further, it was determined that this protein binds to an imperfect palindromic DNA sequence present in the dsz promoter DNA. Binding to the DNA also changes conformation of the protein. © 2019 Elsevier B.V. All rights reserved.
1. Introduction Gordonia sp. IITR100 is a Gram-positive, aerobic, non-sporulating, high GC bacterium belonging to class Actinobacteria. It can desulfurize various sulfur containing aliphatic and aromatic organic compounds [1]. The bacterium follows the 4S pathway for desulfurization in which the carbon skeleton of organosulfur is intact therefore, the calorific value of fuel is maintained. The genes for desulfurization are present in the form of an operon, the dsz operon, under the control of a promoter. The dsz promoter is repressed in presence of inorganic sulfur and is active when the cells are grown in presence of organosulfurs as the sole sulfur source [2]. Recently, a TetR family protein was reported to regulate the operon. It is reported that the protein activates the operon when supplied in trans at sub optimal concentrations and the region of activation lies in the first 80 bp of the 385 bp promoter region [2]. TetR family proteins are involved in the regulation of various genes of catabolic pathways, co-factor metabolism, lipid metabolism, amino acid metabolism, nitrogen metabolism, carbon metabolism, cell signalling, osmotic stress and many more [3] [4]. Initially the members of the TetR family regulators were known as repressors, however several studies report that they may also serve as activators or may have dual function [4]. All the members of this family of protein have a helix turn helix domain through which they bind to the DNA [3,4]. ⁎ Corresponding author. E-mail address: [email protected] (P. Srivastava).
https://doi.org/10.1016/j.ijbiomac.2019.09.009 0141-8130/© 2019 Elsevier B.V. All rights reserved.
Here, we report the characterization of a TetR family protein (WP_010840674.1, Genbank ID: MVKV01000005.1 (c5313-4669)) from Gordonia sp. IITR100 which serves as an activator of the dsz operon. 2. Materials and methods 2.1. Growth media and conditions For cloning, expression and purification studies E. coli containing plasmid pPM1 was grown in LB medium containing kanamycin 50 μg/ ml at 37 °C and 180 rpm. The list of primers used in the study is given in Table 1. 2.2. Purification of the TetR family protein For purification of the TetR family protein in native conditions, immobilized metal affinity chromatography (IMAC) was used. For this, induced 500 ml of the BL21 (DE3) pLysS cells containing plasmid pPM1 (the gene for the TetR family protein cloned in pET29a vector between the sites HindIII and NdeI) were harvested, resuspended in 4 ml sonication buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride and 10 mM imidazole, pH 8), sonicated and the supernatant was collected after centrifugation at 12,000 rpm for 30 min. The NiNTA resins were pre-equilibrated with the sonication buffer (5 column volume). The lysate was incubated overnight with the pre-equilibrated Ni-NTA resins. The flow through was collected in a fresh falcon tube. Further the resins were washed with 2 column volumes of sonication
672
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
Table 1 List of primers used in the study (restriction sites italicized). Primer name
Resulted Sequence (5′ → 3′) fragment
PS-18 PS-19 Cy5 PS-19
Pdsz F Pdsz R Pdsz R
Motif
22 bp oligo 22 bp oligo 20 bp oligo 20 bp oligo 32 bp 32 bp
Motif comp Kan motif Kan motif comp Motif 2 Motif 2 comp
GAGCAGATCTGGCCATGATCGACCGCCTCGTCCATCACGC CAGTCATATGCGCGTATGTGTCCTCTAACCGTAAATAGCG Cy5-CAGTCATATGCGCGTATGTGTCCTCTAACCGTAAAT AGCG AGGAGACAGCTACCGACTCAAG Cy5-TCCTCTGTCGATGGCTGAGTTC GAACAATAAAACTGTCTGCT Cy5-CTTGTTATTTTGACAGACGA AGGAGACAGCTACCGACTCAAGAACCGAGA Cy5-TCCTCTGTCGATGGCTGAGTTCTTGGCTCT
buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride and 10 mM imidazole, pH 8) to remove the weakly bound proteins. The bound proteins were eluted with elution buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride and 100–300 mM imidazole, pH 8). The different elution fractions were run on a 12% SDS polyacrylamide gel. The aliquot containing the single band was dialyzed against buffer (20 mM Tris buffer, 150 mM NaCl and 10% glycerol, pH 8). The concentration of the pure protein was determined by Bradford assay. 2.3. Glutaraldehyde cross linking Glutaraldehyde cross linking was performed to determine the multimeric forms of the protein [5]. Glutaraldehyde (final concentration 0.1%) was added to 0.2 mg/ml of pure protein in a total reaction volume of 100 μl followed by incubation at 25 °C. An aliquot of 15 μl was collected at every 15 min interval and 5 μl of 1 M Tris-HCl buffer, pH 7.4 was added to stop the activity of glutaraldehyde. The samples were further run on 12% SDS polyacrylamide gel to check the multimeric form of the protein. 2.4. Pure protein on native gel An aliquot of the pure protein (20 μg) was mixed with 5 μl of TBE loading dye. It was run on 6% native TBE gel for 2 h at 100 V in cold conditions. Running buffer used was 0.25× TBE. The protein was visualized after staining the gel with coomassie brilliant blue R250 stain. 2.5. Size exclusion chromatography The oligomeric state of native TetR family protein was further confirmed through size-exclusion chromatography. For this purpose, 500 μl of 0.25 mg/ml protein was loaded on a Superdex 200 10/300 column fitted to an AKTA explorer FPLC system (GE Healthcare, Uppsala, Sweden). For comparison, two globular protein standards, bovine carbonic anhydrase II (29 kDa), bovine serum albumin (66 kDa) were also analyzed in a similar way. The void volume of the column was determined using dextran 2000. Prior to sample analysis, the column was equilibrated with 3 column volumes of protein buffer (20 mM Tris, 150 mM NaCl; pH 8). The flow rate of elution was 0.5 ml min−1. The data were acquired and analyzed using UNICORN software. 2.6. Fluorescence spectroscopy To determine the changes in the tertiary structure of the protein upon DNA binding, fluorescence spectroscopy was performed [6] in LS
55 spectrofluorimeter (Perkin Elmer, USA). The analysis is based on the intrinsic tryptophan fluorescence of the protein. The excitation wavelength was 295 nm. The spectrum was obtained over a wavelength range of 310 to 450 nm. The excitation and emission slits were 5 and 10 nm and path length of the cuvette was 10 mm. The protein (4 ∗ 10−3 μM) and dsz promoter (0.042 ∗ 10−6 μM) was incubated in ice for 2 h before the spectroscopic analysis. For all the spectra, the buffer background was subtracted. The change in the tertiary structure of the protein was monitored in presence of ligands: sodium sulfate and DBT. For this the protein (4 ∗ 10−3 μM) was incubated with sodium sulfate (3 mM) and DBT (0.1 mM) separately for 2 h in ice. The spectroscopic analysis was performed as done above. To monitor the change, a spectroscopic scan of only protein (4 ∗ 10 −3 μM) was performed as a control. 2.7. CD spectroscopy To determine the changes in the secondary structure of the protein upon DNA binding, circular dichroism was performed [7] in a circular dichroism spectropolarimeter (Jasco J-815, USA). The conformational change was monitored in the region between 190 and 250 nm in a quartz cuvette with a path length of 1 mm. The protein (4 ∗ 10−3 μM) and dsz promoter (10 ng) was incubated in ice for 2 h before the spectroscopic analysis. The scanning band width, speed and data pitch were 1 nm, 50 nm/min and 1 nm, respectively. The average of two accumulations with five scans each was considered (within 600 HT voltage range). Similarly, the change in the secondary structure of the protein was monitored in presence of ligands: sodium sulfate and DBT. For this the protein (4 ∗ 10−3 μM) was incubated with sodium sulfate (3 mM) and DBT (0.1 mM) separately for 2 h in ice. The spectroscopic analysis was performed as described above. For samples containing DBT, they were centrifuged at 12,000 for 5 min and the supernatant was collected. This was done to avoid turbidity in the samples. 2.8. Dynamic light scattering The hydrodynamic radius of the protein and the change in the particle size on binding to DNA was measured by dynamic light scattering (DLS) [8]. The above experiment was performed on a Wyatt quasielastic light scattering system (Wyatt Technology Corp., Santa Barbara, CA) with inbuilt Astra software. Protein sample (0.25 mg/ml) was taken in a quartz cuvette and the diffusion coefficient (DT) was determined. The protein was filtered through 0.22 μm syringe filter before data acquisition. To monitor the change in the presence of DNA, the protein and dsz promoter (10 ng) was incubated in ice for 2 h before the spectroscopic analysis. Hydrodynamic radius (Rh) was calculated from values of DT using Stokes-Einstein equation, Rh ¼ kb T=6πηDT where kb is Boltzmann's constant, T is temperature and η is solvent viscosity as described by Hoffmann et al. [9]. 2.9. EMSA with TetR family protein For EMSA with the TetR family protein, about 12 ng of the Cy5 labelled promoter (amplified from genomic DNA of Gordonia sp. IITR100 using primers PS18 and Cy5 PS19) was incubated with different concentrations (5–40 μg) of pure protein in presence of binding buffer (20 mM Tris, 10% glycerol and 150 mM NaCl, pH 7.5), poly d(I-C) and poly L-lysine. This complex was incubated for 4 h at 4 °C and was then run on 6% native TBE gel for 2 h at 100 V in cold conditions. Running buffer used was 0.25× TBE. The gel was then scanned in a fluorimager to observe
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
the shift. Induced and uninduced crude cell extract of recombinant E. coli containing the plasmid pPM1 was also used to determine the binding of protein to the promoter.
673
For EMSA with the motifs, the two complementary oligos (set 1: annealed motif and motif comp, set 2: annealed motif 2 and motif 2 comp) (Table 1) were annealed by mixing both the oligos in equal
Fig. 1. A) 3D structure of TetR family protein containing HTH domain. The red portion in the structure indicates the DNA binding region of the protein. The N and C terminal are marked B). Multiple sequence alignment of the protein in 6 different desulfurizing bacteria showing ~14% identity. The DNA binding region is marked in red box.
674
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
concentration (5 μM) followed by heating the mixture at 95 °C for 2 min and cooling it slowly to 25 °C over a period of 45 min in a thermocycler. This stock of 5 μM double stranded oligo was diluted and used for EMSA to give a final concentration of 12 ng. As a control
a non-specific kanamycin promoter motif (kan and kan comp) were annealed and used. Other steps of the protocol were same as above except the running time was reduced to 45 min as the length of the motifs is smaller.
A
C Terminal
N Terminal N Terminal
B
C Terminal
C
D
Fig. 2. (A) Chemical structure of the ligands under study: sulfate and DBT. (B) Docking of the protein to sulfate ion and DBT with ΔG of −10.11 kJ/mol and − 6.4 kJ/mol respectively. (C) Binding of the protein to sodium sulfate. The intrinsic fluorescence quenching of the protein was used to monitor its tertiary structural change in the protein and the change in the secondary structure was monitored by circular spectroscopy. (D) Structural change in the protein as monitored by fluorescence and circular dichroism spectroscopic method.
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
2.10. Bioinformatics analysis The 3-dimensional structure of the TetR family protein was elucidated computationally using PyMOL software (https://pymol.org/ edu/?q=educational/) based on similarity (63%) with protein Rv3557c, PDB ID: 4W1U (HTH type transcriptional repressor of Rhodococcus erythropolis. Multiple sequence alignment of this protein was done with other desulfurizing bacteria using CLUSTAL omega (https://www.ebi.ac.uk/ Tools/msa/clustalo/). The probable protein binding sites and the palindromic region in the dsz promoter were determined by the software meme suite (http://meme-suite.org/). The change in the secondary structure of the protein was analyzed by K2D2 software [10] (http:// cbdm-01.zdv.uni-mainz.de/~andrade/k2d2/). The docking studies of the protein to different ligands were performed using swissdock software (http://www.swissdock.ch/). 3. Results and discussion TetR family is the third most abundant family of regulators reported in bacteria [11]. While 102 TetR family regulators are present in Gordonia sp. IITR100 [12], none of them are characterized. One of the TetR family proteins (Genbank ID: MVKV01000005.1 (c5313-4669) was found to activate the dsz operon. Here, we describe the DNA binding and the ligand binding potential of the protein.
675
obtained in the gel confirmed that the purified protein is the TetR family protein (Fig. S1B). On spectroscopic analysis, a decrease in fluorescence intensity was found when the protein is incubated with sodium sulfate which suggests a change in the tertiary structure of the protein upon binding to sodium sulfate. Similarly, a change in the secondary structure of the protein was observed in presence of sodium sulfate (Fig. 2C). A decrease in fluorescence yield was observed with the increase in concentration of sodium sulfate. This suggests that there may be a ligand binding site in the protein where the sodium sulfate binds and quenches the fluorescence. This finding is in accordance with the property of the TetR family proteins. The TetR family proteins have been reported to contain a ligand binding site at their C-terminal which provides diversity to different members of this family [3]. Fluorescence spectroscopy has been used to study the ligand binding property of several TetR family proteins. A decrease in fluorescence yield has been reported for the TetR family protein, TtgR, in presence of its ligand phloretin [14]. Binding of Fad35R to its ligand tetracycline and activated fatty acid is also reported by intrinsic fluorescence spectrometry. A decrease in fluorescence intensity was observed with increase in concentration of tetracycline [15]. Similar observations are reported for ActR protein in presence of actinorhodin [16], QacR in presence of rhodamine [17], DesT binding to acyl-CoA [18] and FadR in presence of activated fatty acids [15]. However, very little or no structural change was found in the protein in presence of DBT (Fig. 2D).
3.1. The TetR family protein is conserved in other desulfurizing bacteria A 3D structure of this protein was generated using PyMOL software (Fig. 1A). The structure was based on the known structure of the HTH type transcription repressor in Rhodococcus sp. (Uniprot ID Q0S7V2) [13] with which the protein has 63% similarity. According to the structure obtained, the protein has 9 α-helices out of which 3 (marked in red) are involved in DNA binding. Multiple sequence alignment of the TetR family protein was performed using bioinformatics tools and is shown in Fig. 1B. The regions which are conserved are marked in red whereas as amino acids which are similar in their property are marked in green, the amino acids which show little similarity are shown in blue and the dissimilar amino acids are marked in black. Interestingly, in accordance with other members of the TetR family protein, this protein was also found to be more conserved in its DNA binding region (marked in red box in the figure) whereas little similarity was observed in its Cterminal region [3].
A
3.2. The TetR family protein contains a ligand binding site The TetR family of proteins is known to have a ligand binding site [3]. To determine whether it is true for the protein under study, docking studies were performed using swissdock software for the protein and different ligands: sodium sulfate and DBT (Fig. 2A). The Gibbs free energy (ΔG value) for binding of the protein to DBT was found to be −6.462 kJ/mol and that for sodium sulfate was −10.11 kJ/mol respectively, suggesting that the protein has a higher affinity towards sulfate when compared to that of DBT (Fig. 2B). To study the structural changes in the protein upon ligand binding, spectroscopic analysis was performed with pure protein. The TetR family protein was purified using Immobilized metal affinity chromatography. Expression analysis was carried out using E. coli BL21 (DE3) pLysS harbouring the plasmid pPM1. The solubility of the protein was determined at different time intervals after induction. The samples (100 ml each) were collected after 3 h, 5 h, 7 h and overnight of induction and sonicated. It was found that the maximum amount of the soluble protein was found after 5 h of induction. Therefore, the induction time was optimized to 5 h for purification. The purity of the protein was checked by running the purified sample on a 12% SDS polyacrylamide gel (Fig. S1A). MALDI-ToF analysis of the purified band
B
Fig. 3. Structural change in the protein on binding to the dsz promoter (A) A decrease in the ellipticity of the protein in presence of the DNA thus indicating a change in secondary structure of the protein on DNA binding (B) An increase of the tryptophan fluorescence of the protein in presence of the DNA thus indicating a change in tertiary structure of the protein upon DNA.
676
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
3.3. DNA binding changes the structure of the TetR family protein The TetR family of proteins is reported to have a helix turn helix domain through which they bind to the DNA. The helical structure of the protein was confirmed by circular dichroism. Negative bands at 208 nm, 222 nm and a positive band at 193 nm confirm the helical structure of the protein (Fig. 3A) [19]. The binding of the protein to
A
C
the DNA induces a structural change in the protein. It was demonstrated by circular dichroism and intrinsic fluorescence spectroscopy. In presence of promoter DNA, the negative bands at 208 nm and 222 nm of the protein become deeper suggesting that the protein gains secondary structure. K2D2 software analysis of the values obtained revealed that α helical content of the protein increased to 67.45% + 0.1 from the original 61.33% + 0.1 in presence of promoter DNA.
B
Bovine Carbonic Anhydrase II (29 kDa) Bovine Serum Albumin (66 kDa) TetR family Protein
D
Fig. 4. The TetR family protein exists as a dimer. (A) A 12% SDS polyacrylamide gel of the protein cross linked with glutaraldehyde. Lane 1: protein marker, lane 2: Control sample (protein without glutaraldehyde), lane 3–9: protein incubated with glutaraldehyde for 5, 15, 30, 45, 60, 75 and 90 min respectively. (B) Purified protein run on native gel. Lane 1: native protein marker, lane 2: purified protein band above 50 kDa protein. (C) Size-exclusion chromatography: SEC of the TetR family protein was carried out to infer its stoichiometry. Globular standards of different molecular weights; BSA (66 kDa) and bovine carbonic anhydrase II (29 kDa) were simultaneously analyzed. (D) An increase in size of the protein in presence of DNA suggesting that more than one protein binds to the dsz promoter as determined by dynamic light scattering.
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
A similar observation was reported by Hoffmann et al. (2005) where a change in the random coil of the MtrR protein on binding to the DNA was monitored by CD spectroscopy. Similarly, an increase in the helical
1
2 3
4
677
content of the QacR protein is reported upon DNA binding. Similarly, an increase in the helical content of the QacR protein is reported upon DNA binding [10]. Change of secondary structure on DNA binding is also
5 6
7
8
9 10
A
B
1 2 3
4 5
6
7 8
9
C
D
Fig. 5. (A) EMSA showing protein bound to Cy5 labelled dsz promoter (385 bp). Lane 1: Cy5 labelled dsz + crude extract of E. coli containing uninduced TetR family protein (5 μg), lane 2: Cy5 labelled dsz + crude extract of E. coli containing uninduced TetR family protein (40 μg), lane 3: Cy5 labelled dsz + crude extract of E. coli containing induced TetR family protein (5 μg), lane 4: control (only labelled DNA), lane 5–9: Cy5 labelled dsz + purified TetR family protein (5, 10, 20, 30 and 40 μg respectively), lane 10: Cy5 labelled dsz + crude extract of E. coli containing induced TetR family protein (40 μg). (B) Logo representing the sequences similar to the motif as obtained by MEME software. (C) A 6% TBE native gel showing protein bound to Cy5 labelled motif of the promoter (dsz motif (lane 1–3), kan motif (lane 4–6) and 32 bp motif respectively (lane 7–9)). Lane 1, 4, 7: Free labelled DNA (12 ng), lane 2, 5, 8: DNA (12 ng) + protein (10 μg protein), lane 3, 6, 9: DNA (12 ng) + protein (20 μg protein). (D) Location of different motifs similar to that of motif used for EMSA. The similar nucleotides are underlined.
678
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
studied for other members of the TetR family proteins such as the Tet repressor [20] and HylIIR [21]. Change in the tertiary structure was monitored by intrinsic fluorescence spectroscopy. An increase in fluorescence yield of the protein was observed in presence of the protein (Fig. 3B). It is reported that the intrinsic fluorescence yield can increase or decrease when bound to DNA [22]. Here an increase in fluorescence suggests that the tryptophan residues in the protein get a more hydrophobic environment upon DNA binding thereby increasing the fluorescence yield. Structural change upon DNA binding has also been studied for several members of the TetR family proteins such as QacR, the Tet repressor, SimR, AmtR, SlmA and KstR [14,23]. 3.4. The TetR family protein exists as dimer To determine the multimeric form of the above purified protein, glutaraldehyde cross linking was performed. SDS PAGE analysis shows an increase in intensity of protein band at around 50 kDa (Fig. 4A). Since the molecular weight of the monomeric form of protein is 25 kDa, an intense band at around 50 kDa suggests that the protein exists as a dimer. A single band around the 50 kDa molecular marker band in a native gel (Fig. 4B) further confirms the dimeric form of the protein, which is in agreement with other members of this family. The TetR family protein was analyzed by size-exclusion chromatography along with two globular standards of different molecular weight. The elution profile of the TetR family protein was in the form of a sharp single peak chromatogram, with elution volume corresponding to 15.9 ml. The globular standards BSA (66 kDa) and carbonic anhydrase (29 kDa) eluted corresponding to 15.2 and 17.7 ml, respectively. A minor peak preceding to the major peak could be due to preformed oligomers. The monomeric TetR family protein being a 25 kDa protein, was expected to elute at volume larger than carbonic anhydrase. Its elution profile however, can be justified with its dimeric stoichiometry which is corresponding to ~50 kDa (Fig. 4C). The TetR family of proteins is reported to exist predominantly as dimers. Several members of the TetR family proteins such as MexZ of Pseudomonas aeruginosa [24], QacR of Staphylococcus aureus [25] and MsfR of Pseudomonas knackmussi [26] protein were found to exist as dimers. 3.5. More than one protein binds to the dsz promoter Dynamic light scattering (DLS) experiment was performed with the protein in presence and absence of the promoter DNA. The hydrodynamic radius of the protein was found to be 5.35 ± 0.15 nm in absence of DNA whereas the size was 10.75 ± 0.25 nm in presence of DNA (Fig. 4D). As the hydrodynamic radius of the protein is almost doubled in presence of the promoter DNA, it can be said that more than one protein binds to the DNA. DLS has also been performed with the members of the TetR family protein. Studies show that the members of this family of regulators usually bind to their DNA as dimers or as dimer of dimers [3]. For instance, DLS studies show that two dimers of MtrR and the QacR protein binds to their respective DNA. The TetR repressor protein bind as a single dimer to its DNA and the EthR regulator binds as four dimers to its respective DNA [9,15]. 3.6. The TetR family protein binds to the promoter The above experiments show that the TetR family protein binds to the promoter. This was further validated by EMSA. Cy5 labelled dsz promoter was incubated with increasing concentrations of the purified protein and run on 6% native gel. A clear shift was observed in the lane containing protein. As the protein concentration increased, a super shift was observed and the concentration of the free DNA reduced (Fig. 5A). Further, two retarded bands were observed in case of uninduced crude cell extract containing the plasmid pPM1 whereas in
case of induced cell extract, the shift was more prominent with no free DNA left (Fig. 5A). This suggests that the TetR protein possibly interacts with other proteins/cofactors for strong binding to the dsz promoter. Although the concentrations required to give shift were different for crude extract and pure protein, the difference can be explained by the fact that full length promoter was used in the shift and the crude extract contains several DNA binding proteins which were identified in the pull-down assay as well. The protein binding site in the promoter was determined by MEME software (Fig. 5B). A clear shift was observed when EMSA was performed with a cy5 labelled motif (annealed motif and motif comp) determined by the software. As control, a Cy5 labelled dissimilar motif from the kanamycin promoter (annealed kan and kan comp) was used where no shift was observed (Fig. 5C). A major significance is that the motif lies in the first 80 bp of the promoter (52–73 bp) which corresponds to the region of activation [2]. Also, motif like sequence is present at multiple places throughout the promoter (58–67 bp (S1), 70–79 bp (S2), 108–117 bp (S3) and 126–135 bp (S4) (Fig. 5D). The alignment of the different regions similar to that of motif shows N50% similarity and is given in Fig. 5D (underlined). The motif and its similar sequence are represented in the logo. To further validate the binding site of the protein, EMSA was performed with purified protein and a 32 bp motif (annealed motif 2 and motif 2 comp) containing two binding sites (58–67 bp (S1), 70–79 bp (S2)). A shift was observed with dsz promoter motif containing two protein binding sites (Fig. 5C). According to the MEME software and EMSA, it was found that the protein binds to an imperfect palindromic region present at several places in the promoter. Interestingly, the TetR family proteins are reported to bind to perfect/imperfect palindromic sequences or inverted repeats. These include proteins PA2196 from Pseudomonas aeruginosa, Ms6564 from Mycobacterium smegmatis, AcrR of E. coli, Cmer of Campylobacter jejuni, PigZ of Serratia sp. and QacR of Staphylococcus aureus [27]. In fact, reports suggest that there are variations in the length of the binding sites of the TetR family protein and also in the number of palindromic nucleotides in a particular sequence. This is the first report on the characterization of the regulator of the dsz operon. The protein belongs to the TetR transcription regulator family and was found to have several properties in accordance to the other members of the TetR family proteins. Here, we provide experimental evidences for the same. Supplementary data to this article can be found online at https://doi. org/10.1016/j.ijbiomac.2019.09.009. Acknowledgements The work was supported by DBT-Innovative Young Biotechnologist Award (IYBA grant) to Preeti Srivastava. Pooja Murarka thanks CSIR for providing fellowship. Declaration of competing interest The authors declare no conflict of interest. References [1] J. Adlakha, P. Singh, S.K. Ram, M. Kumar, M. Singh, D. Singh, V. Sahai, P. Srivastava, Optimization of conditions for deep desulfurization of heavy crude oil and hydrodesulfurized diesel by Gordonia sp. IITR100, Fuel 184 (2016) 761–769. [2] P. Murarka, T. Bagga, P. Singh, S. Rangra, P. Srivastava, Isolation and identification of a TetR family protein that regulates the biodesulfurization operon, AMB Express 9 (1) (2019) 71. [3] J.L. Ramos, M. Martínez-Bueno, A.J. Molina-Henares, W. Terán, K. Watanabe, X. Zhang, M.T. Gallegos, R. Brennan, R. Tobes, The TetR family of transcriptional repressors, Microbiol. Mol. Biol. Rev. 69 (2) (2005) 326–356. [4] L. Cuthbertson, J.R. Nodwell, The TetR family of regulators, Microbiol. Mol. Biol. Rev. 77 (3) (2013) 440–475. [5] D.K. Simanshu, H.S. Savithri, M.R. Murthy, Crystal structures of Salmonella typhimurium biodegradative threonine deaminase and its complex with CMP
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
[6]
[7]
[8]
[9]
[10]
[11]
[12] [13]
[14]
[15]
provide structural insights into ligand-induced oligomerization and enzyme activation, J. Biol. Chem. 281 (51) (2006) 39630–39641. D. Tippner, R. Wagner, Fluorescence analysis of the Escherichia coli transcription regulator H-NS reveals two distinguishable complexes dependent on binding to specific or nonspecific DNA sites, J. Biol. Chem. 270 (38) (1995) 22243–22247. A. Micsonai, F. Wien, L. Kernya, Y.-H. Lee, Y. Goto, M. Réfrégiers, J. Kardos, Accurate secondary structure prediction and fold recognition for circular dichroism spectroscopy, Proc. Natl. Acad. Sci. (2015) 201500851. D. Arosio, S. Cui, C. Ortega, M. Chovanec, S. Di Marco, G. Baldini, A. Falaschi, A. Vindigni, Studies on the mode of Ku interaction with DNA, J. Biol. Chem. 277 (12) (2002) 9741–9748. K.M. Hoffmann, D. Williams, W.M. Shafer, R.G. Brennan, Characterization of the multiple transferable resistance repressor, MtrR, from Neisseria gonorrhoeae, J. Bacteriol. 187 (14) (2005) 5008–5012. M.A. Schumacher, M.C. Miller, S. Grkovic, M.H. Brown, R.A. Skurray, R.G. Brennan, Structural basis for cooperative DNA binding by two dimers of the multidrug‐binding protein QacR, EMBO J 21 (5) (2002) 1210–1218. E.P. Rueda, R.H. Guerrero, M.A.M. Nuñez, D.A. Medina, I. Sanchez, J.A. Ibarra, Abundance, diversity and domain architecture variability in prokaryotic DNA-binding transcription factors, PloS One 13 (4) (2018), e0195332. J. Jaishankar, P. Singh, P. Srivastava, Draft genome sequence of a biodesulfurizing bacterium, Gordonia sp. strain IITR100, Genome Announc. 5 (17) (2017) e00230-17. M.P. McLeod, R.L. Warren, W.W. Hsiao, N. Araki, M. Myhre, C. Fernandes, D. Miyazawa, W. Wong, A.L. Lillquist, D. Wang, The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse, Proc. Natl. Acad. Sci. 103 (42) (2006) 15582–15587. Z. Yu, S.E. Reichheld, A. Savchenko, J. Parkinson, A.R. Davidson, A comprehensive analysis of structural and sequence conservation in the TetR family transcriptional regulators, J. Mol. Biol. 400 (4) (2010) 847–864. S. Anand, V. Singh, A.K. Singh, M. Mittal, M. Datt, B. Subramani, S. Kumaran, Equilibrium binding and kinetic characterization of putative tetracycline repressor family transcription regulator Fad35R from Mycobacterium tuberculosis, FEBS J. 279 (17) (2012) 3214–3228.
679
[16] K. Tahlan, Z. Yu, Y. Xu, A.R. Davidson, J.R. Nodwell, Ligand recognition by ActR, a TetR-like regulator of actinorhodin export, J. Mol. Biol. 383 (4) (2008) 753–761. [17] S. Grkovic, K.M. Hardie, M.H. Brown, R.A. Skurray, Interactions of the QacR multidrug-binding protein with structurally diverse ligands: implications for the evolution of the binding pocket, Biochemistry 42 (51) (2003) 15226–15236. [18] Y.M. Zhang, K. Zhu, M.W. Frank, C.O. Rock, A Pseudomonas aeruginosa transcription factor that senses fatty acid structure, Mol. Microbiol. 66 (3) (2007) 622–632. [19] N.J. Greenfield, Using circular dichroism spectra to estimate protein secondary structure, Nat. Protoc. 1 (6) (2006) 2876. [20] L. Atschmied, W. Hillen, Tet repressor tet operator complex formation induces conformational changes in the tet operator DNA, Nucleic Acids Res. 12 (4) (1984) 2171–2180. [21] E.A. Rodikova, O.V. Kovalevskiy, S.G. Mayorov, Z.I. Budarina, V.V. Marchenkov, B.S. Melnik, A.P. Leech, D.V. Nikitin, M.G. Shlyapnikov, A.S. Solonin, Two HlyIIR dimers bind to a long perfect inverted repeat in the operator of the hemolysin II gene from Bacillus cereus, FEBS Lett. 581 (6) (2007) 1190–1196. [22] R. Favicchio, A.I. Dragan, G.G. Kneale, C.M. Read, Fluorescence spectroscopy and anisotropy in the analysis of DNA-protein interactions, DNA-Protein Interactions, Springer 2009, pp. 589–611. [23] S. Ray, A. Maitra, A. Biswas, S. Panjikar, J. Mondal, R. Anand, Functional insights into the mode of DNA and ligand binding of the TetR family regulator TylP from Streptomyces fradiae, J. Biol. Chem. 292 (37) (2017) 15301–15311 (M117. 788000). [24] Y. Matsuo, S. Eda, N. Gotoh, E. Yoshihara, T. Nakae, MexZ-mediated regulation of mexXY multidrug efflux pump expression in Pseudomonas aeruginosa by binding on the mexZ-mexX intergenic DNA, FEMS Microbiol. Lett. 238 (1) (2004) 23–28. [25] S. Grkovic, M.H. Brown, M.A. Schumacher, R.G. Brennan, R.A. Skurray, The Staphylococcal QacR multidrug regulator binds a correctly spaced operator as a pair of dimers, J. Bacteriol. 183 (24) (2001) 7102–7109. [26] N. Pradervand, F. Delavat, S. Sulser, R. Miyazaki, J.R. van der Meer, The TetR-type MfsR protein of the integrative and conjugative element ICEclc controls both a putative efflux system and initiation of ICE transfer, J. Bacteriol. (2014) 02129-14. [27] W. Deng, C. Li, J. Xie, The underling mechanism of bacterial TetR/AcrR family transcriptional repressors, Cell. Signal. 25 (7) (2013) 1608–1613.
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: http://www.elsevier.com/locate/ijbiomac
Characterization of DNA binding and ligand binding properties of the TetR family protein involved in regulation of dsz operon in Gordonia sp. IITR100 Pooja Murarka, Preeti Srivastava ⁎ Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology Delhi, Hauz Khas, New Delhi 110016, India
a r t i c l e
i n f o
Article history: Received 27 June 2019 Received in revised form 13 August 2019 Accepted 3 September 2019 Available online 04 September 2019 Keywords: TetR family protein Desulfurization Ligand binding Fluorescence spectroscopy Circular dichroism
a b s t r a c t Gordonia sp. IITR100 is a biodesulfurizing bacterium which can metabolize dibenzothiophene (DBT) to 2 hydroxybiphenyl in four steps via the 4S pathway. The genes involved in the metabolism are present in the form of an operon, dszABC, which gets activated by a TetR family protein. Here, we report the detailed characterization of the DNA binding and ligand binding property of the TetR family protein. The protein was found to be conserved across other desulfurizing organisms. The protein was purified and was found to exist as dimer. The presence of ligand binding site was identified by docking studies and the structural changes in the protein upon ligand binding were determined by CD spectroscopy and tryptophan fluorescence. Further, it was determined that this protein binds to an imperfect palindromic DNA sequence present in the dsz promoter DNA. Binding to the DNA also changes conformation of the protein. © 2019 Elsevier B.V. All rights reserved.
1. Introduction Gordonia sp. IITR100 is a Gram-positive, aerobic, non-sporulating, high GC bacterium belonging to class Actinobacteria. It can desulfurize various sulfur containing aliphatic and aromatic organic compounds [1]. The bacterium follows the 4S pathway for desulfurization in which the carbon skeleton of organosulfur is intact therefore, the calorific value of fuel is maintained. The genes for desulfurization are present in the form of an operon, the dsz operon, under the control of a promoter. The dsz promoter is repressed in presence of inorganic sulfur and is active when the cells are grown in presence of organosulfurs as the sole sulfur source [2]. Recently, a TetR family protein was reported to regulate the operon. It is reported that the protein activates the operon when supplied in trans at sub optimal concentrations and the region of activation lies in the first 80 bp of the 385 bp promoter region [2]. TetR family proteins are involved in the regulation of various genes of catabolic pathways, co-factor metabolism, lipid metabolism, amino acid metabolism, nitrogen metabolism, carbon metabolism, cell signalling, osmotic stress and many more [3] [4]. Initially the members of the TetR family regulators were known as repressors, however several studies report that they may also serve as activators or may have dual function [4]. All the members of this family of protein have a helix turn helix domain through which they bind to the DNA [3,4]. ⁎ Corresponding author. E-mail address: [email protected] (P. Srivastava).
https://doi.org/10.1016/j.ijbiomac.2019.09.009 0141-8130/© 2019 Elsevier B.V. All rights reserved.
Here, we report the characterization of a TetR family protein (WP_010840674.1, Genbank ID: MVKV01000005.1 (c5313-4669)) from Gordonia sp. IITR100 which serves as an activator of the dsz operon. 2. Materials and methods 2.1. Growth media and conditions For cloning, expression and purification studies E. coli containing plasmid pPM1 was grown in LB medium containing kanamycin 50 μg/ ml at 37 °C and 180 rpm. The list of primers used in the study is given in Table 1. 2.2. Purification of the TetR family protein For purification of the TetR family protein in native conditions, immobilized metal affinity chromatography (IMAC) was used. For this, induced 500 ml of the BL21 (DE3) pLysS cells containing plasmid pPM1 (the gene for the TetR family protein cloned in pET29a vector between the sites HindIII and NdeI) were harvested, resuspended in 4 ml sonication buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride and 10 mM imidazole, pH 8), sonicated and the supernatant was collected after centrifugation at 12,000 rpm for 30 min. The NiNTA resins were pre-equilibrated with the sonication buffer (5 column volume). The lysate was incubated overnight with the pre-equilibrated Ni-NTA resins. The flow through was collected in a fresh falcon tube. Further the resins were washed with 2 column volumes of sonication
672
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
Table 1 List of primers used in the study (restriction sites italicized). Primer name
Resulted Sequence (5′ → 3′) fragment
PS-18 PS-19 Cy5 PS-19
Pdsz F Pdsz R Pdsz R
Motif
22 bp oligo 22 bp oligo 20 bp oligo 20 bp oligo 32 bp 32 bp
Motif comp Kan motif Kan motif comp Motif 2 Motif 2 comp
GAGCAGATCTGGCCATGATCGACCGCCTCGTCCATCACGC CAGTCATATGCGCGTATGTGTCCTCTAACCGTAAATAGCG Cy5-CAGTCATATGCGCGTATGTGTCCTCTAACCGTAAAT AGCG AGGAGACAGCTACCGACTCAAG Cy5-TCCTCTGTCGATGGCTGAGTTC GAACAATAAAACTGTCTGCT Cy5-CTTGTTATTTTGACAGACGA AGGAGACAGCTACCGACTCAAGAACCGAGA Cy5-TCCTCTGTCGATGGCTGAGTTCTTGGCTCT
buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride and 10 mM imidazole, pH 8) to remove the weakly bound proteins. The bound proteins were eluted with elution buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride and 100–300 mM imidazole, pH 8). The different elution fractions were run on a 12% SDS polyacrylamide gel. The aliquot containing the single band was dialyzed against buffer (20 mM Tris buffer, 150 mM NaCl and 10% glycerol, pH 8). The concentration of the pure protein was determined by Bradford assay. 2.3. Glutaraldehyde cross linking Glutaraldehyde cross linking was performed to determine the multimeric forms of the protein [5]. Glutaraldehyde (final concentration 0.1%) was added to 0.2 mg/ml of pure protein in a total reaction volume of 100 μl followed by incubation at 25 °C. An aliquot of 15 μl was collected at every 15 min interval and 5 μl of 1 M Tris-HCl buffer, pH 7.4 was added to stop the activity of glutaraldehyde. The samples were further run on 12% SDS polyacrylamide gel to check the multimeric form of the protein. 2.4. Pure protein on native gel An aliquot of the pure protein (20 μg) was mixed with 5 μl of TBE loading dye. It was run on 6% native TBE gel for 2 h at 100 V in cold conditions. Running buffer used was 0.25× TBE. The protein was visualized after staining the gel with coomassie brilliant blue R250 stain. 2.5. Size exclusion chromatography The oligomeric state of native TetR family protein was further confirmed through size-exclusion chromatography. For this purpose, 500 μl of 0.25 mg/ml protein was loaded on a Superdex 200 10/300 column fitted to an AKTA explorer FPLC system (GE Healthcare, Uppsala, Sweden). For comparison, two globular protein standards, bovine carbonic anhydrase II (29 kDa), bovine serum albumin (66 kDa) were also analyzed in a similar way. The void volume of the column was determined using dextran 2000. Prior to sample analysis, the column was equilibrated with 3 column volumes of protein buffer (20 mM Tris, 150 mM NaCl; pH 8). The flow rate of elution was 0.5 ml min−1. The data were acquired and analyzed using UNICORN software. 2.6. Fluorescence spectroscopy To determine the changes in the tertiary structure of the protein upon DNA binding, fluorescence spectroscopy was performed [6] in LS
55 spectrofluorimeter (Perkin Elmer, USA). The analysis is based on the intrinsic tryptophan fluorescence of the protein. The excitation wavelength was 295 nm. The spectrum was obtained over a wavelength range of 310 to 450 nm. The excitation and emission slits were 5 and 10 nm and path length of the cuvette was 10 mm. The protein (4 ∗ 10−3 μM) and dsz promoter (0.042 ∗ 10−6 μM) was incubated in ice for 2 h before the spectroscopic analysis. For all the spectra, the buffer background was subtracted. The change in the tertiary structure of the protein was monitored in presence of ligands: sodium sulfate and DBT. For this the protein (4 ∗ 10−3 μM) was incubated with sodium sulfate (3 mM) and DBT (0.1 mM) separately for 2 h in ice. The spectroscopic analysis was performed as done above. To monitor the change, a spectroscopic scan of only protein (4 ∗ 10 −3 μM) was performed as a control. 2.7. CD spectroscopy To determine the changes in the secondary structure of the protein upon DNA binding, circular dichroism was performed [7] in a circular dichroism spectropolarimeter (Jasco J-815, USA). The conformational change was monitored in the region between 190 and 250 nm in a quartz cuvette with a path length of 1 mm. The protein (4 ∗ 10−3 μM) and dsz promoter (10 ng) was incubated in ice for 2 h before the spectroscopic analysis. The scanning band width, speed and data pitch were 1 nm, 50 nm/min and 1 nm, respectively. The average of two accumulations with five scans each was considered (within 600 HT voltage range). Similarly, the change in the secondary structure of the protein was monitored in presence of ligands: sodium sulfate and DBT. For this the protein (4 ∗ 10−3 μM) was incubated with sodium sulfate (3 mM) and DBT (0.1 mM) separately for 2 h in ice. The spectroscopic analysis was performed as described above. For samples containing DBT, they were centrifuged at 12,000 for 5 min and the supernatant was collected. This was done to avoid turbidity in the samples. 2.8. Dynamic light scattering The hydrodynamic radius of the protein and the change in the particle size on binding to DNA was measured by dynamic light scattering (DLS) [8]. The above experiment was performed on a Wyatt quasielastic light scattering system (Wyatt Technology Corp., Santa Barbara, CA) with inbuilt Astra software. Protein sample (0.25 mg/ml) was taken in a quartz cuvette and the diffusion coefficient (DT) was determined. The protein was filtered through 0.22 μm syringe filter before data acquisition. To monitor the change in the presence of DNA, the protein and dsz promoter (10 ng) was incubated in ice for 2 h before the spectroscopic analysis. Hydrodynamic radius (Rh) was calculated from values of DT using Stokes-Einstein equation, Rh ¼ kb T=6πηDT where kb is Boltzmann's constant, T is temperature and η is solvent viscosity as described by Hoffmann et al. [9]. 2.9. EMSA with TetR family protein For EMSA with the TetR family protein, about 12 ng of the Cy5 labelled promoter (amplified from genomic DNA of Gordonia sp. IITR100 using primers PS18 and Cy5 PS19) was incubated with different concentrations (5–40 μg) of pure protein in presence of binding buffer (20 mM Tris, 10% glycerol and 150 mM NaCl, pH 7.5), poly d(I-C) and poly L-lysine. This complex was incubated for 4 h at 4 °C and was then run on 6% native TBE gel for 2 h at 100 V in cold conditions. Running buffer used was 0.25× TBE. The gel was then scanned in a fluorimager to observe
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
the shift. Induced and uninduced crude cell extract of recombinant E. coli containing the plasmid pPM1 was also used to determine the binding of protein to the promoter.
673
For EMSA with the motifs, the two complementary oligos (set 1: annealed motif and motif comp, set 2: annealed motif 2 and motif 2 comp) (Table 1) were annealed by mixing both the oligos in equal
Fig. 1. A) 3D structure of TetR family protein containing HTH domain. The red portion in the structure indicates the DNA binding region of the protein. The N and C terminal are marked B). Multiple sequence alignment of the protein in 6 different desulfurizing bacteria showing ~14% identity. The DNA binding region is marked in red box.
674
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
concentration (5 μM) followed by heating the mixture at 95 °C for 2 min and cooling it slowly to 25 °C over a period of 45 min in a thermocycler. This stock of 5 μM double stranded oligo was diluted and used for EMSA to give a final concentration of 12 ng. As a control
a non-specific kanamycin promoter motif (kan and kan comp) were annealed and used. Other steps of the protocol were same as above except the running time was reduced to 45 min as the length of the motifs is smaller.
A
C Terminal
N Terminal N Terminal
B
C Terminal
C
D
Fig. 2. (A) Chemical structure of the ligands under study: sulfate and DBT. (B) Docking of the protein to sulfate ion and DBT with ΔG of −10.11 kJ/mol and − 6.4 kJ/mol respectively. (C) Binding of the protein to sodium sulfate. The intrinsic fluorescence quenching of the protein was used to monitor its tertiary structural change in the protein and the change in the secondary structure was monitored by circular spectroscopy. (D) Structural change in the protein as monitored by fluorescence and circular dichroism spectroscopic method.
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
2.10. Bioinformatics analysis The 3-dimensional structure of the TetR family protein was elucidated computationally using PyMOL software (https://pymol.org/ edu/?q=educational/) based on similarity (63%) with protein Rv3557c, PDB ID: 4W1U (HTH type transcriptional repressor of Rhodococcus erythropolis. Multiple sequence alignment of this protein was done with other desulfurizing bacteria using CLUSTAL omega (https://www.ebi.ac.uk/ Tools/msa/clustalo/). The probable protein binding sites and the palindromic region in the dsz promoter were determined by the software meme suite (http://meme-suite.org/). The change in the secondary structure of the protein was analyzed by K2D2 software [10] (http:// cbdm-01.zdv.uni-mainz.de/~andrade/k2d2/). The docking studies of the protein to different ligands were performed using swissdock software (http://www.swissdock.ch/). 3. Results and discussion TetR family is the third most abundant family of regulators reported in bacteria [11]. While 102 TetR family regulators are present in Gordonia sp. IITR100 [12], none of them are characterized. One of the TetR family proteins (Genbank ID: MVKV01000005.1 (c5313-4669) was found to activate the dsz operon. Here, we describe the DNA binding and the ligand binding potential of the protein.
675
obtained in the gel confirmed that the purified protein is the TetR family protein (Fig. S1B). On spectroscopic analysis, a decrease in fluorescence intensity was found when the protein is incubated with sodium sulfate which suggests a change in the tertiary structure of the protein upon binding to sodium sulfate. Similarly, a change in the secondary structure of the protein was observed in presence of sodium sulfate (Fig. 2C). A decrease in fluorescence yield was observed with the increase in concentration of sodium sulfate. This suggests that there may be a ligand binding site in the protein where the sodium sulfate binds and quenches the fluorescence. This finding is in accordance with the property of the TetR family proteins. The TetR family proteins have been reported to contain a ligand binding site at their C-terminal which provides diversity to different members of this family [3]. Fluorescence spectroscopy has been used to study the ligand binding property of several TetR family proteins. A decrease in fluorescence yield has been reported for the TetR family protein, TtgR, in presence of its ligand phloretin [14]. Binding of Fad35R to its ligand tetracycline and activated fatty acid is also reported by intrinsic fluorescence spectrometry. A decrease in fluorescence intensity was observed with increase in concentration of tetracycline [15]. Similar observations are reported for ActR protein in presence of actinorhodin [16], QacR in presence of rhodamine [17], DesT binding to acyl-CoA [18] and FadR in presence of activated fatty acids [15]. However, very little or no structural change was found in the protein in presence of DBT (Fig. 2D).
3.1. The TetR family protein is conserved in other desulfurizing bacteria A 3D structure of this protein was generated using PyMOL software (Fig. 1A). The structure was based on the known structure of the HTH type transcription repressor in Rhodococcus sp. (Uniprot ID Q0S7V2) [13] with which the protein has 63% similarity. According to the structure obtained, the protein has 9 α-helices out of which 3 (marked in red) are involved in DNA binding. Multiple sequence alignment of the TetR family protein was performed using bioinformatics tools and is shown in Fig. 1B. The regions which are conserved are marked in red whereas as amino acids which are similar in their property are marked in green, the amino acids which show little similarity are shown in blue and the dissimilar amino acids are marked in black. Interestingly, in accordance with other members of the TetR family protein, this protein was also found to be more conserved in its DNA binding region (marked in red box in the figure) whereas little similarity was observed in its Cterminal region [3].
A
3.2. The TetR family protein contains a ligand binding site The TetR family of proteins is known to have a ligand binding site [3]. To determine whether it is true for the protein under study, docking studies were performed using swissdock software for the protein and different ligands: sodium sulfate and DBT (Fig. 2A). The Gibbs free energy (ΔG value) for binding of the protein to DBT was found to be −6.462 kJ/mol and that for sodium sulfate was −10.11 kJ/mol respectively, suggesting that the protein has a higher affinity towards sulfate when compared to that of DBT (Fig. 2B). To study the structural changes in the protein upon ligand binding, spectroscopic analysis was performed with pure protein. The TetR family protein was purified using Immobilized metal affinity chromatography. Expression analysis was carried out using E. coli BL21 (DE3) pLysS harbouring the plasmid pPM1. The solubility of the protein was determined at different time intervals after induction. The samples (100 ml each) were collected after 3 h, 5 h, 7 h and overnight of induction and sonicated. It was found that the maximum amount of the soluble protein was found after 5 h of induction. Therefore, the induction time was optimized to 5 h for purification. The purity of the protein was checked by running the purified sample on a 12% SDS polyacrylamide gel (Fig. S1A). MALDI-ToF analysis of the purified band
B
Fig. 3. Structural change in the protein on binding to the dsz promoter (A) A decrease in the ellipticity of the protein in presence of the DNA thus indicating a change in secondary structure of the protein on DNA binding (B) An increase of the tryptophan fluorescence of the protein in presence of the DNA thus indicating a change in tertiary structure of the protein upon DNA.
676
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
3.3. DNA binding changes the structure of the TetR family protein The TetR family of proteins is reported to have a helix turn helix domain through which they bind to the DNA. The helical structure of the protein was confirmed by circular dichroism. Negative bands at 208 nm, 222 nm and a positive band at 193 nm confirm the helical structure of the protein (Fig. 3A) [19]. The binding of the protein to
A
C
the DNA induces a structural change in the protein. It was demonstrated by circular dichroism and intrinsic fluorescence spectroscopy. In presence of promoter DNA, the negative bands at 208 nm and 222 nm of the protein become deeper suggesting that the protein gains secondary structure. K2D2 software analysis of the values obtained revealed that α helical content of the protein increased to 67.45% + 0.1 from the original 61.33% + 0.1 in presence of promoter DNA.
B
Bovine Carbonic Anhydrase II (29 kDa) Bovine Serum Albumin (66 kDa) TetR family Protein
D
Fig. 4. The TetR family protein exists as a dimer. (A) A 12% SDS polyacrylamide gel of the protein cross linked with glutaraldehyde. Lane 1: protein marker, lane 2: Control sample (protein without glutaraldehyde), lane 3–9: protein incubated with glutaraldehyde for 5, 15, 30, 45, 60, 75 and 90 min respectively. (B) Purified protein run on native gel. Lane 1: native protein marker, lane 2: purified protein band above 50 kDa protein. (C) Size-exclusion chromatography: SEC of the TetR family protein was carried out to infer its stoichiometry. Globular standards of different molecular weights; BSA (66 kDa) and bovine carbonic anhydrase II (29 kDa) were simultaneously analyzed. (D) An increase in size of the protein in presence of DNA suggesting that more than one protein binds to the dsz promoter as determined by dynamic light scattering.
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
A similar observation was reported by Hoffmann et al. (2005) where a change in the random coil of the MtrR protein on binding to the DNA was monitored by CD spectroscopy. Similarly, an increase in the helical
1
2 3
4
677
content of the QacR protein is reported upon DNA binding. Similarly, an increase in the helical content of the QacR protein is reported upon DNA binding [10]. Change of secondary structure on DNA binding is also
5 6
7
8
9 10
A
B
1 2 3
4 5
6
7 8
9
C
D
Fig. 5. (A) EMSA showing protein bound to Cy5 labelled dsz promoter (385 bp). Lane 1: Cy5 labelled dsz + crude extract of E. coli containing uninduced TetR family protein (5 μg), lane 2: Cy5 labelled dsz + crude extract of E. coli containing uninduced TetR family protein (40 μg), lane 3: Cy5 labelled dsz + crude extract of E. coli containing induced TetR family protein (5 μg), lane 4: control (only labelled DNA), lane 5–9: Cy5 labelled dsz + purified TetR family protein (5, 10, 20, 30 and 40 μg respectively), lane 10: Cy5 labelled dsz + crude extract of E. coli containing induced TetR family protein (40 μg). (B) Logo representing the sequences similar to the motif as obtained by MEME software. (C) A 6% TBE native gel showing protein bound to Cy5 labelled motif of the promoter (dsz motif (lane 1–3), kan motif (lane 4–6) and 32 bp motif respectively (lane 7–9)). Lane 1, 4, 7: Free labelled DNA (12 ng), lane 2, 5, 8: DNA (12 ng) + protein (10 μg protein), lane 3, 6, 9: DNA (12 ng) + protein (20 μg protein). (D) Location of different motifs similar to that of motif used for EMSA. The similar nucleotides are underlined.
678
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
studied for other members of the TetR family proteins such as the Tet repressor [20] and HylIIR [21]. Change in the tertiary structure was monitored by intrinsic fluorescence spectroscopy. An increase in fluorescence yield of the protein was observed in presence of the protein (Fig. 3B). It is reported that the intrinsic fluorescence yield can increase or decrease when bound to DNA [22]. Here an increase in fluorescence suggests that the tryptophan residues in the protein get a more hydrophobic environment upon DNA binding thereby increasing the fluorescence yield. Structural change upon DNA binding has also been studied for several members of the TetR family proteins such as QacR, the Tet repressor, SimR, AmtR, SlmA and KstR [14,23]. 3.4. The TetR family protein exists as dimer To determine the multimeric form of the above purified protein, glutaraldehyde cross linking was performed. SDS PAGE analysis shows an increase in intensity of protein band at around 50 kDa (Fig. 4A). Since the molecular weight of the monomeric form of protein is 25 kDa, an intense band at around 50 kDa suggests that the protein exists as a dimer. A single band around the 50 kDa molecular marker band in a native gel (Fig. 4B) further confirms the dimeric form of the protein, which is in agreement with other members of this family. The TetR family protein was analyzed by size-exclusion chromatography along with two globular standards of different molecular weight. The elution profile of the TetR family protein was in the form of a sharp single peak chromatogram, with elution volume corresponding to 15.9 ml. The globular standards BSA (66 kDa) and carbonic anhydrase (29 kDa) eluted corresponding to 15.2 and 17.7 ml, respectively. A minor peak preceding to the major peak could be due to preformed oligomers. The monomeric TetR family protein being a 25 kDa protein, was expected to elute at volume larger than carbonic anhydrase. Its elution profile however, can be justified with its dimeric stoichiometry which is corresponding to ~50 kDa (Fig. 4C). The TetR family of proteins is reported to exist predominantly as dimers. Several members of the TetR family proteins such as MexZ of Pseudomonas aeruginosa [24], QacR of Staphylococcus aureus [25] and MsfR of Pseudomonas knackmussi [26] protein were found to exist as dimers. 3.5. More than one protein binds to the dsz promoter Dynamic light scattering (DLS) experiment was performed with the protein in presence and absence of the promoter DNA. The hydrodynamic radius of the protein was found to be 5.35 ± 0.15 nm in absence of DNA whereas the size was 10.75 ± 0.25 nm in presence of DNA (Fig. 4D). As the hydrodynamic radius of the protein is almost doubled in presence of the promoter DNA, it can be said that more than one protein binds to the DNA. DLS has also been performed with the members of the TetR family protein. Studies show that the members of this family of regulators usually bind to their DNA as dimers or as dimer of dimers [3]. For instance, DLS studies show that two dimers of MtrR and the QacR protein binds to their respective DNA. The TetR repressor protein bind as a single dimer to its DNA and the EthR regulator binds as four dimers to its respective DNA [9,15]. 3.6. The TetR family protein binds to the promoter The above experiments show that the TetR family protein binds to the promoter. This was further validated by EMSA. Cy5 labelled dsz promoter was incubated with increasing concentrations of the purified protein and run on 6% native gel. A clear shift was observed in the lane containing protein. As the protein concentration increased, a super shift was observed and the concentration of the free DNA reduced (Fig. 5A). Further, two retarded bands were observed in case of uninduced crude cell extract containing the plasmid pPM1 whereas in
case of induced cell extract, the shift was more prominent with no free DNA left (Fig. 5A). This suggests that the TetR protein possibly interacts with other proteins/cofactors for strong binding to the dsz promoter. Although the concentrations required to give shift were different for crude extract and pure protein, the difference can be explained by the fact that full length promoter was used in the shift and the crude extract contains several DNA binding proteins which were identified in the pull-down assay as well. The protein binding site in the promoter was determined by MEME software (Fig. 5B). A clear shift was observed when EMSA was performed with a cy5 labelled motif (annealed motif and motif comp) determined by the software. As control, a Cy5 labelled dissimilar motif from the kanamycin promoter (annealed kan and kan comp) was used where no shift was observed (Fig. 5C). A major significance is that the motif lies in the first 80 bp of the promoter (52–73 bp) which corresponds to the region of activation [2]. Also, motif like sequence is present at multiple places throughout the promoter (58–67 bp (S1), 70–79 bp (S2), 108–117 bp (S3) and 126–135 bp (S4) (Fig. 5D). The alignment of the different regions similar to that of motif shows N50% similarity and is given in Fig. 5D (underlined). The motif and its similar sequence are represented in the logo. To further validate the binding site of the protein, EMSA was performed with purified protein and a 32 bp motif (annealed motif 2 and motif 2 comp) containing two binding sites (58–67 bp (S1), 70–79 bp (S2)). A shift was observed with dsz promoter motif containing two protein binding sites (Fig. 5C). According to the MEME software and EMSA, it was found that the protein binds to an imperfect palindromic region present at several places in the promoter. Interestingly, the TetR family proteins are reported to bind to perfect/imperfect palindromic sequences or inverted repeats. These include proteins PA2196 from Pseudomonas aeruginosa, Ms6564 from Mycobacterium smegmatis, AcrR of E. coli, Cmer of Campylobacter jejuni, PigZ of Serratia sp. and QacR of Staphylococcus aureus [27]. In fact, reports suggest that there are variations in the length of the binding sites of the TetR family protein and also in the number of palindromic nucleotides in a particular sequence. This is the first report on the characterization of the regulator of the dsz operon. The protein belongs to the TetR transcription regulator family and was found to have several properties in accordance to the other members of the TetR family proteins. Here, we provide experimental evidences for the same. Supplementary data to this article can be found online at https://doi. org/10.1016/j.ijbiomac.2019.09.009. Acknowledgements The work was supported by DBT-Innovative Young Biotechnologist Award (IYBA grant) to Preeti Srivastava. Pooja Murarka thanks CSIR for providing fellowship. Declaration of competing interest The authors declare no conflict of interest. References [1] J. Adlakha, P. Singh, S.K. Ram, M. Kumar, M. Singh, D. Singh, V. Sahai, P. Srivastava, Optimization of conditions for deep desulfurization of heavy crude oil and hydrodesulfurized diesel by Gordonia sp. IITR100, Fuel 184 (2016) 761–769. [2] P. Murarka, T. Bagga, P. Singh, S. Rangra, P. Srivastava, Isolation and identification of a TetR family protein that regulates the biodesulfurization operon, AMB Express 9 (1) (2019) 71. [3] J.L. Ramos, M. Martínez-Bueno, A.J. Molina-Henares, W. Terán, K. Watanabe, X. Zhang, M.T. Gallegos, R. Brennan, R. Tobes, The TetR family of transcriptional repressors, Microbiol. Mol. Biol. Rev. 69 (2) (2005) 326–356. [4] L. Cuthbertson, J.R. Nodwell, The TetR family of regulators, Microbiol. Mol. Biol. Rev. 77 (3) (2013) 440–475. [5] D.K. Simanshu, H.S. Savithri, M.R. Murthy, Crystal structures of Salmonella typhimurium biodegradative threonine deaminase and its complex with CMP
P. Murarka, P. Srivastava / International Journal of Biological Macromolecules 141 (2019) 671–679
[6]
[7]
[8]
[9]
[10]
[11]
[12] [13]
[14]
[15]
provide structural insights into ligand-induced oligomerization and enzyme activation, J. Biol. Chem. 281 (51) (2006) 39630–39641. D. Tippner, R. Wagner, Fluorescence analysis of the Escherichia coli transcription regulator H-NS reveals two distinguishable complexes dependent on binding to specific or nonspecific DNA sites, J. Biol. Chem. 270 (38) (1995) 22243–22247. A. Micsonai, F. Wien, L. Kernya, Y.-H. Lee, Y. Goto, M. Réfrégiers, J. Kardos, Accurate secondary structure prediction and fold recognition for circular dichroism spectroscopy, Proc. Natl. Acad. Sci. (2015) 201500851. D. Arosio, S. Cui, C. Ortega, M. Chovanec, S. Di Marco, G. Baldini, A. Falaschi, A. Vindigni, Studies on the mode of Ku interaction with DNA, J. Biol. Chem. 277 (12) (2002) 9741–9748. K.M. Hoffmann, D. Williams, W.M. Shafer, R.G. Brennan, Characterization of the multiple transferable resistance repressor, MtrR, from Neisseria gonorrhoeae, J. Bacteriol. 187 (14) (2005) 5008–5012. M.A. Schumacher, M.C. Miller, S. Grkovic, M.H. Brown, R.A. Skurray, R.G. Brennan, Structural basis for cooperative DNA binding by two dimers of the multidrug‐binding protein QacR, EMBO J 21 (5) (2002) 1210–1218. E.P. Rueda, R.H. Guerrero, M.A.M. Nuñez, D.A. Medina, I. Sanchez, J.A. Ibarra, Abundance, diversity and domain architecture variability in prokaryotic DNA-binding transcription factors, PloS One 13 (4) (2018), e0195332. J. Jaishankar, P. Singh, P. Srivastava, Draft genome sequence of a biodesulfurizing bacterium, Gordonia sp. strain IITR100, Genome Announc. 5 (17) (2017) e00230-17. M.P. McLeod, R.L. Warren, W.W. Hsiao, N. Araki, M. Myhre, C. Fernandes, D. Miyazawa, W. Wong, A.L. Lillquist, D. Wang, The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse, Proc. Natl. Acad. Sci. 103 (42) (2006) 15582–15587. Z. Yu, S.E. Reichheld, A. Savchenko, J. Parkinson, A.R. Davidson, A comprehensive analysis of structural and sequence conservation in the TetR family transcriptional regulators, J. Mol. Biol. 400 (4) (2010) 847–864. S. Anand, V. Singh, A.K. Singh, M. Mittal, M. Datt, B. Subramani, S. Kumaran, Equilibrium binding and kinetic characterization of putative tetracycline repressor family transcription regulator Fad35R from Mycobacterium tuberculosis, FEBS J. 279 (17) (2012) 3214–3228.
679
[16] K. Tahlan, Z. Yu, Y. Xu, A.R. Davidson, J.R. Nodwell, Ligand recognition by ActR, a TetR-like regulator of actinorhodin export, J. Mol. Biol. 383 (4) (2008) 753–761. [17] S. Grkovic, K.M. Hardie, M.H. Brown, R.A. Skurray, Interactions of the QacR multidrug-binding protein with structurally diverse ligands: implications for the evolution of the binding pocket, Biochemistry 42 (51) (2003) 15226–15236. [18] Y.M. Zhang, K. Zhu, M.W. Frank, C.O. Rock, A Pseudomonas aeruginosa transcription factor that senses fatty acid structure, Mol. Microbiol. 66 (3) (2007) 622–632. [19] N.J. Greenfield, Using circular dichroism spectra to estimate protein secondary structure, Nat. Protoc. 1 (6) (2006) 2876. [20] L. Atschmied, W. Hillen, Tet repressor tet operator complex formation induces conformational changes in the tet operator DNA, Nucleic Acids Res. 12 (4) (1984) 2171–2180. [21] E.A. Rodikova, O.V. Kovalevskiy, S.G. Mayorov, Z.I. Budarina, V.V. Marchenkov, B.S. Melnik, A.P. Leech, D.V. Nikitin, M.G. Shlyapnikov, A.S. Solonin, Two HlyIIR dimers bind to a long perfect inverted repeat in the operator of the hemolysin II gene from Bacillus cereus, FEBS Lett. 581 (6) (2007) 1190–1196. [22] R. Favicchio, A.I. Dragan, G.G. Kneale, C.M. Read, Fluorescence spectroscopy and anisotropy in the analysis of DNA-protein interactions, DNA-Protein Interactions, Springer 2009, pp. 589–611. [23] S. Ray, A. Maitra, A. Biswas, S. Panjikar, J. Mondal, R. Anand, Functional insights into the mode of DNA and ligand binding of the TetR family regulator TylP from Streptomyces fradiae, J. Biol. Chem. 292 (37) (2017) 15301–15311 (M117. 788000). [24] Y. Matsuo, S. Eda, N. Gotoh, E. Yoshihara, T. Nakae, MexZ-mediated regulation of mexXY multidrug efflux pump expression in Pseudomonas aeruginosa by binding on the mexZ-mexX intergenic DNA, FEMS Microbiol. Lett. 238 (1) (2004) 23–28. [25] S. Grkovic, M.H. Brown, M.A. Schumacher, R.G. Brennan, R.A. Skurray, The Staphylococcal QacR multidrug regulator binds a correctly spaced operator as a pair of dimers, J. Bacteriol. 183 (24) (2001) 7102–7109. [26] N. Pradervand, F. Delavat, S. Sulser, R. Miyazaki, J.R. van der Meer, The TetR-type MfsR protein of the integrative and conjugative element ICEclc controls both a putative efflux system and initiation of ICE transfer, J. Bacteriol. (2014) 02129-14. [27] W. Deng, C. Li, J. Xie, The underling mechanism of bacterial TetR/AcrR family transcriptional repressors, Cell. Signal. 25 (7) (2013) 1608–1613.