- Email: [email protected]
SpnA protein in DNA binding and embryonic development
BBRC Biochemical and Biophysical Research Communications 348 (2006) 1310–1318 www.elsevier.com/locate/ybbrc
Characterization of Drosophila Rad51/SpnA protein in DNA binding and embryonic development Siuk Yoo
*
Laboratory of Biochemical Genetics, National Heart, Lung, and Blood Institute, National Institutes of Health, Building 10, Room 7N321, 9000 Rockville Pike, Bethesda, MD 20892, USA Received 27 July 2006 Available online 11 August 2006
Abstract The Rad51 is a highly conserved protein throughout the eukaryotic kingdom and an essential enzyme in DNA repair and recombination. It possesses DNA binding activity and ATPase activity, and interacts with meiotic chromosomes during prophase I of meiosis. Drosophila Rad51, Spindle-A (SpnA) protein has been shown to be involved in repair of DNA damage in somatic cells and meiotic recombination in female germ cells. In this study, DNA binding activity of SpnA is demonstrated by both agarose gel mobility shift assay and restriction enzyme protection assay. SpnA is also shown to interact with meiotic chromosomes during prophase I in the primary spermatocytes of hsp26-spnA transgenic flies. In addition, SpnA is highly expressed in embryos, and the depletion of SpnA by RNA interference (RNAi) leads to embryonic lethality implying that SpnA is involved in early embryonic development. Therefore, these results suggest that Drosophila SpnA protein possesses properties similar to mammalian Rad51 homologs. 2006 Elsevier Inc. All rights reserved. Keywords: Drosophila Rad51; SpnA; DNA binding activity; Embryogenesis; Spermatocyte; RNAi
Homologous recombination is an essential biological function required not only for genetic recombination but also for chromosomal segregation, DNA replication, and DNA repair. Recombination occurs between two homologous DNA sequences in all organisms and the exchange of information is critical for the survival of the species. Among the proteins required for DNA repair and recombination, the Rad51 protein, a homolog of Escherichia coli RecA protein, is a central enzyme in both meiotic recombination and recombinational repair of double-strand DNA breaks (DSBs) caused by ionizing radiation or chemical mutagens [1]. It is a highly conserved protein throughout eukaryotes and possesses DNA-dependent ATPase activity, both double strand (ds) and single strand (ss) DNA binding activities, homologous DNA pairing activity, and strand exchange activity [2].
*
Fax: +1 301 496 9985. E-mail address: [email protected].
0006-291X/$ - see front matter 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.07.211
The functions of Rad51 protein in DNA repair and recombination have been extensively studied in yeast and mammals by biochemical, cytological, and genetic approaches. In vitro studies with yeast and human Rad51 proteins revealed a crucial role of Rad51 protein in the process of recombination [3,4]. Rad51 interacts with DNA to form a DNA–protein complex and catalyzes pairing and exchange of strands between two homologous DNA molecules in the presence of cofactors such as ATP, single strand DNA binding protein, and Rad52 epistasis group proteins which are Rad52, Rad54, Rad55, and Rad57 [5–7]. Several immunocytochemistry studies have also revealed that Rad51 interacts with components of the synaptonemal complex (lateral element proteins) at early prophase I, suggesting a role of Rad51 in meiotic recombination [8–11]. In yeast, the kinetics and timing of appearance and disappearance of Rad51 foci during meiosis have been reported to coincide with the occurrence of DSBs, suggesting a function of Rad51 protein in DNA repair [12]. Yeast Rad51
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
protein is also required to establish or stabilize axial associations between homologous chromatids [13] and required for heteroduplex formation [12], implicating a possible role of Rad51 protein in searching for homology and synaptic initiation during zygonema. In vertebrates, Rad51 protein is localized on meiotic chromatin in mouse spermatocytes and oocytes as well as chicken oocytes during sequential stages of meiosis [8,11]. These results suggest that the Rad51 protein is functionally involved in multiple steps of meiosis from before synaptic initiation through metaphase I. It has been reported that human Rad51 foci were increased significantly in somatic cells after treatments that induced DNA damage, suggesting a role of mammalian Rad51 in DNA repair [14]. Analysis of loss-of-function mutants has also revealed a role of rad51 in DNA repair and recombination. In yeast, mutations in rad51 gene cause inability to repair doublestrand DNA breaks, a decrease in meiotic recombination, and an increase in chromosome loss although rad51-deficient yeast cells have been shown to be viable [15,16]. The homozygous null mutation of murine rad51, however, results in very early embryonic lethality [17,18]. The mutant embryos arrest in the early developmental stage and exhibit a decrease in cell proliferation followed by programmed cell death [17]. Similar effects on cell proliferation were observed in a rad51-deficient chicken cell line [19]. The inhibition of rad51 expression in the rad51-deficient chicken cell line leads to chromosome breaks, cell-cycle arrest, and cell death, suggesting an essential function of mammalian Rad51 in cell proliferation and maintenance of chromosome integrity. Previously, the Drosophila homolog of Rad51 (DmRad51) has been isolated [20,21]. It was demonstrated that its transcript level was dramatically higher in ovaries than testes or other adult tissues, suggesting a role in female meiosis [21]. Recently, DmRad51 was shown to correspond to the spindle-A (spnA) locus [22]. In contrast to mammals, spnA null mutants are viable, but female mutants are sterile and show defects in DSB repair during oogenesis. In addition, homozygous mutants are sensitive to both irradiation of X-rays and treatment of methyl methanesulfonate (MMS) that induce DSBs [22]. These results suggest that DmRad51/SpnA is also involved in meiotic recombination and DNA repair. Additionally, down-regulation of spnA by RNA interference (RNAi) revealed that Drosophila Rad51 is required for resistance of larvae to the DNA damaging agent MMS [23], indicating a role of SpnA in repair of DNA damage. Although several lines of studies suggest the function of SpnA in recombination and DNA repair, the molecular mechanism of SpnA is not known. Therefore, to explore the action of SpnA at the molecular and cellular level, in this study, DNA binding activity and cellular localization of SpnA were studied. Like mammalian Rad51 proteins, both in vitro and in vivo assays demonstrate that Drosophila SpnA protein possesses both ds- and ssDNA binding activities and interacts with meiotic chromosomes. In addition,
1311
depletion of spnA m-RNA by RNAi in embryos results in embryonic lethality, suggesting a possible role of SpnA in early development. Materials and methods Generation of polyclonal antibody. Anti-SpnA polyclonal antibody was produced by a standard protocol using bacterially expressed full-length SpnA proteins containing six additional histidine residues at the C-terminus as an antigen [24]. Briefly, the full-length coding region of spnA gene was amplified by polymerase-chain reaction (PCR) and cloned into NdeI and XhoI sites of pET30b expression vector to generate pSpnA-NX (Fig. 1A). The construct was transformed into BL21(DE3) strain of E. coli. The recombinant SpnA (rSpnA) protein was expressed by the addition of isopropyl-b-D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM for 3 h and purified by affinity chromatography using a nickel-chelating column according to manufacturer’s protocol (Novagen). For immunization, the purified rSpnA protein was dialyzed against phosphate buffered saline (PBS) at pH 7.4 containing 10 mM Na2HPO4, 1.8 mM KH2PO4, 2.7 mM KCl, and 137 mM NaCl and injected subcutaneously into rabbits every 4–6 weeks. To measure titer of the antibody, the immunized rabbit serum was tested by Western blot analysis. DNA-binding assays. The rSpnA protein was prepared as described above with some modifications. After IPTG induction, the cells were harvested and lysed in Tris–buffered saline (TBS) at pH 7.5 (25 mM Tris base, 3 mM KCl, and 140 mM NaCl), 1 mM dithiothreitol (DTT), 1% Triton X-100, and 1 mM phenylmethylsulfonylfluoride (PMSF) and sonicated. After elution of the protein from a nickel column, the protein was dialyzed against storage buffer (20 mM Tris, pH 8.0, 2 mM EDTA, 0.5 mM DTT, and 5% glycerol) and frozen at 80 C. For agarose gel mobility shift assay [25,26], 50 ng of either double-stranded (ds) circular / X 174 DNA or single-stranded (ss) /X 174 DNA was mixed with varying concentrations of the rSpnA protein in DNA binding buffer (30 mM Tris– HCl, pH 7.5, 2 mM ATP, 2 mM DTT, and 10 mM MgCl2) to make final 30 ll of reaction mixture and incubated for 10 min at 37 C. After adding 5 ll of sample loading buffer (40 mM Tris–acetate, pH 8.0, 1 mM EDTA, 50% glycerol, and bromophenol blue) in each reaction, the DNA–protein complexes were analyzed by electrophoresis on an agarose gel in Tris– acetate/EDTA (TAE) buffer (40 mM Tris–acetate, 1 mM EDTA, pH 8.0) at 4 C. For restriction enzyme protection assay [27], 30 ll of reaction mixture containing 40 lg of the protein and 50 ng of ds /X 174 DNA was incubated for 40 min and the enzyme digestion was performed for 20 min at 37 C using 5u of BssHI, PstI, and XhoI. To inactivate the restriction
Fig. 1. Schematic diagram of plasmid constructs. (A) pSpnA-NX was generated by inserting spnA coding region into NdeI and XhoI sites of the pET30-b vector. (B) pHsp26-spnA construct contains the hsp26 promoter and the spnA coding region along with about 2 kb of downstream flanking DNA cloned into the Carnegie 20 vector which carries ry+ eye color marker. The arrows indicate the transcription orientation of spnA gene. Black boxes, spnA coding region; white box, hsp26 promoter region; grey box, flanking sequence; P, promoter; O, operator; rbs, ribosome binding site; T, terminator; PR, P-element right end; PL, P-element left end.
1312
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
enzymes, the stop solution [2 ll of 0.5 M EDTA and 1 ll of 10% sodium dodecyl sulfate (SDS)] was added. After incubation for 10 min at 65 C, the mixture was treated with 1 ll of proteinase K (10 mg/ml) for 10 min at 37 C and run on an agarose gel in Tris–borate/EDTA (TBE) buffer (45 mM Tris–borate, 1 mM EDTA, pH 8.0). Plasmid construction for transgenic animal. To express the SpnA protein in vivo, pHsp26-spnA construct was generated (Fig. 1B). After cloning of a 6.5 kb genomic fragment containing full-length spnA gene into the SalI site of Carnegie 20 P-element vector (pC20-spnA) [23], a HpaI-SwaI fragment of pC20-spnA was excised to delete the upstream of the start codon of the spnA gene in pC20-spnA and replaced with the 0.9 kb heat shock protein 26 (hsp26) promoter region to produce pHsp26-spnA construct. The hsp26 promoter region was obtained by a PCR using genomic DNA as a template and H26F (5 0 GTTAACCAAGTGAAGACTG AACTA3 0 ; HpaI site is underlined) and H26R (5 0 TATGTTCCTTTTG CGAGATT3 0 ) as primers. The PCR fragment was cloned into the EcoRV site of pBluescript KS(), excised by HpaI and SmaI enzymes, and cloned into HpaI and SwaI sites of pC20-spnA. The pHsp26-spnA construct was mixed with P-helper plasmid at a molar ratio of 2:1 and microinjected into ry506 embryos. Transgene insertions were identified by expression of the ry+ eye color marker in the Carnegie 20 vector. Immunofluorescent staining. For immunofluorescent staining of spermatocytes, adult testes were dissected in testis buffer [28] and transferred to a clean microscope slide, squashed gently by covering with a siliconized coverslip, and frozen in liquid nitrogen. After removal of the coverslip, the samples were fixed in methanol at 20 C for 5 min, then in acetone at 20 C for 1 min, and finally in PBS containing 1% Triton X-100 and 0.5% acetic acid for 10 min at room temperature [29]. After blocking in 10% normal goat serum for 1 h, the samples were incubated with antiSpnA antiserum diluted 1:100 with PT solution (PBS containing 0.2% Triton X-100) for 12 h, and then with the secondary Ab [fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit immunoglobulin (Ig) G] diluted 1:150 with PT solution for 1 h. The samples were washed with PT solution and counterstained with 4 0 6-diamidino-2-phenylindole (DAPI; 0.5 lg/ml) for 5 min. For immunofluorescent staining of embryos, freshly laid fertilized eggs were collected on grape-agar plates for 1 h. After dechorionation, fixation, and devitellization [28], the samples were incubated for 30 min in PBS containing 1% SDS, 0.5% Tween 20, and 1 mM EDTA. After blocking in 10% normal goat serum for 1 h, the antibody staining and DAPI staining were performed as described above. The photographs were taken by Leica TCS confocal microscope. Immunoblot analysis. Total proteins were extracted from embryos, larvae, testes, ovaries, male carcass (without testes), and female carcass (without ovaries). Each sample was mixed with approximately equal volume of 6 M urea in TBS buffer containing 1 mM DTT, 1% Triton X100, 2% SDS and 1 mM PMSF, homogenized with 0.1 mm glass beads (Sigma), and incubated on ice for 1 h. After centrifugation, the soluble fraction was mixed with equal volume of SDS sample buffer [30] and boiled for 10 min. Ten microgram proteins was electrophoresed on a 10% denaturing polyacrylamide gel and transferred to nitrocellulose by electroblotting. SpnA proteins were detected by chemiluminescent method according to the manufacturer’s protocol (Tropix). RNA interference. To produce spnA double-stranded (ds) RNA, antisense and sense RNA were synthesized in vitro. The spnA coding region was amplified by PCR using pC20-spnA as a template and RAFM3 (5 0 GGGAATTCATGGAGAAGCTAACGAATGTT3 0 ; EcoRI site is underlined) and RARM4 (5 0 GGCTCGAGGCTCTCCCTGGCGTCT CC3 0 ; XhoI site is underlined) as primers. The PCR fragment was digested with EcoRI and XhoI enzymes and cloned into the EcoRI and XhoI sites of pBluescript SK and pBluescript KS to produce pAS-spnA and pS-spnA, respectively. For anti-sense spnA RNA, pAS-spnA was linearized with XbaI enzyme, and for sense RNA, pS-spnA was linearized with XhoI enzyme. The transcription reaction was performed using MEGAscript T7 kit (Ambion). After RNA synthesis, the templates were digested with DNase I for 30 min at 37 C. To anneal the sense and anti-sense RNA, the reactions were pooled, boiled for 10 min, and cooled down to room temperature for 12 h. dsRNA was extracted by using phenol/chloroform, precipitated with ethanol and resuspended in injection buffer containing
5 mM KCl and 0.1 mM PO4, pH 7.8. spnA small interfering (si) RNA corresponding to DNA binding region at N-terminus of SpnA protein was synthesized (IDT). The sense (GCCACCAAGAAGCAACUGATT) and anti-sense (UCAGUUGCUUCUUGGUGGCTT) RNA were annealed as described above. For controls, dsRNA and siRNA were prepared from white gene. To generate 1.2 kb dsRNA, a PCR was performed using WFwd (TAATACGACTCACTATAGGGACCCACAAAAATCCCAA ACC; T7 RNA polymerase binding site was underlined) and WRev (TAATACGACTCACTATAGGGCTTCTGCGACAGCTTCTTC; T7 RNA polymerase binding site was underlined) as primers and pCaSpeR4 as a template. The PCR fragment was used as a template for in vitro transcription using MEGAscript T7 kit (Ambion). For siRNA, the sense (GGAUCAGGAGCUAUUAAUUTT) and anti-sense (AAUUAAUA GCUCCUGAUCCTT) RNA were synthesized (IDT) and annealed. Oregon R (wild type) embryos prior to the syncytial blastoderm stage were collected every 30 min period and injected [31]. The embryos were kept in an 18 C incubator for 24 h and hatched larvae were transferred into a fresh medium to determine survival rate.
Results Purification of recombinant SpnA protein The biochemical properties of Rad51 protein have been extensively studied in yeast and mammals. However, little is known about the molecular function of Drosophila Rad51/SpnA protein in the process of recombinational repair. Therefore, to study biochemical properties of SpnA protein, an expression construct, pSpnA-NX, carrying fulllength spnA coding region and six histidine residues at the C-terminus, was generated (Fig. 1A) and transformed into BL21 E. coli strain. After IPTG induction, the recombinant SpnA (rSpnA) protein was highly expressed (Fig. 2A). The last lane in Fig. 2A shows rSpnA protein without any major contaminants after purification by a nickel chelating column chromatography. In order to investigate the DNA binding activity of the rSpnA protein, the eluted proteins from an affinity nickel column were dialyzed against storage buffer. After centrifugation to remove the precipitants, the soluble fraction was analyzed by SDS-PAGE (Fig. 2C). The purity of rSpnA protein was more than 95% based on the gel electrophoresis. The purified rSpnA protein was also used to generate a polyclonal antibody to investigate whether SpnA binds to meiotic chromosomes. Specificity of anti-SpnA antibody is shown in Fig. 2B by Western blot analysis using the same protein samples in Fig. 2A. In vitro DNA binding activity of SpnA protein A number of studies have showed that Rad51 is an essential enzyme for DNA pairing and strand invasion steps that allow a broken DNA molecule to access an undamaged DNA template [3–7]. Thus the ability of binding DNA is de novo property of this enzyme. To investigate whether SpnA protein has DNA binding activity in vitro, both agarose gel mobility shift assay (GMSA) and restriction enzyme protection assay (REPA) were employed (Fig. 3). In the agarose GMSA, as the concentration of
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
1313
Fig. 2. Purified recombinant SpnA (rSpnA) protein analyzed by SDS-PAGE (A) and immunoblot (B). Lane 1 contains the molecular marker. Lane 2 shows total proteins extracted from BL21 (DE3) without being transformed with pSpnA-NX expression plasmid carrying full-length spnA coding region. Lane 3 and lane 4 show total proteins before and after IPTG induction, respectively, of BL21 (DE3) transformed with pSpnA-NX plasmid. Purified rSpnA protein in lane 5 is indicated by the arrowhead. (B) Immunoblot of the same protein samples as in (A). Note that polyclonal anti-SpnA serum reacts specifically with rSpnA protein. (C) Purification of rSpnA protein for DNA binding assay. After affinity chromatography using a nickel-chelating column, the protein was dialyzed against storage buffer and analyzed by SDS-PAGE.
rSpnA protein was increased, both supercoiled and relaxed ds /X 174 DNAs were decreased and DNA/protein complexes appeared at the top of the gel (Fig. 3A, upper panel). The recombinant protein also bound ss circular /X 174 DNA (Fig. 3A, lower panel). Bovine serum albumin (BSA) protein was used as a control. As expected, BSA did not show any significant DNA binding activity to both dsDNA and ssDNA. The binding activity of rSpnA protein to DNA is shown to be non-specific since the same result was obtained using different plasmid DNA, pBlueScript KS (data not shown). The DNA binding activity of SpnA protein was also confirmed by REPA using ds /X 174 DNA (Fig. 3B). In the absence of the rSpnA protein, all the restriction enzymes cleaved the circular /X 174 DNA generating linear molecules. However, in the presence of the rSpnA protein, no linear DNA molecules were detected indicating that the cleavage sites of restriction enzymes were protected. These results demonstrate that, like other Rad51 proteins in mammals and fungi, Drosophila SpnA possesses both ds- and ssDNA binding activities. To study the effects of Mg2+ and ATP on DNA binding activity, the rSpnA protein was incubated with either ds- or ssDNA in the absence of either Mg2+ or ATP. The results showed that the rSpnA protein did not bind to both dsDNA and ssDNA in the absence of Mg2+, however, the DNA binding activity of rSpnA protein was not affected by the presence or absence of ATP in the reaction (Fig. 3C). These results suggest that the binding of rSpnA protein to DNA requires the presence of Mg2+, but does not depend upon a nucleotide cofac-
tor since DNA/protein complexes were observed without ATP. In vivo DNA binding activity and localization of SpnA protein Rad51 protein plays a crucial role in meiotic recombination by association with meiotic chromosomes during prophase I [8–11]. To investigate whether SpnA protein also binds to meiotic chromosomes, a polyclonal antibody against rSpnA was generated and the specificity of the antibody is shown in Fig. 2A and B. The primary spermatocytes were examined by immunofluorescent staining using anti-SpnA antibody for the following reasons; preparation step is relatively simple and a large number of cells can be obtained easily. Since there are no distinct markers to reveal the developing stages of primary spermatocyte, Ychromosome fertility factors, ks-1, kl-3, and kl-5, were observed under a phase-contrast microscope to identify prophase cells during meiosis I [29]. These factors are giant lampbrush-like loops present only in the male germ line and restricted to the primary spermatocyte at prophase I. The primary spermatocytes from wild type flies were observed, but SpnA foci were not detected by immunofluorescent staining probably due to the lack of recombination events in Drosophila males (data not shown). Thus, to express SpnA in vivo, the hsp26-spnA transgenic flies that carry spnA gene driven by the hsp26 promoter were generated (Fig. 1B). After heat shock treatment, the primary spermatocytes were prepared and stained with the
1314
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
proteins were more concentrated at mid-prophase I stage forming thread-like structures in the nucleus (Fig. 4C, lower left) and rapidly disappeared in subsequent stages (data not shown). High magnifications of the late prophase I spermatocytes shown in the boxes of Fig. 4A and B displayed some SpnA proteins bound to chromatin although most signals have faded away (Fig. 4B and D). To determine if SpnA protein interacts with mitotic chromosomes, wild type embryos were examined by immunofluorescent staining. Since the embryonic nuclei are mitotically synchronized before the cellularization stage, early embryos are an excellent model system to study mitosis. A number of SpnA foci were observed around the nuclei of embryos. During mitosis, SpnA proteins appeared not to interact with mitotic chromosomes, however, many foci were associated with unknown DAPI-staining material around mitotic chromosomes indicated by arrows (Fig. 4E). At telophase of mitosis, a number of SpnA proteins were detected scattered around mitotic chromosomes but no SpnA foci were associated with mitotic chromosomes indicated by arrowheads (Fig. 4F). These results represent that the SpnA protein interacts with meiotic chromosomes demonstrating in vivo DNA binding activity. However, SpnA is not detected in association with mitotic chromosomes. Expression levels of SpnA protein during development
Fig. 3. Binding of the rSpnA protein to ds- and ssDNA. (A) For agarose gel mobility shift assay, 50 ng of ds /X 174 DNA (upper gel) or ss /X 174 DNA (lower gel) was incubated with various concentrations of the rSpnA protein as indicated above the gel for 10 min at 37 C. The mixtures were analyzed on a 0.9% (dsDNA) or a 1.5% agarose gel (ssDNA) at 4 C. Bovine serum albumin (BSA) was used as a control. (B) For restriction enzyme protection assay, 50 ng of ds /X 174 DNA was treated with 5u of BssHI (B), PstI (P), or XhoI (X) after incubation with or without 40 lg of rSpnA protein for 40 min at 37 C. To inactivate restriction enzymes, SDS and EDTA were added, and incubated for 10 min at 65 C. Following deproteinization by proteinase K, DNA products were analyzed on a 0.8% agarose gel and visualized by ethdium–bromide staining. (C) Effects of MgCl2 and ATP on binding activity of rSpnA protein to both dsDNA and ssDNA. 30 lg rSpnA protein was mixed with 50 ng of DNA in the absence of either MgCl2 or ATP. The mixture was incubated for 5 min at 37 C and analyzed on an agarose gel stained with ethidium bromide.
polyclonal antibody (green) and DAPI (blue). The result showed that SpnA proteins are exclusively localized in the nucleoplasm at the early prophase I stage, but absent in the nucleoli and cytoplasm (Fig. 4A, lower left). The
Since a number of SpnA foci were detected around the nuclei of embryos, the expression level of SpnA protein was determined at different developmental stages. Total proteins were extracted from wild type embryos, larvae, testes, ovaries, and adult carcasses without sex organs and analyzed by Western blot analysis. The most abundant SpnA protein was detected in embryos (arrowhead), and the protein was also expressed to the detectable level in ovaries (arrow) (Fig. 5). Since the highest level of spnA transcripts was observed in ovaries [21], this result implicates a maternal effect of spnA transcripts for early embryonic development. However, expression of SpnA protein was not detected in testes, suggesting that SpnA may not be an essential factor in the spermatocytes. This result is in good agreement with the immunofluorescent data because no SpnA foci were detected from wild type spermatocyte. SpnA protein was not observed in larvae and adult flies, presumably due to very low expression level of SpnA protein in somatic cells under the normal condition. Since spnA mutant flies are viable, a compensation mechanism for repair of DSBs might be present in somatic cells. Taken together, the high expression level of SpnA protein only in embryos suggests a possible role of SpnA protein during embryogenesis. RNA interference (RNAi) during early embryonic development To investigate the function of SpnA protein in embryonic development, it is necessary to deplete maternally stored
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
1315
Fig. 4. Immunolocalization of SpnA in the primary spermatocytes of hsp26-spnA transgenic flies and wild-type embryos. For (A) through (D), testes were dissected from hsp26-spnA transgenic flies after 1 h heat-shock treatment at 37 C following a 12 h recovery. Primary spermatocytes were stained with anti-SpnA polyclonal antibody (green) and then counterstained with the DNA-specific DAPI stain (blue). (A) and (C) Distribution of SpnA protein at prophase I stage. (B) and (D) High magnifications of the late prophase I spermatocytes marked in (A) and (C), respectively. For (E) and (F), wild type embryos at the syncytial blastoderm stage were prepared and stained with anti-SpnA polyclonal antibody (green) and DAPI stain (blue). (E) The distribution of SpnA protein at anaphase of mitotic nuclei. The arrows indicate SpnA proteins localized with unknown DAPI-staining molecules. (F) High magnification of SpnA staining at telophase of mitosis. The arrowheads indicate telophase chromosomes. All images were obtained on Leica TCS confocal microscope. Scale bars: 10 lm in A, B, C, E; 5 lm in D, F.
spnA transcripts in embryos. RNAi has been shown to be a powerful method to study the function of genes in vivo by down-regulating endogenous RNA using either double stranded (ds) RNA or small interfering (si) RNA. This method has also been successfully applied to Drosophila embryos to interfere with the function of a native gene [31–33]. In addition, it is a useful tool to identify function of a gene which particularly induces lethality or sterility. Since Drosophila females homozygous for spnA alleles are sterile [22], RNAi method was employed. To generate spnA dsRNA, anti-sense and sense spnA RNA were produced by in vitro transcription, and
annealed. The spnA dsRNA was subjected to both agarose gel electrophoresis and RNase treatment assay to confirm approximately 1.1 kb spnA dsRNA fragment corresponding to the spnA coding region (data not shown). For spnA siRNA, 21 nucleotides of anti-sense and sense RNAs corresponding to the putative DNA binding domain at the N-terminus of SpnA were synthesized [34]. To investigate if spnA dsRNA and siRNA interferes with normal embryonic development, both RNAs were injected into pre-blastoderm embryos and the survival rate was determined (Table 1). For control experiments, injection buffer (mock injection) and white dsRNA and siRNA were used. The
1316
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
Fig. 5. Immunoblot analysis of total proteins at major developmental stages. Total proteins were extracted as described in Materials and methods and approximately 10 lg of the proteins were analyzed by SDSPAGE. After transferring onto a nitrocellulose membrane, SpnA protein was detected using chemiluminiscent method. The arrowhead indicates the 38 kDa SpnA protein. Note that SpnA protein was barely detectable in ovaries (arrow). Females and males, adult carcasses without ovaries and testes, respectively; rSpnA, purified recombinant SpnA protein. Table 1 Effect of spnA depletion by RNAi during embryogenesis Gene
RNA
Injection buffer (mock) white dsRNA siRNA spnA dsRNA siRNA
No. of embryos
No. of larvae
% Hatching
1371
975
71.1
1612 1349 1665 1538
1060 855 0 0
65.8 63.4 0 0
Either dsRNA or siRNA was injected into pre-blastoderm embryos and the survival rate was calculated as total number of larvae hatched out/ total number of embryos injected · 100.
white gene is involved in the process of eye pigmentation and does not affect viability during Drosophila development. The survival rates of mock injection and white dsRNA/siRNA injection were more than 60% (N > 1300). However, when either spnA dsRNA or siRNA were injected, embryos ceased developing at stage 13/14 and did not survive beyond embryonic stage (N > 1500), suggesting that spnA RNAs interfered with the function of SpnA in normal embryonic development (Table 1). RNAi was also performed in Drosophila S2 cell line isolated from late stage embryos; however, the viability of S2 cells was not affected by depletion of spnA (data not shown). These results imply a role of SpnA during early embryonic development. Discussion Rad51 protein has been demonstrated to possess DNA binding activity, ATPase activity, and strand transfer activity [3–7]. These properties are essential to homologous recombination since the primary function of Rad51 protein is to bring two homologous DNA molecules into close proximity to facilitate the formation of heteroduplex DNA and to mediate strand exchange between them. Thus, the presumptive first step of homologous recombination is
binding of Rad51 protein to the DNA molecule. In the present study, the DNA binding activity of SpnA protein is demonstrated in a Mg2+-dependent but ATP-independent manner. A substantial body of biochemical evidence indicates that the binding reaction of Rad51 protein is affected by nucleotide cofactors, Mg2+ concentration, and salt concentration [25,26,35]. In contrast to Mg2+ which is an indispensable factor for DNA binding assay, the precise role of ATP is still controversial. It has been reported that yeast Rad51 protein binds to both ds- and ssDNA only in the presence of ATP and that neither ADP nor the nonhydrolyzable ATP analogues can substitute the function of ATP [35]. In contrast, Zaitseva et al., demonstrated the binding of yeast Rad51 protein to DNA in the absence of nucleotide cofactor at low pH condition [26]. A study using human Rad51 protein also represented that both ds- and ssDNA binding activities are not dependent upon a nucleotide cofactor [25]. Therefore, it is not surprising that ATP is not an essential factor for DNA binding of SpnA protein. Recently, the Drosophila Rad51 homolog, SpnA protein is also shown to be involved in the strand exchange step [36]. Although the precise biochemical properties of SpnA protein remain to be determined, these results strongly support the central role of SpnA in repair of DSBs by homologous recombination. Several studies using mouse spermatocytes and oocytes have reported that Rad51 foci appear as early as premeiotic S phase before the initiation of synapsis. These foci are increased in number and become organized during leptotene, and then, dramatically decreased as pachytene progresses [8–10,37]. In this study, SpnA foci were also observed during early prophase I and rapidly disappeared at late prophase I of the spermatocytes of hsp26-spnA transformants. Although it is not a physiological condition, the time course of appearance of SpnA and its distribution in spermatocytes are similar to mammalian Rad51 homologs. The failure to detect SpnA foci in wild type spermatocytes suggest that SpnA might be absent or, if any, at very low level in the spermatocytes. A previous study also reported no role of SpnA in male meiotic chromosome pairing [23], a diagnostic phenotype in meiotic recombination. Taken together with the observation that spnA null mutant males are fertile [22], SpnA may be dispensable during Drosophila spermatogenesis unlike mammalian Rad51 proteins. The disruption of rad51 gene in mice results in early embryonic lethality, indicating a crucial role of Rad51 in embryogenesis [17,18]. Since the cells are rapidly dividing during embryogenesis, Rad51 might be required for the cell proliferation, cell cycle control, DNA replication, or transcription possibly by interacting with p53, Brca1, or Brca2 [38]. However, the precise role of Rad51 protein during embryogenesis is not understood yet. In contrast to mammals, Drosophila spnA null mutants are viable although they are defective in recombination and DNA repair [22]. The survival of Drosophila mutants might be explained by the presence of maternal SpnA proteins for early embryonic
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
development. The depletion of maternally stored spnA transcript may demonstrate a possible role of SpnA in rapidly dividing cells during early development. Staeva-Vieira et al., generated double mutants for spnA and mei-W68 [22] to escape the complete sterility of spnA mutant females caused by defects in DNA repair during oogenesis. meiW68 is the Drosophila homolog of Spo11 that induces the DSB formation [39]. Since spnA phenotypes are suppressed by mei-W68 mutation, the double mutants are fertile and their progeny survive to adulthood [22], suggesting that SpnA may not be essential for viability. In this study, in an attempt to examine the phenotype caused by the depletion of SpnA solely, the maternal effect of SpnA was eliminated by employing RNAi technique. Interestingly, the results showed that both dsRNA and siRNA targeting spnA severely interfered with normal development, implying a role of SpnA during embryogenesis. It is possible that SpnA functions in the repair of mis-incorporated nucleotides during DNA replication or in the removal of nucleotide wastes during embryogenesis [19]. Although many SpnA foci associate with unknown material stained with DAPI during mitosis, the role of SpnA in embryonic development is unclear and need to be addressed in the future experiments. Acknowledgments I would like to thank S.-K. Lee and B. Mozer for critical reading of the manuscript and B.D. McKee for intellectual input and valuable discussions. References [1] P. Baumann, S.C. West, Role of the human Rad51 protein in homologous recombination and double-stranded-break repair, Trend Biol. Sci. 23 (1998) 247–251. [2] W. Edelmann, R. Kucherlapati, Role of recombination enzymes in mammalian cell survival, Proc. Natl. Acad. Sci. USA 93 (1996) 6225– 6227. [3] P. Sung, Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein, Science 265 (1994) 1241–1243. [4] P. Baumann, S.C. West, The human Rad51 protein: polarity of strand transfer and stimulation by hRP-A, EMBO J. 16 (1997) 5198–5206. [5] E.F. Benson, P. Baumann, S.C. West, Synergistic actions of Rad51 and Rad52 in recombination and DNA repair, Nature 391 (1998) 401–407. [6] G. Petukhova, S. Stratton, P. Sung, Catalysis of homologous DNA pairing by yeast Rad51 and Rad54 protein, Nature 393 (1998) 91–94. [7] P. Sung, Yeast Rad55 and Rad57 proteins form a hetero dimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase, Genes Dev. 111 (1997) 1111–1121. [8] T. Ashley, A.W. Plug, J. Xu, A.J. Solari, G. Reddy, Dynamic changes in Rad51 distribution on chromatin during meiosis in male and female vertebrates, Chromosoma 104 (1995) 19–28. [9] A.W. Plug, J. Xu, G. Reddy, E.I. Golub, T. Ashley, Presynaptic association of Rad51 protein with selected sites in meiotic chromatin, Proc. Natl. Acad. Sci. 93 (1996) 5920–5924. [10] P.B. Moens, D.J. Chen, Z. Shen, N. Kolas, M. Tarsoumas, H.H.Q. Heng, B. Spyropoulos, Rad51 immunocytology in rat and mouse spermatocytes and oocytes, Chromosoma 106 (1997) 207–215. [11] A. Barlow, F.E. Benson, S.C. West, M.A. Hulte´n, Distribution of the Rad51 recombinase in human and mouse spermatocytes, EMBO J. 16 (1997) 5207–5215.
1317
[12] D.K. Bishop, RecA homologs Dmc1 and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis, Cell 79 (1994) 1081–1092. [13] B. Rockmill, M. Sym, H. Scherthan, S. Roeder, Roles of two recA homologs in promoting meiotic chromosome synapse, Genes Dev. 9 (1995) 2684–2695. [14] T. Haaf, E.I. Golub, G. Reddy, C.M. Radding, D.C. Ward, Nuclear foci of mammalian Rad51 recombination protein in somatic cells after DNA damage and its localization in synaptonemal complexes, Proc. Natl. Acad. Sci. USA 92 (1995) 2298–2302. [15] A. Shinohara, H. Ogawa, T. Ogawa, Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein, Cell 69 (1992) 457–470. [16] T. Ogawa, A. Shinihara, A. Nabetani, T. Ikeya, X. Yu, E.H. Egelmam, H. Ogawa, RecA-like recombination proteins in eukaryotes: Functions and structures of Rad51 genes, Cold Spring Harb. Symp. Quant. Biol. 58 (1993) 567–576. [17] D.-S. Lim, P. Hasty, A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53, Mol. Cell. Biol. 16 (1996) 7133–7143. [18] T. Tsuzuki, Y. Fujii, K. Sakumi, Y. Tominaga, K. Nakao, M. Sekiguchi, A. Matsushiro, Y. Yoshimura, T. Morita, Targeted disruption of the Rad51 gene leads to lethality in embryonic mice, Proc. Natl. Acad. Sci. USA 93 (1996) 6236–6240. [19] E. Sonoda, M. Sasaki, J.-M. Buerstedde, O. Bezzubova, A. Shinohara, H. Ogawa, M. Takata, Y. Yamaguchi-Iwai, S. Takeda, Rad51deficient vertebrate cells accumulate chromosomal breaks prior to cell death, EMBO J. 17 (1998) 598–608. [20] E. Akaboshi, Y. Inoue, H. Ryo, Cloning of the cDNA and genomic DNA that correspond to the recA-like gene of Drosophila melanogaster, Jpn. J. Genet. 69 (1994) 663–670. [21] B.D. McKee, X.-J. Ren, C.-S. Hong, A recA-like gene in Drosophila melanogaster that is expressed at high levels in female but not male meiotic tissues, Chromosoma 104 (1996) 479–488. [22] E. Staeva-Vieira, S. Yoo, R. Lehmann, An essential role of DmRad51/SpnA in DNA repair and meiotic check point control, EMBO J. 22 (2003) 5863–5874. [23] S. Yoo, B.D. McKee, Functional analysis of the Drosophila Rad51 gene (spn-A) in repair of DNA damage and meiotic chromosome segregation, DNA Repair 4 (2005) 231–242. [24] S. Yoo, B.D. McKee, Overexpression of Drosophila Rad51 protein (DmRad51) disrupts cell cycle progression and leads to apoptosis, Chromosoma 113 (2004) 92–101. [25] F.E. Benson, A. Stasiak, S.C. West, Purification and characterization of the human Rad51 protein, an analogue of E. coli RecA, EMBO J. 13 (1994) 5764–5771. [26] E.M. Zaitseva, E.N. Zeitsev, S.C. Kowalczykowski, The DNA binding properties of Saccharomyces cerevisiae Rad51 protein, J Biol. Chem. 274 (1999) 2907–2915. [27] D.E. Adams, I.R. Tsaneva, S.C. West, Dissociation of RecA filaments from duplex DNA by the RuvA and RuvB DNA repair protein, Proc. Natl. Acad. Sci. USA 91 (1994) 9901–9905. [28] M. Ashburner, Drosophila: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989. [29] C. Pisano, S. Bonaccorsi, M. Gatti, The kl-3 loop of the Y chromosome of Drosophila melanogaster binds a tektin-like protein, Genetics 133 (1993) 569–579. [30] U.K. Laemmli, Cleavage of structural proteins during assembly of the head bacteriophage T4, Nature 227 (1970) 680–685. [31] A.I. Ivanov, A.C. Rovescalli, P. Pozzi, S. Yoo, B. Mozer, H.-P. Li, S.-H. Yu, H. Higashida, V. Guo, M. Spencer, M. Nirenberg, Genes required for Drosophila nervous system development identified by RNA interference, Proc. Natl. Acad. Sci. USA 101 (2004) 16216– 16221. [32] J.R. Kennerdell, R.W. Carthew, Heritable gene silencing in Drosophila using double-stranded RNA, Nat. Biotech. 18 (2000) 896–898.
1318
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
[33] L. Misquitta, B.M. Paterson, Targeted disruption of gene function in Drosophila by RNA interference (RNAi): a role for nautilus in embryonic somatic muscle formation, Proc. Natl. Acad. Sci. USA 96 (1999) 1451–1456. [34] D.S. Shin, L. Pellegrini, D.S. Daniels, B. Yelent, L. Craig, D. Bates, D.S. Yu, M.K. Shivji, C. Hitomi, A.S. Arvai, N. Volkmann, H. Tsuruta, T.L. Blundell, A.R. Venkitaraman, J.A. Tainer, Full-length archaeal Rad51 structure and mutants: mechanisms for RAD51 assembly and control by BRCA2, EMBO J. 22 (2003) 4566–4576. [35] E.A. Namsaraev, P. Berg, Binding of Rad51p to DNA. Interaction of Rad51p with single- and double-stranded DNA, J. Biol. Chem. 273 (1998) 6177–6182.
[36] V. Alexiadis, J.T. Kadonaga, Strand pairing by Rad54 and Rad51 is enhanced by chromatin, Genes Dev. 16 (2002) 2767–2771. [37] M. Tarsounas, T. Morita, R.E. Pearlman, P.B. Moens, Rad51 and Dmc1 form mixed complexes associated with mouse meiotic chromosome cores and synaptonemal complexes, J. Cell Biol. 147 (1999) 207–219. [38] C. Richardson, RAD51, genomic stability, and tumorigenesis, Cancer Lett. 218 (2005) 127–139. [39] K.S. McKim, A. Hayashi-Hagihara, mei-W68 in Drosophila melanogaster encodes a Spo11 homolog: evidence that the mechanism for initiating meiotic recombination is conserved, Genes Dev. 12 (1998) 2932–2942.
Characterization of Drosophila Rad51/SpnA protein in DNA binding and embryonic development Siuk Yoo
*
Laboratory of Biochemical Genetics, National Heart, Lung, and Blood Institute, National Institutes of Health, Building 10, Room 7N321, 9000 Rockville Pike, Bethesda, MD 20892, USA Received 27 July 2006 Available online 11 August 2006
Abstract The Rad51 is a highly conserved protein throughout the eukaryotic kingdom and an essential enzyme in DNA repair and recombination. It possesses DNA binding activity and ATPase activity, and interacts with meiotic chromosomes during prophase I of meiosis. Drosophila Rad51, Spindle-A (SpnA) protein has been shown to be involved in repair of DNA damage in somatic cells and meiotic recombination in female germ cells. In this study, DNA binding activity of SpnA is demonstrated by both agarose gel mobility shift assay and restriction enzyme protection assay. SpnA is also shown to interact with meiotic chromosomes during prophase I in the primary spermatocytes of hsp26-spnA transgenic flies. In addition, SpnA is highly expressed in embryos, and the depletion of SpnA by RNA interference (RNAi) leads to embryonic lethality implying that SpnA is involved in early embryonic development. Therefore, these results suggest that Drosophila SpnA protein possesses properties similar to mammalian Rad51 homologs. 2006 Elsevier Inc. All rights reserved. Keywords: Drosophila Rad51; SpnA; DNA binding activity; Embryogenesis; Spermatocyte; RNAi
Homologous recombination is an essential biological function required not only for genetic recombination but also for chromosomal segregation, DNA replication, and DNA repair. Recombination occurs between two homologous DNA sequences in all organisms and the exchange of information is critical for the survival of the species. Among the proteins required for DNA repair and recombination, the Rad51 protein, a homolog of Escherichia coli RecA protein, is a central enzyme in both meiotic recombination and recombinational repair of double-strand DNA breaks (DSBs) caused by ionizing radiation or chemical mutagens [1]. It is a highly conserved protein throughout eukaryotes and possesses DNA-dependent ATPase activity, both double strand (ds) and single strand (ss) DNA binding activities, homologous DNA pairing activity, and strand exchange activity [2].
*
Fax: +1 301 496 9985. E-mail address: [email protected].
0006-291X/$ - see front matter 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.07.211
The functions of Rad51 protein in DNA repair and recombination have been extensively studied in yeast and mammals by biochemical, cytological, and genetic approaches. In vitro studies with yeast and human Rad51 proteins revealed a crucial role of Rad51 protein in the process of recombination [3,4]. Rad51 interacts with DNA to form a DNA–protein complex and catalyzes pairing and exchange of strands between two homologous DNA molecules in the presence of cofactors such as ATP, single strand DNA binding protein, and Rad52 epistasis group proteins which are Rad52, Rad54, Rad55, and Rad57 [5–7]. Several immunocytochemistry studies have also revealed that Rad51 interacts with components of the synaptonemal complex (lateral element proteins) at early prophase I, suggesting a role of Rad51 in meiotic recombination [8–11]. In yeast, the kinetics and timing of appearance and disappearance of Rad51 foci during meiosis have been reported to coincide with the occurrence of DSBs, suggesting a function of Rad51 protein in DNA repair [12]. Yeast Rad51
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
protein is also required to establish or stabilize axial associations between homologous chromatids [13] and required for heteroduplex formation [12], implicating a possible role of Rad51 protein in searching for homology and synaptic initiation during zygonema. In vertebrates, Rad51 protein is localized on meiotic chromatin in mouse spermatocytes and oocytes as well as chicken oocytes during sequential stages of meiosis [8,11]. These results suggest that the Rad51 protein is functionally involved in multiple steps of meiosis from before synaptic initiation through metaphase I. It has been reported that human Rad51 foci were increased significantly in somatic cells after treatments that induced DNA damage, suggesting a role of mammalian Rad51 in DNA repair [14]. Analysis of loss-of-function mutants has also revealed a role of rad51 in DNA repair and recombination. In yeast, mutations in rad51 gene cause inability to repair doublestrand DNA breaks, a decrease in meiotic recombination, and an increase in chromosome loss although rad51-deficient yeast cells have been shown to be viable [15,16]. The homozygous null mutation of murine rad51, however, results in very early embryonic lethality [17,18]. The mutant embryos arrest in the early developmental stage and exhibit a decrease in cell proliferation followed by programmed cell death [17]. Similar effects on cell proliferation were observed in a rad51-deficient chicken cell line [19]. The inhibition of rad51 expression in the rad51-deficient chicken cell line leads to chromosome breaks, cell-cycle arrest, and cell death, suggesting an essential function of mammalian Rad51 in cell proliferation and maintenance of chromosome integrity. Previously, the Drosophila homolog of Rad51 (DmRad51) has been isolated [20,21]. It was demonstrated that its transcript level was dramatically higher in ovaries than testes or other adult tissues, suggesting a role in female meiosis [21]. Recently, DmRad51 was shown to correspond to the spindle-A (spnA) locus [22]. In contrast to mammals, spnA null mutants are viable, but female mutants are sterile and show defects in DSB repair during oogenesis. In addition, homozygous mutants are sensitive to both irradiation of X-rays and treatment of methyl methanesulfonate (MMS) that induce DSBs [22]. These results suggest that DmRad51/SpnA is also involved in meiotic recombination and DNA repair. Additionally, down-regulation of spnA by RNA interference (RNAi) revealed that Drosophila Rad51 is required for resistance of larvae to the DNA damaging agent MMS [23], indicating a role of SpnA in repair of DNA damage. Although several lines of studies suggest the function of SpnA in recombination and DNA repair, the molecular mechanism of SpnA is not known. Therefore, to explore the action of SpnA at the molecular and cellular level, in this study, DNA binding activity and cellular localization of SpnA were studied. Like mammalian Rad51 proteins, both in vitro and in vivo assays demonstrate that Drosophila SpnA protein possesses both ds- and ssDNA binding activities and interacts with meiotic chromosomes. In addition,
1311
depletion of spnA m-RNA by RNAi in embryos results in embryonic lethality, suggesting a possible role of SpnA in early development. Materials and methods Generation of polyclonal antibody. Anti-SpnA polyclonal antibody was produced by a standard protocol using bacterially expressed full-length SpnA proteins containing six additional histidine residues at the C-terminus as an antigen [24]. Briefly, the full-length coding region of spnA gene was amplified by polymerase-chain reaction (PCR) and cloned into NdeI and XhoI sites of pET30b expression vector to generate pSpnA-NX (Fig. 1A). The construct was transformed into BL21(DE3) strain of E. coli. The recombinant SpnA (rSpnA) protein was expressed by the addition of isopropyl-b-D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM for 3 h and purified by affinity chromatography using a nickel-chelating column according to manufacturer’s protocol (Novagen). For immunization, the purified rSpnA protein was dialyzed against phosphate buffered saline (PBS) at pH 7.4 containing 10 mM Na2HPO4, 1.8 mM KH2PO4, 2.7 mM KCl, and 137 mM NaCl and injected subcutaneously into rabbits every 4–6 weeks. To measure titer of the antibody, the immunized rabbit serum was tested by Western blot analysis. DNA-binding assays. The rSpnA protein was prepared as described above with some modifications. After IPTG induction, the cells were harvested and lysed in Tris–buffered saline (TBS) at pH 7.5 (25 mM Tris base, 3 mM KCl, and 140 mM NaCl), 1 mM dithiothreitol (DTT), 1% Triton X-100, and 1 mM phenylmethylsulfonylfluoride (PMSF) and sonicated. After elution of the protein from a nickel column, the protein was dialyzed against storage buffer (20 mM Tris, pH 8.0, 2 mM EDTA, 0.5 mM DTT, and 5% glycerol) and frozen at 80 C. For agarose gel mobility shift assay [25,26], 50 ng of either double-stranded (ds) circular / X 174 DNA or single-stranded (ss) /X 174 DNA was mixed with varying concentrations of the rSpnA protein in DNA binding buffer (30 mM Tris– HCl, pH 7.5, 2 mM ATP, 2 mM DTT, and 10 mM MgCl2) to make final 30 ll of reaction mixture and incubated for 10 min at 37 C. After adding 5 ll of sample loading buffer (40 mM Tris–acetate, pH 8.0, 1 mM EDTA, 50% glycerol, and bromophenol blue) in each reaction, the DNA–protein complexes were analyzed by electrophoresis on an agarose gel in Tris– acetate/EDTA (TAE) buffer (40 mM Tris–acetate, 1 mM EDTA, pH 8.0) at 4 C. For restriction enzyme protection assay [27], 30 ll of reaction mixture containing 40 lg of the protein and 50 ng of ds /X 174 DNA was incubated for 40 min and the enzyme digestion was performed for 20 min at 37 C using 5u of BssHI, PstI, and XhoI. To inactivate the restriction
Fig. 1. Schematic diagram of plasmid constructs. (A) pSpnA-NX was generated by inserting spnA coding region into NdeI and XhoI sites of the pET30-b vector. (B) pHsp26-spnA construct contains the hsp26 promoter and the spnA coding region along with about 2 kb of downstream flanking DNA cloned into the Carnegie 20 vector which carries ry+ eye color marker. The arrows indicate the transcription orientation of spnA gene. Black boxes, spnA coding region; white box, hsp26 promoter region; grey box, flanking sequence; P, promoter; O, operator; rbs, ribosome binding site; T, terminator; PR, P-element right end; PL, P-element left end.
1312
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
enzymes, the stop solution [2 ll of 0.5 M EDTA and 1 ll of 10% sodium dodecyl sulfate (SDS)] was added. After incubation for 10 min at 65 C, the mixture was treated with 1 ll of proteinase K (10 mg/ml) for 10 min at 37 C and run on an agarose gel in Tris–borate/EDTA (TBE) buffer (45 mM Tris–borate, 1 mM EDTA, pH 8.0). Plasmid construction for transgenic animal. To express the SpnA protein in vivo, pHsp26-spnA construct was generated (Fig. 1B). After cloning of a 6.5 kb genomic fragment containing full-length spnA gene into the SalI site of Carnegie 20 P-element vector (pC20-spnA) [23], a HpaI-SwaI fragment of pC20-spnA was excised to delete the upstream of the start codon of the spnA gene in pC20-spnA and replaced with the 0.9 kb heat shock protein 26 (hsp26) promoter region to produce pHsp26-spnA construct. The hsp26 promoter region was obtained by a PCR using genomic DNA as a template and H26F (5 0 GTTAACCAAGTGAAGACTG AACTA3 0 ; HpaI site is underlined) and H26R (5 0 TATGTTCCTTTTG CGAGATT3 0 ) as primers. The PCR fragment was cloned into the EcoRV site of pBluescript KS(), excised by HpaI and SmaI enzymes, and cloned into HpaI and SwaI sites of pC20-spnA. The pHsp26-spnA construct was mixed with P-helper plasmid at a molar ratio of 2:1 and microinjected into ry506 embryos. Transgene insertions were identified by expression of the ry+ eye color marker in the Carnegie 20 vector. Immunofluorescent staining. For immunofluorescent staining of spermatocytes, adult testes were dissected in testis buffer [28] and transferred to a clean microscope slide, squashed gently by covering with a siliconized coverslip, and frozen in liquid nitrogen. After removal of the coverslip, the samples were fixed in methanol at 20 C for 5 min, then in acetone at 20 C for 1 min, and finally in PBS containing 1% Triton X-100 and 0.5% acetic acid for 10 min at room temperature [29]. After blocking in 10% normal goat serum for 1 h, the samples were incubated with antiSpnA antiserum diluted 1:100 with PT solution (PBS containing 0.2% Triton X-100) for 12 h, and then with the secondary Ab [fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit immunoglobulin (Ig) G] diluted 1:150 with PT solution for 1 h. The samples were washed with PT solution and counterstained with 4 0 6-diamidino-2-phenylindole (DAPI; 0.5 lg/ml) for 5 min. For immunofluorescent staining of embryos, freshly laid fertilized eggs were collected on grape-agar plates for 1 h. After dechorionation, fixation, and devitellization [28], the samples were incubated for 30 min in PBS containing 1% SDS, 0.5% Tween 20, and 1 mM EDTA. After blocking in 10% normal goat serum for 1 h, the antibody staining and DAPI staining were performed as described above. The photographs were taken by Leica TCS confocal microscope. Immunoblot analysis. Total proteins were extracted from embryos, larvae, testes, ovaries, male carcass (without testes), and female carcass (without ovaries). Each sample was mixed with approximately equal volume of 6 M urea in TBS buffer containing 1 mM DTT, 1% Triton X100, 2% SDS and 1 mM PMSF, homogenized with 0.1 mm glass beads (Sigma), and incubated on ice for 1 h. After centrifugation, the soluble fraction was mixed with equal volume of SDS sample buffer [30] and boiled for 10 min. Ten microgram proteins was electrophoresed on a 10% denaturing polyacrylamide gel and transferred to nitrocellulose by electroblotting. SpnA proteins were detected by chemiluminescent method according to the manufacturer’s protocol (Tropix). RNA interference. To produce spnA double-stranded (ds) RNA, antisense and sense RNA were synthesized in vitro. The spnA coding region was amplified by PCR using pC20-spnA as a template and RAFM3 (5 0 GGGAATTCATGGAGAAGCTAACGAATGTT3 0 ; EcoRI site is underlined) and RARM4 (5 0 GGCTCGAGGCTCTCCCTGGCGTCT CC3 0 ; XhoI site is underlined) as primers. The PCR fragment was digested with EcoRI and XhoI enzymes and cloned into the EcoRI and XhoI sites of pBluescript SK and pBluescript KS to produce pAS-spnA and pS-spnA, respectively. For anti-sense spnA RNA, pAS-spnA was linearized with XbaI enzyme, and for sense RNA, pS-spnA was linearized with XhoI enzyme. The transcription reaction was performed using MEGAscript T7 kit (Ambion). After RNA synthesis, the templates were digested with DNase I for 30 min at 37 C. To anneal the sense and anti-sense RNA, the reactions were pooled, boiled for 10 min, and cooled down to room temperature for 12 h. dsRNA was extracted by using phenol/chloroform, precipitated with ethanol and resuspended in injection buffer containing
5 mM KCl and 0.1 mM PO4, pH 7.8. spnA small interfering (si) RNA corresponding to DNA binding region at N-terminus of SpnA protein was synthesized (IDT). The sense (GCCACCAAGAAGCAACUGATT) and anti-sense (UCAGUUGCUUCUUGGUGGCTT) RNA were annealed as described above. For controls, dsRNA and siRNA were prepared from white gene. To generate 1.2 kb dsRNA, a PCR was performed using WFwd (TAATACGACTCACTATAGGGACCCACAAAAATCCCAA ACC; T7 RNA polymerase binding site was underlined) and WRev (TAATACGACTCACTATAGGGCTTCTGCGACAGCTTCTTC; T7 RNA polymerase binding site was underlined) as primers and pCaSpeR4 as a template. The PCR fragment was used as a template for in vitro transcription using MEGAscript T7 kit (Ambion). For siRNA, the sense (GGAUCAGGAGCUAUUAAUUTT) and anti-sense (AAUUAAUA GCUCCUGAUCCTT) RNA were synthesized (IDT) and annealed. Oregon R (wild type) embryos prior to the syncytial blastoderm stage were collected every 30 min period and injected [31]. The embryos were kept in an 18 C incubator for 24 h and hatched larvae were transferred into a fresh medium to determine survival rate.
Results Purification of recombinant SpnA protein The biochemical properties of Rad51 protein have been extensively studied in yeast and mammals. However, little is known about the molecular function of Drosophila Rad51/SpnA protein in the process of recombinational repair. Therefore, to study biochemical properties of SpnA protein, an expression construct, pSpnA-NX, carrying fulllength spnA coding region and six histidine residues at the C-terminus, was generated (Fig. 1A) and transformed into BL21 E. coli strain. After IPTG induction, the recombinant SpnA (rSpnA) protein was highly expressed (Fig. 2A). The last lane in Fig. 2A shows rSpnA protein without any major contaminants after purification by a nickel chelating column chromatography. In order to investigate the DNA binding activity of the rSpnA protein, the eluted proteins from an affinity nickel column were dialyzed against storage buffer. After centrifugation to remove the precipitants, the soluble fraction was analyzed by SDS-PAGE (Fig. 2C). The purity of rSpnA protein was more than 95% based on the gel electrophoresis. The purified rSpnA protein was also used to generate a polyclonal antibody to investigate whether SpnA binds to meiotic chromosomes. Specificity of anti-SpnA antibody is shown in Fig. 2B by Western blot analysis using the same protein samples in Fig. 2A. In vitro DNA binding activity of SpnA protein A number of studies have showed that Rad51 is an essential enzyme for DNA pairing and strand invasion steps that allow a broken DNA molecule to access an undamaged DNA template [3–7]. Thus the ability of binding DNA is de novo property of this enzyme. To investigate whether SpnA protein has DNA binding activity in vitro, both agarose gel mobility shift assay (GMSA) and restriction enzyme protection assay (REPA) were employed (Fig. 3). In the agarose GMSA, as the concentration of
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
1313
Fig. 2. Purified recombinant SpnA (rSpnA) protein analyzed by SDS-PAGE (A) and immunoblot (B). Lane 1 contains the molecular marker. Lane 2 shows total proteins extracted from BL21 (DE3) without being transformed with pSpnA-NX expression plasmid carrying full-length spnA coding region. Lane 3 and lane 4 show total proteins before and after IPTG induction, respectively, of BL21 (DE3) transformed with pSpnA-NX plasmid. Purified rSpnA protein in lane 5 is indicated by the arrowhead. (B) Immunoblot of the same protein samples as in (A). Note that polyclonal anti-SpnA serum reacts specifically with rSpnA protein. (C) Purification of rSpnA protein for DNA binding assay. After affinity chromatography using a nickel-chelating column, the protein was dialyzed against storage buffer and analyzed by SDS-PAGE.
rSpnA protein was increased, both supercoiled and relaxed ds /X 174 DNAs were decreased and DNA/protein complexes appeared at the top of the gel (Fig. 3A, upper panel). The recombinant protein also bound ss circular /X 174 DNA (Fig. 3A, lower panel). Bovine serum albumin (BSA) protein was used as a control. As expected, BSA did not show any significant DNA binding activity to both dsDNA and ssDNA. The binding activity of rSpnA protein to DNA is shown to be non-specific since the same result was obtained using different plasmid DNA, pBlueScript KS (data not shown). The DNA binding activity of SpnA protein was also confirmed by REPA using ds /X 174 DNA (Fig. 3B). In the absence of the rSpnA protein, all the restriction enzymes cleaved the circular /X 174 DNA generating linear molecules. However, in the presence of the rSpnA protein, no linear DNA molecules were detected indicating that the cleavage sites of restriction enzymes were protected. These results demonstrate that, like other Rad51 proteins in mammals and fungi, Drosophila SpnA possesses both ds- and ssDNA binding activities. To study the effects of Mg2+ and ATP on DNA binding activity, the rSpnA protein was incubated with either ds- or ssDNA in the absence of either Mg2+ or ATP. The results showed that the rSpnA protein did not bind to both dsDNA and ssDNA in the absence of Mg2+, however, the DNA binding activity of rSpnA protein was not affected by the presence or absence of ATP in the reaction (Fig. 3C). These results suggest that the binding of rSpnA protein to DNA requires the presence of Mg2+, but does not depend upon a nucleotide cofac-
tor since DNA/protein complexes were observed without ATP. In vivo DNA binding activity and localization of SpnA protein Rad51 protein plays a crucial role in meiotic recombination by association with meiotic chromosomes during prophase I [8–11]. To investigate whether SpnA protein also binds to meiotic chromosomes, a polyclonal antibody against rSpnA was generated and the specificity of the antibody is shown in Fig. 2A and B. The primary spermatocytes were examined by immunofluorescent staining using anti-SpnA antibody for the following reasons; preparation step is relatively simple and a large number of cells can be obtained easily. Since there are no distinct markers to reveal the developing stages of primary spermatocyte, Ychromosome fertility factors, ks-1, kl-3, and kl-5, were observed under a phase-contrast microscope to identify prophase cells during meiosis I [29]. These factors are giant lampbrush-like loops present only in the male germ line and restricted to the primary spermatocyte at prophase I. The primary spermatocytes from wild type flies were observed, but SpnA foci were not detected by immunofluorescent staining probably due to the lack of recombination events in Drosophila males (data not shown). Thus, to express SpnA in vivo, the hsp26-spnA transgenic flies that carry spnA gene driven by the hsp26 promoter were generated (Fig. 1B). After heat shock treatment, the primary spermatocytes were prepared and stained with the
1314
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
proteins were more concentrated at mid-prophase I stage forming thread-like structures in the nucleus (Fig. 4C, lower left) and rapidly disappeared in subsequent stages (data not shown). High magnifications of the late prophase I spermatocytes shown in the boxes of Fig. 4A and B displayed some SpnA proteins bound to chromatin although most signals have faded away (Fig. 4B and D). To determine if SpnA protein interacts with mitotic chromosomes, wild type embryos were examined by immunofluorescent staining. Since the embryonic nuclei are mitotically synchronized before the cellularization stage, early embryos are an excellent model system to study mitosis. A number of SpnA foci were observed around the nuclei of embryos. During mitosis, SpnA proteins appeared not to interact with mitotic chromosomes, however, many foci were associated with unknown DAPI-staining material around mitotic chromosomes indicated by arrows (Fig. 4E). At telophase of mitosis, a number of SpnA proteins were detected scattered around mitotic chromosomes but no SpnA foci were associated with mitotic chromosomes indicated by arrowheads (Fig. 4F). These results represent that the SpnA protein interacts with meiotic chromosomes demonstrating in vivo DNA binding activity. However, SpnA is not detected in association with mitotic chromosomes. Expression levels of SpnA protein during development
Fig. 3. Binding of the rSpnA protein to ds- and ssDNA. (A) For agarose gel mobility shift assay, 50 ng of ds /X 174 DNA (upper gel) or ss /X 174 DNA (lower gel) was incubated with various concentrations of the rSpnA protein as indicated above the gel for 10 min at 37 C. The mixtures were analyzed on a 0.9% (dsDNA) or a 1.5% agarose gel (ssDNA) at 4 C. Bovine serum albumin (BSA) was used as a control. (B) For restriction enzyme protection assay, 50 ng of ds /X 174 DNA was treated with 5u of BssHI (B), PstI (P), or XhoI (X) after incubation with or without 40 lg of rSpnA protein for 40 min at 37 C. To inactivate restriction enzymes, SDS and EDTA were added, and incubated for 10 min at 65 C. Following deproteinization by proteinase K, DNA products were analyzed on a 0.8% agarose gel and visualized by ethdium–bromide staining. (C) Effects of MgCl2 and ATP on binding activity of rSpnA protein to both dsDNA and ssDNA. 30 lg rSpnA protein was mixed with 50 ng of DNA in the absence of either MgCl2 or ATP. The mixture was incubated for 5 min at 37 C and analyzed on an agarose gel stained with ethidium bromide.
polyclonal antibody (green) and DAPI (blue). The result showed that SpnA proteins are exclusively localized in the nucleoplasm at the early prophase I stage, but absent in the nucleoli and cytoplasm (Fig. 4A, lower left). The
Since a number of SpnA foci were detected around the nuclei of embryos, the expression level of SpnA protein was determined at different developmental stages. Total proteins were extracted from wild type embryos, larvae, testes, ovaries, and adult carcasses without sex organs and analyzed by Western blot analysis. The most abundant SpnA protein was detected in embryos (arrowhead), and the protein was also expressed to the detectable level in ovaries (arrow) (Fig. 5). Since the highest level of spnA transcripts was observed in ovaries [21], this result implicates a maternal effect of spnA transcripts for early embryonic development. However, expression of SpnA protein was not detected in testes, suggesting that SpnA may not be an essential factor in the spermatocytes. This result is in good agreement with the immunofluorescent data because no SpnA foci were detected from wild type spermatocyte. SpnA protein was not observed in larvae and adult flies, presumably due to very low expression level of SpnA protein in somatic cells under the normal condition. Since spnA mutant flies are viable, a compensation mechanism for repair of DSBs might be present in somatic cells. Taken together, the high expression level of SpnA protein only in embryos suggests a possible role of SpnA protein during embryogenesis. RNA interference (RNAi) during early embryonic development To investigate the function of SpnA protein in embryonic development, it is necessary to deplete maternally stored
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
1315
Fig. 4. Immunolocalization of SpnA in the primary spermatocytes of hsp26-spnA transgenic flies and wild-type embryos. For (A) through (D), testes were dissected from hsp26-spnA transgenic flies after 1 h heat-shock treatment at 37 C following a 12 h recovery. Primary spermatocytes were stained with anti-SpnA polyclonal antibody (green) and then counterstained with the DNA-specific DAPI stain (blue). (A) and (C) Distribution of SpnA protein at prophase I stage. (B) and (D) High magnifications of the late prophase I spermatocytes marked in (A) and (C), respectively. For (E) and (F), wild type embryos at the syncytial blastoderm stage were prepared and stained with anti-SpnA polyclonal antibody (green) and DAPI stain (blue). (E) The distribution of SpnA protein at anaphase of mitotic nuclei. The arrows indicate SpnA proteins localized with unknown DAPI-staining molecules. (F) High magnification of SpnA staining at telophase of mitosis. The arrowheads indicate telophase chromosomes. All images were obtained on Leica TCS confocal microscope. Scale bars: 10 lm in A, B, C, E; 5 lm in D, F.
spnA transcripts in embryos. RNAi has been shown to be a powerful method to study the function of genes in vivo by down-regulating endogenous RNA using either double stranded (ds) RNA or small interfering (si) RNA. This method has also been successfully applied to Drosophila embryos to interfere with the function of a native gene [31–33]. In addition, it is a useful tool to identify function of a gene which particularly induces lethality or sterility. Since Drosophila females homozygous for spnA alleles are sterile [22], RNAi method was employed. To generate spnA dsRNA, anti-sense and sense spnA RNA were produced by in vitro transcription, and
annealed. The spnA dsRNA was subjected to both agarose gel electrophoresis and RNase treatment assay to confirm approximately 1.1 kb spnA dsRNA fragment corresponding to the spnA coding region (data not shown). For spnA siRNA, 21 nucleotides of anti-sense and sense RNAs corresponding to the putative DNA binding domain at the N-terminus of SpnA were synthesized [34]. To investigate if spnA dsRNA and siRNA interferes with normal embryonic development, both RNAs were injected into pre-blastoderm embryos and the survival rate was determined (Table 1). For control experiments, injection buffer (mock injection) and white dsRNA and siRNA were used. The
1316
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
Fig. 5. Immunoblot analysis of total proteins at major developmental stages. Total proteins were extracted as described in Materials and methods and approximately 10 lg of the proteins were analyzed by SDSPAGE. After transferring onto a nitrocellulose membrane, SpnA protein was detected using chemiluminiscent method. The arrowhead indicates the 38 kDa SpnA protein. Note that SpnA protein was barely detectable in ovaries (arrow). Females and males, adult carcasses without ovaries and testes, respectively; rSpnA, purified recombinant SpnA protein. Table 1 Effect of spnA depletion by RNAi during embryogenesis Gene
RNA
Injection buffer (mock) white dsRNA siRNA spnA dsRNA siRNA
No. of embryos
No. of larvae
% Hatching
1371
975
71.1
1612 1349 1665 1538
1060 855 0 0
65.8 63.4 0 0
Either dsRNA or siRNA was injected into pre-blastoderm embryos and the survival rate was calculated as total number of larvae hatched out/ total number of embryos injected · 100.
white gene is involved in the process of eye pigmentation and does not affect viability during Drosophila development. The survival rates of mock injection and white dsRNA/siRNA injection were more than 60% (N > 1300). However, when either spnA dsRNA or siRNA were injected, embryos ceased developing at stage 13/14 and did not survive beyond embryonic stage (N > 1500), suggesting that spnA RNAs interfered with the function of SpnA in normal embryonic development (Table 1). RNAi was also performed in Drosophila S2 cell line isolated from late stage embryos; however, the viability of S2 cells was not affected by depletion of spnA (data not shown). These results imply a role of SpnA during early embryonic development. Discussion Rad51 protein has been demonstrated to possess DNA binding activity, ATPase activity, and strand transfer activity [3–7]. These properties are essential to homologous recombination since the primary function of Rad51 protein is to bring two homologous DNA molecules into close proximity to facilitate the formation of heteroduplex DNA and to mediate strand exchange between them. Thus, the presumptive first step of homologous recombination is
binding of Rad51 protein to the DNA molecule. In the present study, the DNA binding activity of SpnA protein is demonstrated in a Mg2+-dependent but ATP-independent manner. A substantial body of biochemical evidence indicates that the binding reaction of Rad51 protein is affected by nucleotide cofactors, Mg2+ concentration, and salt concentration [25,26,35]. In contrast to Mg2+ which is an indispensable factor for DNA binding assay, the precise role of ATP is still controversial. It has been reported that yeast Rad51 protein binds to both ds- and ssDNA only in the presence of ATP and that neither ADP nor the nonhydrolyzable ATP analogues can substitute the function of ATP [35]. In contrast, Zaitseva et al., demonstrated the binding of yeast Rad51 protein to DNA in the absence of nucleotide cofactor at low pH condition [26]. A study using human Rad51 protein also represented that both ds- and ssDNA binding activities are not dependent upon a nucleotide cofactor [25]. Therefore, it is not surprising that ATP is not an essential factor for DNA binding of SpnA protein. Recently, the Drosophila Rad51 homolog, SpnA protein is also shown to be involved in the strand exchange step [36]. Although the precise biochemical properties of SpnA protein remain to be determined, these results strongly support the central role of SpnA in repair of DSBs by homologous recombination. Several studies using mouse spermatocytes and oocytes have reported that Rad51 foci appear as early as premeiotic S phase before the initiation of synapsis. These foci are increased in number and become organized during leptotene, and then, dramatically decreased as pachytene progresses [8–10,37]. In this study, SpnA foci were also observed during early prophase I and rapidly disappeared at late prophase I of the spermatocytes of hsp26-spnA transformants. Although it is not a physiological condition, the time course of appearance of SpnA and its distribution in spermatocytes are similar to mammalian Rad51 homologs. The failure to detect SpnA foci in wild type spermatocytes suggest that SpnA might be absent or, if any, at very low level in the spermatocytes. A previous study also reported no role of SpnA in male meiotic chromosome pairing [23], a diagnostic phenotype in meiotic recombination. Taken together with the observation that spnA null mutant males are fertile [22], SpnA may be dispensable during Drosophila spermatogenesis unlike mammalian Rad51 proteins. The disruption of rad51 gene in mice results in early embryonic lethality, indicating a crucial role of Rad51 in embryogenesis [17,18]. Since the cells are rapidly dividing during embryogenesis, Rad51 might be required for the cell proliferation, cell cycle control, DNA replication, or transcription possibly by interacting with p53, Brca1, or Brca2 [38]. However, the precise role of Rad51 protein during embryogenesis is not understood yet. In contrast to mammals, Drosophila spnA null mutants are viable although they are defective in recombination and DNA repair [22]. The survival of Drosophila mutants might be explained by the presence of maternal SpnA proteins for early embryonic
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
development. The depletion of maternally stored spnA transcript may demonstrate a possible role of SpnA in rapidly dividing cells during early development. Staeva-Vieira et al., generated double mutants for spnA and mei-W68 [22] to escape the complete sterility of spnA mutant females caused by defects in DNA repair during oogenesis. meiW68 is the Drosophila homolog of Spo11 that induces the DSB formation [39]. Since spnA phenotypes are suppressed by mei-W68 mutation, the double mutants are fertile and their progeny survive to adulthood [22], suggesting that SpnA may not be essential for viability. In this study, in an attempt to examine the phenotype caused by the depletion of SpnA solely, the maternal effect of SpnA was eliminated by employing RNAi technique. Interestingly, the results showed that both dsRNA and siRNA targeting spnA severely interfered with normal development, implying a role of SpnA during embryogenesis. It is possible that SpnA functions in the repair of mis-incorporated nucleotides during DNA replication or in the removal of nucleotide wastes during embryogenesis [19]. Although many SpnA foci associate with unknown material stained with DAPI during mitosis, the role of SpnA in embryonic development is unclear and need to be addressed in the future experiments. Acknowledgments I would like to thank S.-K. Lee and B. Mozer for critical reading of the manuscript and B.D. McKee for intellectual input and valuable discussions. References [1] P. Baumann, S.C. West, Role of the human Rad51 protein in homologous recombination and double-stranded-break repair, Trend Biol. Sci. 23 (1998) 247–251. [2] W. Edelmann, R. Kucherlapati, Role of recombination enzymes in mammalian cell survival, Proc. Natl. Acad. Sci. USA 93 (1996) 6225– 6227. [3] P. Sung, Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein, Science 265 (1994) 1241–1243. [4] P. Baumann, S.C. West, The human Rad51 protein: polarity of strand transfer and stimulation by hRP-A, EMBO J. 16 (1997) 5198–5206. [5] E.F. Benson, P. Baumann, S.C. West, Synergistic actions of Rad51 and Rad52 in recombination and DNA repair, Nature 391 (1998) 401–407. [6] G. Petukhova, S. Stratton, P. Sung, Catalysis of homologous DNA pairing by yeast Rad51 and Rad54 protein, Nature 393 (1998) 91–94. [7] P. Sung, Yeast Rad55 and Rad57 proteins form a hetero dimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase, Genes Dev. 111 (1997) 1111–1121. [8] T. Ashley, A.W. Plug, J. Xu, A.J. Solari, G. Reddy, Dynamic changes in Rad51 distribution on chromatin during meiosis in male and female vertebrates, Chromosoma 104 (1995) 19–28. [9] A.W. Plug, J. Xu, G. Reddy, E.I. Golub, T. Ashley, Presynaptic association of Rad51 protein with selected sites in meiotic chromatin, Proc. Natl. Acad. Sci. 93 (1996) 5920–5924. [10] P.B. Moens, D.J. Chen, Z. Shen, N. Kolas, M. Tarsoumas, H.H.Q. Heng, B. Spyropoulos, Rad51 immunocytology in rat and mouse spermatocytes and oocytes, Chromosoma 106 (1997) 207–215. [11] A. Barlow, F.E. Benson, S.C. West, M.A. Hulte´n, Distribution of the Rad51 recombinase in human and mouse spermatocytes, EMBO J. 16 (1997) 5207–5215.
1317
[12] D.K. Bishop, RecA homologs Dmc1 and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis, Cell 79 (1994) 1081–1092. [13] B. Rockmill, M. Sym, H. Scherthan, S. Roeder, Roles of two recA homologs in promoting meiotic chromosome synapse, Genes Dev. 9 (1995) 2684–2695. [14] T. Haaf, E.I. Golub, G. Reddy, C.M. Radding, D.C. Ward, Nuclear foci of mammalian Rad51 recombination protein in somatic cells after DNA damage and its localization in synaptonemal complexes, Proc. Natl. Acad. Sci. USA 92 (1995) 2298–2302. [15] A. Shinohara, H. Ogawa, T. Ogawa, Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein, Cell 69 (1992) 457–470. [16] T. Ogawa, A. Shinihara, A. Nabetani, T. Ikeya, X. Yu, E.H. Egelmam, H. Ogawa, RecA-like recombination proteins in eukaryotes: Functions and structures of Rad51 genes, Cold Spring Harb. Symp. Quant. Biol. 58 (1993) 567–576. [17] D.-S. Lim, P. Hasty, A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53, Mol. Cell. Biol. 16 (1996) 7133–7143. [18] T. Tsuzuki, Y. Fujii, K. Sakumi, Y. Tominaga, K. Nakao, M. Sekiguchi, A. Matsushiro, Y. Yoshimura, T. Morita, Targeted disruption of the Rad51 gene leads to lethality in embryonic mice, Proc. Natl. Acad. Sci. USA 93 (1996) 6236–6240. [19] E. Sonoda, M. Sasaki, J.-M. Buerstedde, O. Bezzubova, A. Shinohara, H. Ogawa, M. Takata, Y. Yamaguchi-Iwai, S. Takeda, Rad51deficient vertebrate cells accumulate chromosomal breaks prior to cell death, EMBO J. 17 (1998) 598–608. [20] E. Akaboshi, Y. Inoue, H. Ryo, Cloning of the cDNA and genomic DNA that correspond to the recA-like gene of Drosophila melanogaster, Jpn. J. Genet. 69 (1994) 663–670. [21] B.D. McKee, X.-J. Ren, C.-S. Hong, A recA-like gene in Drosophila melanogaster that is expressed at high levels in female but not male meiotic tissues, Chromosoma 104 (1996) 479–488. [22] E. Staeva-Vieira, S. Yoo, R. Lehmann, An essential role of DmRad51/SpnA in DNA repair and meiotic check point control, EMBO J. 22 (2003) 5863–5874. [23] S. Yoo, B.D. McKee, Functional analysis of the Drosophila Rad51 gene (spn-A) in repair of DNA damage and meiotic chromosome segregation, DNA Repair 4 (2005) 231–242. [24] S. Yoo, B.D. McKee, Overexpression of Drosophila Rad51 protein (DmRad51) disrupts cell cycle progression and leads to apoptosis, Chromosoma 113 (2004) 92–101. [25] F.E. Benson, A. Stasiak, S.C. West, Purification and characterization of the human Rad51 protein, an analogue of E. coli RecA, EMBO J. 13 (1994) 5764–5771. [26] E.M. Zaitseva, E.N. Zeitsev, S.C. Kowalczykowski, The DNA binding properties of Saccharomyces cerevisiae Rad51 protein, J Biol. Chem. 274 (1999) 2907–2915. [27] D.E. Adams, I.R. Tsaneva, S.C. West, Dissociation of RecA filaments from duplex DNA by the RuvA and RuvB DNA repair protein, Proc. Natl. Acad. Sci. USA 91 (1994) 9901–9905. [28] M. Ashburner, Drosophila: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989. [29] C. Pisano, S. Bonaccorsi, M. Gatti, The kl-3 loop of the Y chromosome of Drosophila melanogaster binds a tektin-like protein, Genetics 133 (1993) 569–579. [30] U.K. Laemmli, Cleavage of structural proteins during assembly of the head bacteriophage T4, Nature 227 (1970) 680–685. [31] A.I. Ivanov, A.C. Rovescalli, P. Pozzi, S. Yoo, B. Mozer, H.-P. Li, S.-H. Yu, H. Higashida, V. Guo, M. Spencer, M. Nirenberg, Genes required for Drosophila nervous system development identified by RNA interference, Proc. Natl. Acad. Sci. USA 101 (2004) 16216– 16221. [32] J.R. Kennerdell, R.W. Carthew, Heritable gene silencing in Drosophila using double-stranded RNA, Nat. Biotech. 18 (2000) 896–898.
1318
S. Yoo / Biochemical and Biophysical Research Communications 348 (2006) 1310–1318
[33] L. Misquitta, B.M. Paterson, Targeted disruption of gene function in Drosophila by RNA interference (RNAi): a role for nautilus in embryonic somatic muscle formation, Proc. Natl. Acad. Sci. USA 96 (1999) 1451–1456. [34] D.S. Shin, L. Pellegrini, D.S. Daniels, B. Yelent, L. Craig, D. Bates, D.S. Yu, M.K. Shivji, C. Hitomi, A.S. Arvai, N. Volkmann, H. Tsuruta, T.L. Blundell, A.R. Venkitaraman, J.A. Tainer, Full-length archaeal Rad51 structure and mutants: mechanisms for RAD51 assembly and control by BRCA2, EMBO J. 22 (2003) 4566–4576. [35] E.A. Namsaraev, P. Berg, Binding of Rad51p to DNA. Interaction of Rad51p with single- and double-stranded DNA, J. Biol. Chem. 273 (1998) 6177–6182.
[36] V. Alexiadis, J.T. Kadonaga, Strand pairing by Rad54 and Rad51 is enhanced by chromatin, Genes Dev. 16 (2002) 2767–2771. [37] M. Tarsounas, T. Morita, R.E. Pearlman, P.B. Moens, Rad51 and Dmc1 form mixed complexes associated with mouse meiotic chromosome cores and synaptonemal complexes, J. Cell Biol. 147 (1999) 207–219. [38] C. Richardson, RAD51, genomic stability, and tumorigenesis, Cancer Lett. 218 (2005) 127–139. [39] K.S. McKim, A. Hayashi-Hagihara, mei-W68 in Drosophila melanogaster encodes a Spo11 homolog: evidence that the mechanism for initiating meiotic recombination is conserved, Genes Dev. 12 (1998) 2932–2942.