Characterization of exopolysaccharide and ropy capsular polysaccharide formation by Weissella

Food Microbiology 46 (2015) 418e427

Contents lists available at ScienceDirect

Food Microbiology journal homepage: www.elsevier.com/locate/fm

Characterization of exopolysaccharide and ropy capsular polysaccharide formation by Weissella Saskia Katharina Malang a, Ndegwa Henry Maina b, Clarissa Schwab a, Maija Tenkanen b, Christophe Lacroix a, * a b

Laboratory of Food Biotechnology, Institute of Food, Nutrition and Health, ETH Zürich, Schmelzbergstrasse 7, 8092, Zürich, Switzerland Department of Food and Environmental Sciences, P.O. Box 27, FI-00014, University of Helsinki, Finland

a r t i c l e i n f o

a b s t r a c t

Article history: Received 8 April 2014 Received in revised form 4 August 2014 Accepted 29 August 2014 Available online 7 September 2014

With their broad functional properties, lactic acid bacteria derived high molar mass exopolysaccharides (EPS) and oligosaccharides are of great interest for food, medical and pharmaceutical industry. EPS formation by 123 strains of Weissella cibaria and Weissella confusa, was evaluated. Dextran formation from sucrose was observed for all tested strains while 18 strains produced fructan in addition to dextran. Six isolates synthesized a highly ropy polymer from glucose associated with the formation of a cellbound, capsular polysaccharide (CPS) composed of glucose, O-acetyl groups and two unidentified monomer components. The soluble EPSs of nine strains were identified as low a-1,3-branched dextran, levan and inulin type polymers using NMR. In addition to glucan and fructan, W. confusa produced glucoand fructooligosaccharides. Partial dextransucrase and fructansucrase sequences were characterized in the selected Weissella strains. Our study reports the first structural characterization of fructan type EPS from Weissella as well as the first Weissella strain producing inulin. Production of more than one EPS-type by single strains may have high potential for development of applications combining EPS technological and nutritional benefits. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Weissella Exopolysaccharide Capsular polysaccharide Dextran Inulin Levan

1. Introduction Bacterial exopolysaccharides (EPS) produced by lactic acid bacteria (LAB) are extensively investigated biomolecules that exhibit heterogeneous composition, structure and broad range of physicochemical properties and applications (Ruas-Madiedo et al., 2009). EPS are reported to function as health promotors and to improve rheological properties, mouthfeel and storability of foods, for e.g. fermented milk and breads (Galle et al., 2012a; Hassan, 2008; Ruas-Madiedo et al., 2009). EPS and capsular polysaccharide (CPS) producers are frequently identified among Streptococcus, Lactococcus, Lactobacillus, Leuconostoc and Weissella

Abbreviations: LAB, lactic acid bacteria; EPS, exopolysaccharides; HoPS, homopolysaccharides; HePS, heteropolysaccharide; CPS, capsular polysaccharides; OS, oligosaccharides; FOS, fructooligosaccharides; FS, fructansucrase; GS, glucansucrase; MW, molecular weight; MM, molar mass. * Corresponding author. Schmelzbergstrasse 7; ETH Zurich, 8092 Zürich, Switzerland. Tel.: þ41 44 632 48 67; fax: þ41 44 632 14 03. E-mail addresses: [email protected] (S.K. Malang), henry.maina@ helsinki.fi (N.H. Maina), [email protected] (C. Schwab), maija. tenkanen@helsinki.fi (M. Tenkanen), [email protected] (C. Lacroix). http://dx.doi.org/10.1016/j.fm.2014.08.022 0740-0020/© 2014 Elsevier Ltd. All rights reserved.

species (Bounaix et al., 2009; Monsan et al., 2001; Mozzi et al., 2006). LAB EPS comprise a heterogenous group of polymers which are mostly classified based on composition and cellular attachment. Homo- and heteropolysaccharides (HoPS and HePS) consist of one or several monomer components, respectively. EPS are loosely attached to the cell or secreted to the environment while CPS are covalently bound to the cell surface (Sutherland, 1972). The formation of HePS, CPS and b-glucan (HoPS) requires sugar nucleotide intermediates as precursors and is directly linked to the growth and the central carbon metabolism of the producer organism (De Vuyst and Degeest, 1999). HePS and CPS formation is controlled by complex eps or cps gene clusters (Jolly and Stingele, 2001; Yasuda et al., 2008) while b-glucans are polymerized from UDP-glucose by a single transmembrane glycosyltransferase (Werning et al., 2006). The most abundant monomer building blocks of HePS are glucose, galactose and rhamnose while N-acetyl-D-glucosamine, Nacetyl-D-galactosamine, fucose, mannose, ribose as well as inorganic substitutions might be present with lower frequency (De Vuyst and Degeest, 1999). CPS can structurally be of the HoPS or HePS type (Mozzi et al., 2006). In contrast, b-fructan and a-glucan HoPS synthesis involves single extracellular or cell-wall associated fructansucrases (FS) and

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427

glucansucrases (GS), respectively. FS and GS are glycoside hydrolases (GH) and classified into families GH68 and GH70, respectively (www.cazy.org). Hydrolysis of the glycosidic bond of sucrose provides these glycansucrases with the energy required to catalyse the transfer reaction of the glycosyl moiety to the growing polymerchain, this reaction is thus uncoupled from growth (Monsan et al., 2001). The a-glucan polymers are classified based on types of glycosidic linkages into dextrans (>50% a-1,6), mutans (>50% a1,3), alternans (alternating a-1, 3 and a-1,6-linkages) and reuterans (a-1,4 with some a-1,6 branches) (Monsan et al., 2001). Betafructans are separated into levans consisting of mainly (2,6)linked-b-D-fructofuranosyl units, and inulins with (2,1)-linked-bD-fructofuranosyl residues (Monsan et al., 2001). Glycansucrases can also produce oligosaccharides (OS) in the presence of acceptor molecules (Tieking et al., 2005). Cereals, vegetables and other plant materials are natural habitats of Weissella cibaria and Weissella confusa, which are associated with mixed LAB populations and are frequently isolated from traditionally fermented foods such as sourdough (Robert et al., 2009), fermented vegetables (Park et al., 2013; Shukla and Goyal, 2011), raw milk and fermented dairy (Ayeni et al., 2011; Van der Meulen et al., 2007). Dextran production from sucrose is regarded as phenotypic identification characteristic of the closely related W. confusa and W. cibaria (Bjorkroth et al., 2002). W. cibaria and W. confusa strains have been used for in-situ dextran and glucooligosaccharide formation to improve wheat and gluten-free breads (Galle et al., 2012a; Katina et al., 2009; Schwab et al., 2008). Furthermore, strains of W. cibaria were suggested as probiotic bacteria for oral health, inhibiting Streptococcus mutans glucan biofilm formation and proliferation by their produced dextran (Kang et al., 2006). Most studies on EPS-producing Weissella strains focused on dextran produced by strains isolated from European sourdoughs. This study aimed to investigate EPS production of W. confusa and W. cibaria strains previously isolated from African fermented milk and cassava products (Kastner, 2008; Wullschleger et al., 2013). Isolates with different EPS phenotypes were characterized to elucidate the EPS structures and identify genes and enzymes involved in EPS biosynthesis. 2. Material and methods 2.1. Materials, strains and growth conditions Strains were grown in standard MRS media (De Man et al., 1960) containing 20 g/l glucose (Biolife, Labo-Life S
arl, Pully, Switzerland) or modified MRS in which glucose was replaced with sucrose (MRSsuc), maltose (MRSmal) or raffinose (MRSraf) (Table 1). To promote growth, raffinose media were supplemented with 5 g/l maltose and/or glucose as indicated (Table 1). Solid plates were prepared by addition of 1.5% (w/v) agar. Liquid media were filtersterilized (0.2 mm PES, bottle-top vacuum filtration system, VWR International AG, Dietikon, Switzerland) and sugars for solid media were autoclaved separately. All Weissella strains were obtained from the Laboratory of Food Biotechnology culture collection and previously isolated from African spontaneously fermented Malian sour milk or cassava products from Ivory Coast. Isolates were identified to species level by polyphasic approach including phenotypic and molecular typing methods (Kastner, 2008; Wullschleger et al., 2013). The strains used as controls for EPS screening were: EPS negative Weissella paramesenteroides DSM20288T, dextran-producing W. confusa DSM20196T, dextran and fructan-producing Leuconostoc mesenteroides DSM20343T (Deutsche Sammlung von Zellkulturen und Mikroorganismen GmbH, Braunschweig, Germany), and HePSproducing Lactobacillus rhamnosus RW9595 (Van Calsteren et al.,

419

Table 1 Media and growth conditions used for screening, EPS isolation and OS production.

Screening Glucan production Fructan production HePS/CPS production EPS isolation Glucan, Glucan þ fructan Fructan CPS OS production GOS

FOS

Sugar supplement per L MRS medium

Medium type

Incubation conditions

40 g sucrose 40 g raffinose 5 g glucose 40 g glucose

Agar plate Agar plate

30  C, 48 h 30  C, 48 h

Agar plate

30  C, 48 h

60 g sucrose

Agar plate

30  C, 96 h

60 g raffinose 5 g glucose 20 g glucose

Agar plate

30  C, 96 h

Broth

30  C, 24 h

Broth

30  C, 24 h

Broth

30  C, 24 h

40 g sucrose 5 g glucose 5 g maltose 40 g raffinose 5 g glucose 5 g maltose

2002). Stock cultures were kept at 80  C in 50% (v/v) glycerol and propagated twice in MRS broth before use. Liquid cultures were prepared by inoculation of 10 ml in glass flasks at 1% (v/v) and incubated statically at 30  C for 48 h if not otherwise stated. Agar plates were incubated anaerobically (anaerobic jars with Anaerogen, Oxoid AG, Pratteln, Switzerland). 2.2. Screening for EPS and CPS production In total, 123 strains of W. confusa (110 strains) and W. cibaria (13 strains) were screened for the production of EPS. EPS biosynthesis was evaluated on solid media as described by Bounaix et al. (2009) with modifications for EPS type differentiation based on the use of different carbon sources (Table 1). Sucrose was used to determine HoPS formation of the glucan and fructan type. Raffinose, acting exclusively as substrate for fructansucrases without being converted by glucansucrases, was used to specifically identify fructan formation (Malik et al., 2009). To differentiate HePS and/or CPS formation from HoPS formation, strains were grown in MRS supplied with glucose (MRSglc). Liquid precultures were prepared in microplates (96 wells) which allowed fast transfer to different media and spotting to agar plates using Multichannel pipettes. Strains were cultured once in 300 ml MRS broth before being transferred to the three screening media containing 40 g/l of carbon substrate. After the second subcultivation, the corresponding solid medium was spotted with 2 ml liquid culture. Phenotypic appearance of EPS produced on plates was assessed by estimation of strand length formed after touching with a loop and evaluation of general slime consistency and assignment of attributes liquid, compact or firm. CPS was visualized by light microscopy after negative staining with india ink as described by Ferreira et al. (2002). Negative staining allowed the observation of a polysaccharide layer surrounding the cells as light halo. Counterstaining with crystal violet stained the cells blue facilitating the differentiation of CPS negative cells on dark background. Briefly, a drop of washed cell suspension was mixed on a glass slide with a drop of india ink (Beckton Dickinson, Allschwil, Switzerland) and spread thinly over the whole slide. After air-drying, fixation was carried out with absolute ethanol. Slides were again air-dried before counterstaining with crystal violet. Presence of CPS was evaluated by light microscopy (Leica DM12000, Leica AG, Heerbrugg, Switzerland) using oilimmersion and 1000 magnification.

420

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427

2.3. Production and isolation of EPS, CPS and OS Nine strains selected for EPS characterization were grown at 30  C under anaerobic conditions on solid MRS media supplemented with 60 g/l sucrose or 60 g/l raffinose and 5 g/l glucose (Table 1). After 96 h, cell mass was carefully collected from plates, diluted with phosphate buffered saline (PBS) and heated to 100  C for 15 min to inactivate EPS degrading enzymes. EPS suspensions were centrifuged (45 min, 12.000  g) and supernatant fractions were collected. EPS was precipitated by the addition of 3 volumes of chilled ethanol. After 24 h incubation at 4  C, precipitates were harvested by centrifugation, supernatants were discarded and the pellet was resolved in MilliQ water. Fractionated precipitation of concomitantly synthesized glucan and fructan type polymers on MRSsuc plates was performed by sequential addition of ethanol to supernatants (Wilham et al., 1955). EtOH was added starting at 30% (v/v) and increased up to a final concentration of 80% (v/v), in steps of 10%. Samples were kept at 4  C for 2 h between each addition step to allow proper precipitation and collection of EPS fraction by centrifugation (15 min, 12.000  g). Dissolved EPS extracts were freeze-dried (Alpha 1-2 LD, Christ GmbH, Osterode am Harz, Germany) before further analysis. Protein content in EPS extracts was determined using the Quick Start™ Bradford Protein Assay Reagent and bovine g-globuline as standard according to manufacturer instructions (Bio-Rad Laboratories, Reinach, Switzerland). CPS fractions were isolated from cells grown in MRS broth containing 20 g/l glucose. Cells were harvested from 24 h grown cultures, washed twice with PBS and finally re-suspended in 1/10 of the initial volume. Cell suspensions were heated at 90  C for 15 min to detach cell bound polysaccharides (Mende et al., 2013). Cells were removed by centrifugation (15 min, 12.000  g) and polysaccharides were isolated from supernatants as described above. GOS and FOS production by selected Weissella strains was investigated in modified MRS broth containing either 40 g/l sucrose or raffinose, respectively, and 5 g/l glucose and maltose (Table 1). The amount of sucrose was lowered to 40 g/l for OS production to decrease viscosity and improve ultrafiltration performance. Cultures were freeze-dried and dry material resuspended in 0.05 M sodium citrate buffer pH 5.5 at a concentration of 50 mg/ml. Suspensions were centrifuged (10 min, 12.000 g) and supernatants subjected to ultrafiltration using centrifugal filter units (Amicon Ultra-0.5 10 kDa, Merck Millipore, Darmstadt, Germany) to remove high molar mass carbohydrates. Filtrates were passed through 0.45 mm nylon membrane filters (Arcodisc, Pall, Ann Arbor, USA) before analysis by high performance anion exchange chromatography. 2.4. Structural characterization of EPS, CPS and OS 2.4.1. Acid hydrolysis for determination of monomer composition Acid hydrolysis of total and separated EPS fractions and CPS extracts was conducted by the addition of 0.75 ml 1.75 M perchloric acid to 4 mg of dry polysaccharide. The samples were incubated at 80  C for 2 or 16 h for hydrolysis of fructan or glucan, and CPS, respectively, followed by neutralization with 5 M KOH (Bounaix et al., 2009). Supernatants were passed through 0.45 mm nylonmembrane filters (Infochroma, Zug, Switzerland) and subjected to monosaccharide analysis by HPLC (Merck Hitachi, Darmstadt, Germany) equipped with a HPX-87H column (300  7.8 mm; Aminex; Bio-Rad Laboratories, Reinach, Switzerland) with a CationH guard cartridge (Bio-Rad) at an oven temperature of 40  C, 10 mM H2SO4 at a flow rate of 0.6 ml/min as eluent and a RI detection system (Hugenschmidt et al., 2010). Peak identification and quantification was performed using galactose, mannose, xylose, glucose, fructose, rhamnose, acetic-, lactic- and glucuronic acid as external standards.

2.4.2. NMR spectroscopy (1D 1H spectra) EPS fractions (10 mg/ml) were exchanged once with D2O, lyophilized, resolved in D2O and transferred to NMR tubes (VWR International). 1D 1H NMR spectra were recorded on a Bruker Avance III 600 MHz spectrometer at 50  C using 16 scans and chemical shifts referenced to internal acetone (1H ¼ 2.225 ppm). Chemical shift assignment were carried out according to Matulova et al. (2011) for fructans and as reported by Maina et al. (2008) for dextrans. The ratio of a-(1,3) and a-(1,6)-linkages in the dextrans were calculated by integration of corresponding anomeric peaks using Bruker topspin 3.2 software. 2.4.3. EPS molar mass estimation Size of isolated polymer in total and separated fractions was estimated by high performance gel permeation chromatography (HP-GPC) carried out with an HPLC system equipped with a Sephacryl S-500HR High Resolution Hiprep 16/60, 1  120 ml GPC column with a separation range of 4  104 to 2  107 g/mol for dextrans (GE Healthcare Biosciences, Uppsala, Sweden). NaCl (0.25 M) was used as eluent at a flow rate of 0.5 ml/min. EPS samples were dissolved in eluent at a concentration of 4 mg/ml, passed through a 0.45 mm cellulose acetate filter membrane € ttingen, Germany) and 0.4 ml was injected (Minisart, Sartorius, Go to the system. Dextran standard solutions of 50, 150, 470, 670 (Sigma, Buchs, Switzerland), 1900 and 5900 kg/mol (American Polymer Standards Corporation, Mentor, USA) were prepared as described for EPS extracts and used for calibration of the column. 2.4.4. Determination of OS production Production of GOS and FOS was investigated by high performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD) as described earlier (Rantanen et al., 2007; Shukla et al., 2014). In short, an analytical CarboPac PA-100 column (Dionex, Sunnyvale, USA) and a decade detector with gold electrode (Antec Leyden, Zoeterwoude, Netherlands) were used in a Waters HPLC system. Oligosaccharides were eluted using a 100 mM NaOH1 M NaOAc gradient at flow rate of 1 ml/min and D-glucose, Dfructose, sucrose, maltose, isomaltose, isomaltotriose and panose used as standard. 2.5. Screening for glycosyltransferase and glycansucrase encoding genes DNA was isolated from MRS grown cultures using the method of Goldenberger et al. (1995). Primers targeting the catalytic regions of dextran- and fructansucrases, conserved priming glycosyltransferase of HePS gene clusters and transmembrane glycosyltransferase involved in b-glucan synthesis were used (Table 2). Amplicons were sequenced by GATC Biotech (Konstanz, Germany) and searched for protein homologies using NCBI blastx (blast.ncbi. nlm.nih.gov). Translation tool from ExPASy (http://www.expasy. org/) was used to translate nucleotide sequences into amino acid sequences and clustalw (http://www.ebi.ac.uk/Tools/msa/ clustalw2/) was selected for alignment and sequence homology calculation. Nucleotide sequences of partial dextran, levan and inulosucrase are available in the EMBL nucleotide sequence database under accession numbers HG970178 to HG970189. 2.6. Activity staining of glycansucrases For detection of active glycansucrases and estimation of their molecular weight (MW), supernatants of MRS grown Weissella cultures or partially purified protein extracts were used. Proteins were extracted from supernatant by a modified PEG fractionation protocol (Siddiqui et al., 2013), in which polyethylene glycol-4000

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427

421

Table 2 Primers and PCR conditions used to detect genes related to EPS synthesis in Weissella strains. Primer

Sequence (5'e3')

Target gene

Expected fragment size

PCR conditions

Reference

FTF2-F FTF2-R

GAYRTYTGGGAYWSNTGGC GCWGANCCNGACCATTSTTG

Fructansucrase

220 bp

Bounaix et al. (2009)

WcibDex fw WcibDex rev

GCATCTTTCAATACTTGAGG CATGACTTGTTGGCATAGC

W. cibaria dextransucrase

1000 bp

WconDex fw WconDex rev

TGTGGATTCAGGACACCGTA GGTTCAATCACGGCTAACG

W. confusa dextransucrase

1037 bp

G-Lr-Bact-b-F-20 G-Lr-Bact-b-R-20

TTGCCAAATATTGGAGGGGT TTTAATAGGCTCCAGTTGGA

Priming glycosyltransferase

694 bp

Gtft fw Gtft rev

CGGTAATGAAGCGTTTCCTG GCTAGTACGGTAGACTTG

Transmembrane glycosyltransferase

420 bp

1 (94  C, 5 min); 30 (94  C, 45 s; 55  C, 30 s; 72  C, 30 s); 1 (72  C, 10 min) 1 (94  C, 3 min); 32 (94  C, 30 s; 56  C, 1 min; 72  C 1.5 min); 1 (72  C, 7 min) 1 (94  C, 4 min.); 30 (94  C, 30 s; 52  C, 1 min; 72  C, 100 s); 1 (72  C, 7 min) 1 (94  C, 4 min.); 30 (94  C, 30 s; 58  C, 1 min; 72  C, 60 s); 1 (72  C, 7 min) 1 (95  C,4 min); 30 (95  C, 1 min; 55  C,1 min; 72  C, 30 s); 1 (72  C 7 min)

(PEG-4000) was replaced by addition of PEG-1300 to a final concentration of 33%. Sodium dodecyl-sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed similar as described by Bounaix et al. (2010). Cell free supernatant or protein extract (60 ml) were mixed with 20 ml 4 Laemmli buffer, incubated for 10 min at 70  C and centrifuged for 5 min at 12.000 g to separate solid residues. Each 20 ml of Precision Plus Protein Standard and samples were separated on precast 7.5% Mini Protean TGX gels (all from Biorad, Reinach, Switzerland). Separated proteins were renatured in sodium-acetate pH 5.4 containing 0.05 g/l CaCl2 and 0.1% v/v Triton X-100 for 1 h followed by over-night in-situ polymer formation in the same buffer supplemented with 100 g/l sucrose or raffinose to detect active glucan- and fructansucrases, respectively. Polymers were fixed for 1 h in a solution of 70% (v/v) ethanol and 5% (v/v) acetic acid and visualized by periodic acid Schiff staining (PAS) applying oxidation for 45 min in 1% (w/v) periodic acid, washing in water for 1 h and staining with Schiff's reagent (Merck, Darmstadt, Germany) until magenta bands were visible. 3. Results 3.1. Prevalence of EPS and CPS production in W. cibaria and W. confusa A phenotypic screening using agar plates supplemented with sucrose, raffinose or glucose was used for identification and differentiation of EPS phenotypes within 123 strains of the genus Weissella. All W. confusa (110) and W. cibaria (13) strains produced EPS from sucrose. W. cibaria strains formed EPS only from sucrose but no polymer was formed on raffinose indicating glucan but no fructan biosynthesis. In contrast, 18 W. confusa strains (16.4%) synthesized fructan from raffinose additionally to glucan from sucrose. Six strains (5.5%) produced ropy colonies on MRSglc medium in addition to glucan from sucrose as shown by formation of strands by extension of a colony with a loop. Investigation of CPS by light microscopy of negatively stained preparations of washed cells grown in MRSglc and MRSsuc broth indicated a correlation of ropiness and CPS formation. The size of the capsule was larger when strains were grown in the presence of glucose than with sucrose (Fig. 1). Subsequently, Weissella strains were categorized into three groups: (i) dextran producers; (ii) strains synthesizing dextran and fructan; and (iii) strains producing dextran and ropy CPS. For further characterization, three strains per group, each possessing different phenotypic EPS appearance ranging from liquid to firm

Galle et al. (2010)

This study

Provencher et al. (2003)

Werning et al. (2006)

and with different degrees of ropiness, were selected to cover EPS diversity (Table 3). 3.2. Isolation and monomer determination of EPS and CPS EPS of all nine strains produced on MRSsuc and MRSraf were precipitated by ethanol at a final concentration of 75% (v/v) (Table 3). Separation of glucan and fructan fractions produced by the three fructan producers on MRSsuc, was carried out by fractional ethanol precipitation. Two distinct EPS fractions were obtained; a large fraction precipitated at 30% ethanol contained dextran, the second main fraction was obtained at 60% ethanol for strains F3/2-2 and E5/2-1 and 70% ethanol for strain G3/2-2 and corresponded to fructans (Table 3). Subsequent acid hydrolysis and monomer analysis confirmed that both separated fractions contained less than 1% residual contamination calculated based on EPS dry weight subjected to hydrolysis. Acid hydrolysis of dextran and fructan extracts released only glucose or fructose, respectively. The glucan:fructan production ratio was estimated by monomer analysis of acid hydrolysed total EPS fractions and ranged from ca. 3:1 to 9:1 (glucose:fructose) (Table 3). Dextran and fructan extracts were virtually free from residual protein contaminations with less than 0.2% based on EPS dry weight. Acid hydrolysis of water insoluble CPS extracts yielded glucose (43.8e48.7%), low amounts of O-acetyl groups (19.4e19.9%) and two unidentified peaks (Table 3). CPS extracts obtained after ethanol precipitation were insoluble in water and were therefore not analysed by GPC and NMR spectroscopy. 3.3. NMR spectroscopy The 1H chemical shift in dextran, levan and inulin each corresponded to their main chain residues (Table 4; Fig. 2). Dextran spectra showed all typical anomeric proton signal at 4.97 ppm and 5.32 ppm corresponding to a-(1,6) and a-(1,3)-linked glucose residues as previsouly reported (Maina et al., 2008). Equivalent chemical shifts were obtained for dextrans of the nine Weissella strains and integration of anomeric proton signals revealed polymers containing approximately 97% a-(1,6)-glycosidic linkages in the main backbone and around 3% a-(1,3)-linked branches (Table 3, Fig. 2A). Fructan-type EPS produced by W. confusa F3/2-2 and E5/21 showed identical NMR spectra and were identified as levan (b(2,6)-linked fructose residues), by comparison of chemical shifts values with references (Matulova et al., 2011) (Table 4, Fig. 2C). In contrast the polymer produced by W. confusa G3/2-2 showed

422

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427

Fig. 1. Light microscopy observations of CPS production by W. confusa strains grown in MRS containing 40 g/l glucose (AeE) or 40 g/l sucrose (FeJ) after negative staining with India ink and counterstaining of bacterial cells with crystal violet at 1000 magnification (scale bar represents 5 mm). Dextran and CPS producing strains W. confusa 8CS-2 (A, F); 11GU-1 (B, G); 11GT-2 (C, H), levan and dextran producing CPS negative strain F3/2-2 (D, I) and dextran producing CPS negative strain A3/2-1 (E, J). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

chemical shifts of inulin-type fructan (b-(2,1)-linked fructose residues) (Table 4, Fig. 2B) as previously reported by Matulova et al. (2011). Minor peaks present in the NMR spectra of the fructans, especially inulin (Fig. 2B and C) may indicated the presence of branched linkages. Identical NMR spectra were obtained for EPS derived from W. confusa strains grown in sucrose or raffinose suggesting that fructan structural characteristics were not impacted by the carbon source.

3.4. Molar mass determination All dextrans exhibited high MM exceeding the exclusion limit of the column (>2  107 g/mol) as indicated by early elution at equal retention times and confirmed by calculating the exclusion limit by extrapolation of dextran standards retention times (Table 3). Interestingly, levan fractions obtained by fractionation of total EPS of W. confusa F3/2-2 and E5/2-1 produced from sucrose or raffinose

Table 3 Source of selected Weissella isolates and EPS characterization. Strain

Origin

W. cibaria 11GM-2 Sour milk W. confusa A3/2-1 W. confusa A4/2-1 W. confusa F3/2-2

C-sourcea EPS pheno-typeb Ropynessc Sucrose

Cassava Sucrose fermentation Cassava Sucrose fermentation Cassava Sucrose fermentation

CPSd ETOHe EPS monomer composition EPS type

EPS molar mass g/mol

a-(1,6)/a-(1,3) linkages in dextran (%)

Compact-firm

e

e

75%

Glucose

Dextran

>2  107

95.4/4.6

Compact

e

e

75%

Glucose

Dextran

>2  107

96.9/3.1

Dextran

7

96.9/3.1

7

Firm

e

e

e

75%

W. confusa E5/2-1

Raffinose Liquid-compact Cassava Sucrose Liquid-compact fermentation

e e

e e

W. confusa G3/2-2

Raffinose Liquid Cassava Sucrose Compact fermentation

e e

e e

W. confusa 8CS-2

Sour milk

Raffinose Compact Sucrose Compact Glucose Compact

e þ þþþ

e þ þ

30% 60% 75% 75% 30% 60% 75% 75% 30% 70% 75% 75% 75% 75%

W. confusa 11GU-1 Sour milk

Sucrose Glucose

Compact Compact

þþ þþþ

þ þ

75% 75%

W. confusa 11GT-2 Sour milk

Sucrose Glucose

Compact Compact

þþþ þ þþþþ þ

75% 75%

a b c d e f

Liquid

e

Glucose Glucose Fructose Glucose: fructose (3.3:1) Fructose Glucose Fructose Glucose: fructose (9.1:1) Fructose Glucose Fructose Glucose: fructose (5.5:1) Fructose Glucose Glucose, O-acetyl, two unidentified peaks Glucose Glucose, O-acetyl, two unidentified peaks Glucose Glucose, O-acetyl, two unidentified peaks

>2  10

Dextran Levan Dextran/levan Levan Dextran Levan Dextran/levan Levan Dextran Inulin Dextran/inulin Inulin Dextran HePS

>2  10 2  105 >2  107/2  105 2  105 >2  107 1.4  105 >2  107/1.4  105 1.7  107 >2  107 1.9  107 >2  107/1.9  107 1.9  107 >2  107 n.d.f

97.0/3.0

Dextran HePS

>2  107 n.d.

97.2/2.8

Dextran HePS

>2  107 n.d.

97.4/2.6

e 97.0/3.0

e 97.0/3.0

e 97.4/2.6

Phenotypic EPS biosynthesis observed on MRS agar supplemented with given C-source. Characteristics refer to colonies/EPS slime observed on MRS plates containing particular C-sources and described with attributes: liquid, compact or firm. Ropiness defined by elongation of colony/slime with loop: 1e10 cm: þ, 11e20 cm: þþ, 21e30 cm:þþþ, >30 cm:þþþþ, no strand: e Presence or absence of CPS evaluated by light microscopy of bacterial cells after negative staining with india ink. EPS or CPS fractions precipitated by addition of given amount absolute ethanol. n.d. not determined.

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427 Table 4 Assignments of 1H chemical shifts (ppm) of main residues in dextran, levan and inulin. Polymer

Dextran Levan Inulin

1

H chemical shiftsa

1, 1'

2

3

4

5

6, 6'

4.98 3.75, 3.68 3.91, 3.71

3.58 e e

3.73 4.18 4.25

3.51 4.07 4.09

3.91 3.94 3.87

3.77, 3.98 3.89, 3.58 3.84, 3.77

a Chemical shifts correspond to a-(1,6)-linked glucopyranosyl residues of dextran, b-(2,6)-linked fructofuranosyl residues of levan and b-(1,2)-linked fructofuranosyl residues of inulin main chain.

had different MM. Levans synthesized from raffinose showed higher MM compared to levans concomitantly synthesized with dextran during growth on sucrose (Table 3). In contrast, W. confusa G3/2-2 produced high MM inulin from both sucrose and raffinose (Table 3). 3.5. Oligosaccharide biosynthesis The nine investigated W. confusa strains produced highly similar oligosaccharides of the panose series reaching polymerization degrees (DP) of up to 18 based on the number of peaks observed in the chromatograph when grown in MRSsuc with glucose and maltose as additional acceptor molecules (Fig. 3A). (Katina et al., 2009; Shukla et al., 2014). OS profiles of levan-producing W. confusa F3/ 2-2 and E5/2-1, and inulin-synthesizing W. confusa G3/2-2 formed in the presence raffinose showed only minor differences (Fig. 3B). None of the investigated W. cibaria and W. confusa produced OS in the presence of only sucrose or raffinose. 3.6. Detection of glycansucrase encoding genes Using primer pairs WcibDex and WconDex, partial dextransucrase genes could be amplified in W. cibaria and W. confusa strains, respectively (Table 5). Partial fructansucrase genes of W. confusa were identified using primer pair FTF2. No amplicons were derived with primers targeting glycosyltransferase and transmembrane gtf. W. confusa and W. cibaria partial

423

dextransucrases had a homology of 85%. Blast search revealed also highest homology with other W. cibaria and W. confusa dextransucrases (Table 5). Partial levansucrase sequences of W. confusa F3/2-2 and E5/2-1 had highest homologies to W. confusa FTF8-2 and Lactobacillus sanfranciscensis levansucrases (Table 5). The partial inulosucrase of W. confusa G3/2-2 was highly similar to a presumptive inulosucrase of W. confusa MBFCNC-2(1) and a putative levansucrase of Lactobacillus plantarum 16 (Table 5). The two levansucrases of W. confusa F3/2-2 and E5/2-1 showed high protein homology of 98%, while homology to the inulosucrase fragment of W. confusa G3/2-2 was lower with 52%. 3.7. Glycansucrase activity staining SDS-PAGE activity staining of in-situ formed EPS revealed mainly soluble and constitutive expression of glycansucrases. Dextransucrase activity of all nine strains and inulosucrase activity of W. confusa G3/2-2 was detected in supernatant fractions as illustrated in Fig. 4A; MWs are summarized in Table 5. Fructansucrase activities were verified by comparing gels incubated in sucrose and raffinose and by using dextran-producing strain W. confusa 11GU-1 as negative control (Table 4, Fig. 4B and C). Levansucrase activity of W. confusa F3/2-2 and E5/2-1 was not detectable in cell-free MRS culture supernatant but was observed in PEG protein extracts. Faint residual bands of W. confusa 11GU-1 and G3/2-2 dextransucrases visible in raffinose-incubated gels might result either from PAS stained sugar residues bound to dextransucrases or minor activity due to some sucrose presence as cleavage product of raffinose. The double band for presumptive levansucrases of W. confusa F3/2-2 and E5/2-1 may result from diffusion of the oxidized polymers (Miller and Robyt, 1986) (Fig. 4C). 4. Discussion LAB produce compositionally and structurally diverse EPS which find applications in food industry and could have therapeutic potential (Ruas-Madiedo et al., 2009). Weissella sp. have been mainly

Fig. 2. 1D 1H NMR spectra of purified dextrans (A), inulin (B) and levans (C) produced by different strains of W. confusa recorded in D2O at 50  C and 600 MHz.

424

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427

Fig. 3. Acceptor reaction products synthesized by selected W. confusa strains during (A) 24 h growth at 30  C in modified MRS broth containing 40 g/l sucrose, 5 g/l glucose and maltose and (B) levan-producing strains F3/2-2 and E5/2-1 and inulin-producing strain G3/2-2 grown in MRS containing 40 g/l raffinose, 5 g/l glucose and maltose.

investigated for dextran formation (Bounaix et al., 2009; Shukla et al., 2014), very few information is available on other EPS types. In this study we evaluated the diversity of 123 EPS-producing phenotypes of W. confusa and W. cibaria isolated from spontaneous African cassava and milk fermentations. Three distinct phenotypic groups could be identified representing strains producing (i) dextran only, (ii) dextran and fructan of either levan or inulin type, and (iii) strains producing dextran and a CPS. Production of high molar mass dextran with few branches (approximately 3% a-(1,3)-linkages) was suggested to be a common feature of Weissella (Maina, 2012), which is in agreement

with our structure analysis of nine Weissella dextrans. Partially sequenced dextransucrases of W. confusa and W. cibaria were distinct for each species, but were almost identical to enzymes of W. confusa LBAE C-39-2 and W. cibaria LBAE K39 isolated from French sourdoughs (Amari et al., 2013; Bounaix et al., 2009). Dextransucrases were constitutively expressed in agreement with previous studies (Bounaix et al., 2010). The apparent larger size of W. cibaria 11GM-2 dextransucrase may be caused by enzyme dimerization as reported for Leuconostoc dextransucrases (Vasileva et al., 2012). In the presence of maltose, W. confusa and W. cibaria strains produced panose-series OS which are typically formed by

Table 5 Homologies of detected partial dextran and fructansucrases and size of active enzymes of dextran, dextran and fructan, and dextran and CPS producing Weissella strains. Polymer formation

Strain

Identified genes

Protein homology

Size active enzymea

Dextran producers

W. cibaria 11GM-2

dex

300 kDa

W. confusa A3/2-1

dex

W. confusa A4/2-1

dex

W. cibaria LBAE K39 DSR (CBL51479) 99% in 333 AA W. confusa LBAE C39-2 DSR (CCF30682.1) 99% in 333 AA W. confusa LBAE C39-2 DSR (CCF30682.1) 100% in 333 AA

W. confusa F3/2-2

dex

Dextran þ fructan producers

ftf

W. confusa E5/2-1

dex ftf

W. confusa G3/2-2

dex ftf

Dextran þ CPS producers

a

W. confusa 8CS-2

dex

W. confusa 11GU-1

dex

W. confusa 11GT-2

dex

180 kDa 180 kDa

W. confusa LBAE C39-2 DSR (CCF30682.1) 99% in 337 AA L. sanfranciscensis TMW.1.392 levansucrase (CAD48195) 94% in 72 AA W. confusa FTF8-2 levansucrase (ACK87020) 93% in 72 AA W. confusa LBAE C39-2 DSR (CCF30682.1) 99% in 334 AA L. sanfranciscensis TMW.1.392 levansucrase (CAD48195) 95% in 76 AA W. confusa FTF8-2 levansucrase (ACK87020) 93% in 76 AA W. confusa LBAE C39-2 DSR (CCF30682.1) 100% in 334 AA W. confusa MBFCNC-2(1) fructansucrase (ADB27748) 93% in 83 AA L. plantarum 16 putative levansucrase (YP_008125076) 93% in 83 AA

180 kDa

W. confusa LBAE C39-2 DSR (CCF30682.1) 99% in 333 AA W. confusa LBAE C39-2 DSR (CCF30682.1) 99% in 317 AA W. confusa LBAE C39-2 DSR (CCF30682.1) 99% in 336 AA

180 kDa

Approximate molecular weight of active glycansucrase as observed by SDS-PAGE enzyme activity staining using sucrose and raffinose as substrates.

110 kDa

180 kDa 110 kDa

180 kDa 130 kDa

180 kDa 180 kDa

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427

425

Fig. 4. PAS stained SDS-PAGE gel showing active glycansucrases expressed during growth in MRSglc broth: (A) polysaccharides produced by glycansucrases present in cell free supernatants after incubation in the presence of sucrose. (B) polysaccharides produced by glycansucrases present in cell free MRS culture (11GU-1 and G3/2-2) and PEG protein extracts (F3/2-2 and E5/2-1) after incubation with sucrose. (C) polysaccharides formed after incubation with raffinose. W. confusa 11GU-1 served as negative control.

dextransucrases (Galle et al., 2010, 2012b; Katina et al., 2009; Shukla et al., 2014). Visual appearance of EPS produced on agar-plates ranged from very liquid to firm with different degrees of ropiness. For CPS- and fructan-producing strains this might result from simultaneous formation of two polymer types and different ratios to dextran. Strains producing only dextran also showed different phenotypic characteristics suggesting variations in polymer structures. Because the linkage ratios of dextrans from all isolates were almost identical, the different visual polymer characteristics may be due to physical properties or other factors that were not determined in this study. Also the topology and chain length of a-(1,3)-linked branches might play an important role for molecular conformation and solution properties. At present, methods allowing exact determination of the length of branches in dextrans are still missing. While dextran formation is a general characteristic of W. cibaria and W. confusa (Bjorkroth et al., 2002), the ability to additionally form fructan was observed for 18 W. confusa strains, all isolated from cassava fermentations. Fructan production has only been reported for three strains of W. confusa isolated from Malaysian soy (Malik et al., 2009), a Malaysian coconut milk beverage (Malik, 2012), and from wheat sourdough (Tieking et al., 2003). Inulin biosynthesis is rare in LAB, and only individual strains of Lactobacillus and Leuconostoc as well as few streptococci were reported to produce inulin or possess inulosucrase encoding genes (Anwar et al., 2010, 2008; Jacques, 1993; Olivares-Illana et al., 2003; Schwab et al., 2007; Van Hijum et al., 2002). In contrast to GOS, FOS produced by fructansucrases exhibited a maximal degree of polymerization of 6, which is well in agreement with the reported OS formation of DP5-6 by L. sanfranciscensis and Lactobacillus reuteri levansucrases (Ozimek et al., 2006; Tieking et al., 2005). Nonetheless, structurally different FOS may co-elute in HPAEC separation and therefore the composition may not be fully represented by the chromatographic profile observed here. For inulosucrases of L. reuteri and Lactobacillus gasseri FOS up to DP6 with traces up to DP11 were observed (Diez-Municio et al., 2013; Ozimek et al., 2006). Levansucrases of L. reuteri and L. sanfranciscensis are furthermore known to form both, b-(2,1) FOS and b-(2,6) kestose (Korakli et al., 2003; Ozimek et al., 2006). The high sequence homologies observed between fructansucrase fragments of African strains of W. confusa with fructansucrases of Asian W. confusa isolates suggested high conservation of Weissella fructansucrases. W. confusa G3/2-2 inulosucrase had higher MW (130 kDa) than lactobacilli inulosucrases, of ca. 80 kDa (Anwar et al., 2010, 2008; Schwab et al., 2007). Several mosaic

fructansucrases, comprising acquired structural domains from glucansucrases were reported within Leuconostoc sp. reaching MW up to 165 kDa (Morales-Arrieta et al., 2006; Olivares-Illana et al., 2003). In LAB, regulation of fructansucrase expression is species and strain-dependent. Our data suggested constitutive fructansucrase expression in Weissella. In contrast, Ln. citreum requires induction by sucrose while streptococci showed constitutive expression (Olivares-Illana et al., 2002). Bacterial inulins' MM range from 1 to 9  107 g/mol (Anwar et al., 2008; Shiroza and Kuramitsu, 1988; Van Hijum et al., 2002) while LAB levans' MM ranged from 105 e 2  106 g/mol (lactobacilli and Leuconostoc sp.) to 108 g/mol for Streptococcus salivarius (Jacques, 1993; Tieking et al., 2003; Van Hijum et al., 2001). Interestingly, the MM of Weissella levans (1.4  105 to 1.7  107 g/mol) depended on whether strains were grown on sucrose or raffinose as carbon source. The synthesis of lower MM levans from sucrose may be explained by the competition between levansucrase and concomitantly expressed dextransucrase for sucrose, but also by growth and incubation conditions which have been shown to impact polymer MM (Van Hijum et al., 2006). CPS formation was only present in six W. confusa sour milk isolates associating this phenotype with the dairy environment. This is in accordance with the isolation of capsular EPS forming leuconostoc, lactococci, lactobacilli and streptococci from dairy products (Hassan, 2008; Mozzi et al., 2006; Van der Meulen et al., 2007). Milk or other lactose rich media were frequently used to study CPS formation in dairy associated LAB (Hassan, 2008; Mozzi et al., 2006). W. confusa and W. cibaria were, however, in most cases not capable to utilize lactose as indicated by little growth (data not shown). In the presence of glucose, sucrose, maltose, and fructose (data not shown), strains grew well and formed CPS. The smaller capsule size during growth in sucrose medium was most likely due to competition with dextran formation. High molar mass dextrans with few branches have broad technological applicability ranging from production of biodegradable packaging films (Irague et al., 2012) to shelf-life extending, stabilizing agents for bakery products (Galle et al., 2012a; Katina et al., 2009). Prebiotic properties have been reported for inulin, levan and OS (Macfarlane et al., 2006). Ropy strains might additionally impact texture and water holding properties as e.g., CPS of Streptococcus thermophilus or Lactobacillus delbrueckii ssp. bulgaricus increased viscosity (Hassan, 2008) and moisture retention in cheese (Perry et al., 1997). The ability of some W. confusa strains to form multiple polysaccharides might be of special interest for applications using both technological functionalities of dextran and

426

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427

improvement of the nutritional value by inulin, levan or OS production. Concomitant in-situ production of more than one type of EPS could also promote synergistic effects similar to that for mixtures of hydrocolloids from other origins (Santa Cruz, 2011). 5. Conclusion We showed that Weissella strains can synthesize an outstanding pool of oligosaccharides and polymers, including high MM, low branched dextran, levan and inulin, in addition to gluco- and fructooligosaccharides, and cell associated ropy polymers. The present study offers novel insight in the diversity of EPS types produced by W. confusa and W. cibaria thereby broadening general knowledge on this species and opening numerous possibilities for future applications. Strains producing more than one EPS type are of special interest in food application as they potentially offer synergistic effects on texture (dextran, ropy CPS) and nutritional improvement (levan, inulin, OS). Acknowledgements This study was supported by a grant from the Swiss Confederation Innovation Promotion Agency (CTI, project number 10276). The Academy of Finland (project number 255755, H.N.M, T.M) is also acknowledged for the financial support. We thank Franziska Baeriswyl for technical support and Alfonso Díe for assistance in HPLC analysis. References Amari, M., Arango, L.F.G., Gabriel, V., Robert, H., Morel, S., Moulis, C., Gabriel, B., Remaud-Simeon, M., Fontagne-Faucher, C., 2013. Characterization of a novel dextransucrase from Weissella confusa isolated from sourdough. Appl. Microbiol. Biotechnol. 97, 5413e5422. Anwar, M.A., Kralj, S., Pique, A.V., Leemhuis, H., van der Maarel, M., Dijkhuizen, L., 2010. Inulin and levan synthesis by probiotic Lactobacillus gasseri strains: characterization of three novel fructansucrase enzymes and their fructan products. Microbiol. Sgm 156, 1264e1274. Anwar, M.A., Kralj, S., van der Maarel, M.J.E.C., Dijkhuizen, L., 2008. The probiotic Lactobacillus johnsonii NCC 533 produces high-molecular-mass inulin from sucrose by using an inulosucrase enzyme. Appl. Environ. Microbiol. 74, 3426e3433. Ayeni, F.A., Sanchez, B., Adeniyi, B.A., de los Reyes-Gavilan, C.G., Margolles, A., RuasMadiedo, P., 2011. Evaluation of the functional potential of Weissella and Lactobacillus isolates obtained from Nigerian traditional fermented foods and cow's intestine. Int. J. Food Microbiol. 147, 97e104. Bjorkroth, K.J., Schillinger, U., Geisen, R., Weiss, N., Hoste, B., Holzapfel, W.H., Korkeala, H.J., Vandamme, P., 2002. Taxonomic study of Weissella confusa and description of Weissella cibaria sp nov., detected in food and clinical samples. Int. J. Syst. Evol. Microbiol. 52, 141e148. Bounaix, M.S., Gabriel, V., Morel, S., Robert, H., Rabier, P., Remaud-Simeon, M., Gabriel, B., Fontagne-Faucher, C., 2009. Biodiversity of exopolysaccharides produced from sucrose by sourdough lactic acid bacteria. J. Agric. Food Chem. 57, 10889e10897. Bounaix, M.S., Robert, H., Gabriel, V., Morel, S., Remaud-Simeon, M., Gabriel, B., Fontagne-Faucher, C., 2010. Characterization of dextran-producing Weissella strains isolated from sourdoughs and evidence of constitutive dextransucrase expression. FEMS Microbiol. Lett. 311, 18e26. De Man, J.C., Rogosa, M., Sharpe, M.E., 1960. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 23, 130e135. De Vuyst, L., Degeest, B., 1999. Heteropolysaccharides from lactic acid bacteria. FEMS Microbiol. Rev. 23, 153e177. Diez-Municio, M., de las Rivas, B., Jimeno, M.L., Munoz, R., Moreno, F.J., Herrero, M., 2013. Enzymatic synthesis and characterization of fructooligosaccharides and novel maltosylfructosides by inulosucrase from Lactobacillus gasseri DSM 20604. Appl. Environ. Microbiol. 79, 4129e4140. Ferreira, E.O., Falcao, L.S., Vallim, D.C., Santos, F.J., Andrade, J.R.C., Andrade, A.F.B., Vommaro, R.C., Ferreira, M.C.S., Domingues, R.M.C.P., 2002. Bacteroides fragilis adherence to Caco-2 cells. Anaerobe 8, 307e314. Galle, S., Schwab, C., Arendt, E., Gaenzle, M., 2010. Exopolysaccharide-forming Weissella strains as starter cultures for sorghum and wheat sourdoughs. J. Agric. Food Chem. 58, 5834e5841. Galle, S., Schwab, C., Dal Bello, F., Coffey, A., Gaenzle, M.G., Arendt, E.K., 2012a. Influence of in-situ synthesized exopolysaccharides on the quality of gluten-free sorghum sourdough bread. Int. J. Food Microbiol. 155, 105e112.

Galle, S., Schwab, C., Dal Bello, F., Coffey, A., Ganzle, M., Arendt, E., 2012b. Comparison of the impact of dextran and reuteran on the quality of wheat sourdough bread. J. Cereal Sci. 56, 531e537. Goldenberger, D., Perschil, I., Ritzler, M., Altwegg, M., 1995. A simple universal DNA extraction procedure using SDS and proteinase-K is compatible with direct PCR amplification. PCR-Methods Appl. 4, 368e370. Hassan, A.N., 2008. ADSA foundation scholar Award: possibilities and challenges of exopolysaccharide-producing lactic cultures in dairy foods. J. Dairy Sci. 91, 1282e1298. Hugenschmidt, S., Schwenninger, S.M., Gnehm, N., Lacroix, C., 2010. Screening of a natural biodiversity of lactic and propionic acid bacteria for folate and vitamin B12 production in supplemented whey permeate. Int. Dairy J. 20, 852e857. Irague, R., Rolland-Sabate, A., Tarquis, L., Doublier, J.L., Moulis, C., Monsan, P., Remaud-Simeon, M., Potocki-Veronese, G., Buleon, A., 2012. Structure and property engineering of alpha-D-glucans synthesized by dextransucrase mutants. Biomacromolecules 13, 187e195. Jacques, N.A., 1993. The fructosyltransferase of Streptococcus salivarius. New Phytol. 123, 429e435. Jolly, L., Stingele, F., 2001. Molecular organization and functionality of exopolysaccharide gene clusters in lactic acid bacteria. Int. Dairy J. 11, 733e745. Kang, M.S., Chung, J., Kim, S.M., Yang, K.H., Oh, J.S., 2006. Effect of Weisselia cibaria isolates on the formation of Streptococcus mutans biofilm. Caries Res. 40, 418e425. Kastner, S., 2008. The Inoculum of the Cassava Product Attieke (Doctoral dissertation). ETH Zürich. Nr. 18099, 2008. Katina, K., Maina, N.H., Juvonen, R., Flander, L., Johansson, L., Virkki, L., Tenkanen, M., Laitila, A., 2009. In situ production and analysis of Weissella confusa dextran in wheat sourdough. Food Microbiol. 26, 734e743. €nzle, M.G., Vogel, R.F., 2003. Exopolysaccharide and Korakli, M., Pavlovic, M., Ga kestose production by Lactobacillus sanfranciscensis LTH2590. Appl. Environ. Microbiol. 69, 2073e2079. Macfarlane, S., Macfarlane, G.T., Cummings, J.H., 2006. Review article: prebiotics in the gastrointestinal tract. Aliment. Pharmacol. Ther. 24, 701e714. Maina, N.H., 2012. Structural and Macromolecular Properties of Weissella Confusa and Leuconostoc Citreum Dextrans with a Potential Application Is Sourdough (Doctoral dissertation). University of Helsinki, Finland. https://helda.helsinki.fi/ handle/10138/33521. Maina, N.H., Tenkanen, M., Maaheimo, H., Juvonen, R., Virkki, L., 2008. NMR spectroscopic analysis of exopolysaccharides produced by Leuconostoc citreum and Weissella confusa. Carbohydr. Res. 343, 1446e1455. Malik, A., 2012. Molecular cloning and in silico characterization of fructansucrase gene from Weissella confusa MBFCNC-2(1) isolated from local beverage. AsiaPacific J. Mol. Biol. Biotechnol. 20, 33e42. Malik, A., Radji, M., Kralj, S., Dijkhuizen, L., 2009. Screening of lactic acid bacteria from Indonesia reveals glucansucrase and fructansucrase genes in two different Weissella confusa strains from soya. FEMS Microbiol. Lett. 300, 131e138. Matulova, M., Husarova, S., Capek, P., Sancelme, M., Delort, A.-M., 2011. NMR structural study of fructans produced by Bacillus sp 3B6, bacterium isolated in cloud water. Carbohydr. Res. 346, 501e507. Mende, S., Peter, M., Bartels, K., Rohm, H., Jaros, D., 2013. Addition of purified exopolysaccharide isolates from S. thermophilus to milk and their impact on the rheology of acid gels. Food Hydrocoll. 32, 178e185. Miller, A.W., Robyt, J.F., 1986. Detection of dextransucrase and levansucrase on polyacrylamide gels by the periodic acid schiff stain e staining artifacts and their prevention. Anal. Biochem. 156, 357e363. Monsan, P., Bozonnet, S., Albenne, C., Joucla, G., Willemot, R.M., RemaudSimeon, M., 2001. Homopolysaccharides from lactic acid bacteria. Int. Dairy J. 11, 675e685. Morales-Arrieta, S., Rodriguez, M.E., Segovia, L., Lopez-Munguia, A.G., OlveraCarranza, C., 2006. Identification and functional characterization of levS, a gene encoding for a levansucrase from Leuconostoc mesenteroides NRRL B-512F. Gene 376, 59e67. Mozzi, F., Vaningelgem, F., Hebert, E.M., Van der Meulen, R., Moreno, M.R.F., de Valdez, G.F., De Vuyst, L., 2006. Diversity of heteropolysaccharide-producing lactic acid bacterium strains and their biopolymers. Appl. Environ. Microbiol. 72, 4431e4435. Olivares-Illana, V., Lopez-Munguia, A., Olvera, C., 2003. Molecular characterization of inulosucrase from Leuconostoc citreum: a fructosyltransferase within a glucosyltransferase. J. Bacteriol. 185, 3606e3612. Olivares-Illana, V., Wacher-Rodarte, C., Le Borgne, S., Lopez-Munguia, A., 2002. Characterization of a cell-associated inulosucrase from a novel source: a Leuconostoc citreum strain isolated from pozol, a fermented corn beverage of Mayan origin. J. Ind. Microbiol. Biotechnol. 28, 112e117. Ozimek, L.K., Kralj, S., van der Maarel, M., Dijkhuizen, L., 2006. The levansucrase and inulosucrase enzymes of Lactobacillus reuteri 121 catalyse processive and nonprocessive transglycosylation reactions. Microbiol. Sgm 152, 1187e1196. Park, J.H., Ahn, H.J., Kim, S.G., Chung, C.H., 2013. Dextran-like exopolysaccharideproducing Leuconostoc and Weissella from kimchi and its ingredients. Food Sci. Biotechnol. 22, 1047e1053. Perry, D.B., McMahon, D.J., Oberg, C.J., 1997. Effect of exopolysaccharide-producing cultures on moisture retention in low fat mozzarella cheese. J. Dairy Sci. 80, 799e805. Provencher, C., LaPointe, G., Sirois, S., Van Calsteren, M.R., Roy, D., 2003. Consensusdegenerate hybrid oligonucleotide primers for amplification of priming

S.K. Malang et al. / Food Microbiology 46 (2015) 418e427 glycosyltransferase genes of the exopolysaccharide locus in strains of the Lactobacillus casei group. Appl. Environ. Microbiol. 69, 3299e3307. Rantanen, H., Virkki, L., Tuomainen, P., Kabel, M., Schols, H., Tenkanen, M., 2007. Preparation of arabinoxylobiose from rye xylan using family 10 Aspergillus aculeatus endo-1,4-beta-D-xylanase. Carbohydr. Polym. 68, 350e359. Robert, H., Gabriel, V., Fontagne-Faucher, C., 2009. Biodiversity of lactic acid bacteria in French wheat sourdough as determined by molecular characterization using species-specific PCR. Int. J. Food Microbiol. 135, 53e59. n, C., 2009. Bacterial polyRuas-Madiedo, P., Salazar, N., de los Reyes-Gavila saccharides current innovations and future trends. In: Ullrich, M. (Ed.), Biosynthesis and Chemical Composition of Exopolysaccharides Produced by Lactic Acid Bacteria. Caister Academic Press, Norfolk, pp. 279e310. Santa Cruz, W., 2011. Hydrocolloids in bakery products, pp. 51e66. In: Laaman, T.R. (Ed.), Hydrocolloids in Food Processing. Wiley-Blackwell, Ames, Iowa. €nzle, M., 2008. Formation of oligosacSchwab, C., Mastrangelo, M., Corsetti, A., Ga charides and polysaccharides by Lactobacillus reuteri LTH5448 and Weissella cibaria 10M in sorghum sourdoughs. Cereal Chem. 85, 679e684. €nzle, M.G., 2007. Sucrose utiliSchwab, C., Walter, J., Tannock, G.W., Vogel, R.F., Ga zation and impact of sucrose on glycosyltransferase expression in Lactobacillus reuteri. Syst. Appl. Microbiol. 30, 433e443. Shiroza, T., Kuramitsu, H.K., 1988. Sequence-analysis of the Streptococcus mutans fructosyltransferase gene and flanking regions. J. Bacteriol. 170, 810e816. Shukla, S., Goyal, A., 2011. 16S rRNA-based identification of a glucanhyperproducing Weissella confusa. Enzyme Res. 2011, 250842. Shukla, S., Shi, Q., Maina, N.H., Juvonen, M., Tenkanen, M., Goyal, A., 2014. Weissella confusa Cab3 dextransucrase: properties and in vitro synthesis of dextran and glucooligosaccharides. Carbohydr. Polym. 101, 554e564. Siddiqui, N.N., Aman, A., Ul Qader, S.A., 2013. Mutational analysis and characterization of dextran synthesizing enzyme from wild and mutant strain of Leuconostoc mesenteroides. Carbohydr. Polym. 91, 209e216. Sutherland, I.W., 1972. Bacterial exopolysaccharides. Adv. Microb. Physiol. 8, 143e213. €nzle, M.G., Vogel, R.F., 2003. In situ Tieking, M., Korakli, M., Ehrmann, M.A., Ga production of exopolysaccharides during sourdough fermentation by cereal and intestinal isolates of lactic acid bacteria. Appl. Environ. Microbiol. 69, 945e952. €nzle, M.G., 2005. Evidence for formation of heteroTieking, M., Kuhnl, W., Ga oligosaccharides by Lactobacillus sanfranciscensis during growth in wheat sourdough. J. Agric. Food Chem. 53, 2456e2461.

427

Van Calsteren, M.R., Pau-Roblot, C., Begin, A., Roy, D., 2002. Structure determination of the exopolysaccharide produced by Lactobacillus rhamnosus strains RW9595M and R. Biochem. J. 363, 7e17. Van der Meulen, R., Grosu-Tudor, S., Mozzi, F., Vaningelgem, F., Zamfir, M., de Valdez, G.F., de Vuyst, L., 2007. Screening of lactic acid bacteria isolates from dairy and cereal products for exopolysaccharide production and genes involved. Int. J. Food Microbiol. 118, 250e258. Van Hijum, S., Bonting, K., Van der Maarel, M., Dijkhuizen, L., 2001. Purification of a novel fructosyltransferase from Lactobacillus reuteri strain 121 and characterization of the levan produced. FEMS Microbiol. Lett. 205, 323e328. Van Hijum, S., Van Geel-Schutten, G.H., Rahaoui, H., Van der Maarel, M., Dijkhuizen, L., 2002. Characterization of a novel fructosyltransferase from Lactobacillus reuteri that synthesizes high-molecular-weight inulin and inulin oligosaccharides. Appl. Environ. Microbiol. 68, 4390e4398. Van Hijum, S.A., Kralj, S., Ozimek, L.K., Dijkhuizen, L., Van Geel-Schutten, I.G., 2006. Structure-function relationships of glucansucrase and fructansucrase enzymes from lactic acid bacteria. Microbiol. Mol. Biol. Rev. 70, 157e176. Vasileva, T., Iliev, I., Amari, M., Bivolarski, V., Bounaix, M.S., Robert, H., Morel, S., Rabier, P., Ivanova, I., Gabriel, B., Fontagne-Faucher, C., Gabriel, V., 2012. Characterization of glycosyltransferase activity of wild-type Leuconostoc mesenteroides strains from Bulgarian fermented vegetables. Appl. Biochem. Biotechnol. 168, 718e730. Werning, M.L., Ibarburu, I., Duenas, M.T., Irastorza, A., Navas, J., Lopez, P., 2006. Pediococcus parvulus gtf gene encoding the GTF glycosyltransferase and its application for specific PCR detection of beta-D-glucan-producing bacteria in foods and beverages. J. Food Prot. 69, 161e169. Wilham, C.A., Alexander, B.H., Jeanes, A., 1955. Heterogeneity in dextran preparation. Arch. Biochem. Biophys. 59, 61e75. Wullschleger, S., Lacroix, C., Bonfoh, B., Sissoko-Thiam, A., Hugenschmidt, S., Romanens, E., Baumgartner, S., Traore, I., Yaffee, M., Jans, C., Meile, L., 2013. Analysis of lactic acid bacteria communities and their seasonal variations in a spontaneously fermented dairy product (Malian fene) by applying a cultivation/ genotype-based binary model. Int. Dairy J. 29, 28e35. Yasuda, E., Serata, M., Sako, T., 2008. Suppressive effect on activation of macrophages by Lactobacillus casei strain shirota genes determining the synthesis of cell wall-associated polysaccharides. Appl. Environ. Microbiol. 74, 4746e4755.