- Email: [email protected]
Characterization of Helicobacter pylori PldA, a phospholipase with a role in colonization of the gastric mucosa
GASTROENTEROLOGY 1999;117:1098–1104
Characterization of Helicobacter pylori PldA, a Phospholipase With a Role in Colonization of the Gastric Mucosa NICK DORRELL,* M. CELESTE MARTINO,‡ RICHARD A. STABLER,* STEPHEN J. WARD,* ZUN W. ZHANG,§ ANDY A. McCOLM,\ MICHAEL J. G. FARTHING,§ and BRENDAN W. WREN* *Pathogen Molecular Biology and Biochemistry Unit, Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London, England; ‡Department of Pharmacology and Pharmacognosy, La Sapienze University, Rome, Italy; §Digestive Diseases Research Centre, St. Bartholomew’s and the Royal London School of Medicine and Dentistry, London, England; and \Systems Biology Unit, GlaxoWellcome Research and Development, Stevenage, England
Background & Aims: Phospholipase activity may play a role in the pathogenicity of Helicobacter pylori. Furthermore, some drugs that are effective against H. pylori infection are phospholipase inhibitors. Scrutiny of the H. pylori 26695 genome sequence revealed the presence of a putative protein with homology to Esherichia coli outer membrane phospholipase A (PldA). The aim of this study was to investigate the role of this putative PldA in the pathogenicity of H. pylori. Methods: An isogenic pldA mutant was constructed and analyzed for in vitro phospholipase A2 and hemolytic activity. Adherence of the mutant to human gastric adenocarcinoma cells and the ability to colonize mice were also investigated. Results: The pldA mutant showed a marked reduction in phospholipase A2 and hemolytic activity compared with the wild-type strain. The mutant was unable to colonize mice at 2 and 8 weeks, but it did induce a significant immune response. In contrast, the ability of the mutant to adhere to human gastric adenocarcinoma cells was unaffected. Conclusions: The results suggest a role for PldA in colonization of the gastric mucosa and possibly tissue damage after colonization.
elicobacter pylori is a gram-negative gastric pathogen that colonizes the stomachs of at least half the human population.1 Most infected individuals are asymptomatic; however, for approximately 1 in 10 people, infection with H. pylori is associated with the development of gastric disease, including duodenal and gastric ulcers and gastric adenocarcinoma.2 H. pylori survives largely within the gastric mucous layer without attaching to host cells.1 Infection with H. pylori is associated with an increase in gastric acid output and a reduction in the thickness of the mucous layer and in gastric mucosal hydrophobicity.3 H. pylori has been shown to alter the barrier properties of the epithelium in vitro.4 H. pylori possesses several different phospholipase (PL) activities such as PLA1, PLA2, and PLC.5 The main activity of these PLs is thought to be degradation of the
H
phospholipid components of the mucosal barrier.6 Lipids constitute about 20% of the dry weight of the human gastric mucus and are believed to be important in generating a hydrophobic barrier. Theoretically, PLs produced by mucosal pathogens such as H. pylori could be important in the breakdown of gastric surface integrity. PLs could be secreted in sufficient concentration to hydrolyze membrane phospholipids and initiate the inflammatory process found in gastritis.7 Although PL activity has been characterized in H. pylori, the gene(s) and protein(s) that contribute to this have not been identified. Scrutiny of the H. pylori 26695 genome sequence has revealed only one open reading frame with homology to characterized PL enzymes.8 HP0499 has homology to the outer membrane PldA group of enzymes, which are found in many Enterobacteriaceae.9,10 In addition to direct disruption of the mucosal barrier, PLs are also able to liberate leukotrienes and other eicosanoids, converted from arachidonic acid, which could also affect membrane permeability and mucous discharge.6 Hydrolysis of cell phospholipids also produces other cytotoxic products, such as lysolecithin,7 which is itself capable of producing tissue damage but is also a precursor for platelet-activating factor, a powerful ulcerogenic agent.7 H. pylori can also induce the release of PLA2 and other proteolytic enzymes from polymorphonuclear leukocytes recruited to sites of gastric injury, thus exacerbating the primary H. pylori–induced mucosal injury.5 Gastroprotective agents such as bismuth salts, sulglycotide, sucralfate, and ebrotidine, which have been used in the treatment of gastric ulcers, are thought to be Abbreviations used in this paper: AGS, human gastric adenocarcinoma (cells); bp, base pair; BHI, brain-heart infusion; CFU, colonyforming unit; ELISA, enzyme-linked immunosorbent assay; OD, optical density; PCR, polymerase chain reaction; PL, phospholipase; RBC, red blood cell. r 1999 by the American Gastroenterological Association 0016-5085/99/$10.00
November 1999
H. PYLORI PHOSPHOLIPASE 1099
potent inhibitors of H. pylori PLs.5,11 This suggests a possible role for PL in H. pylori–induced disease. Although it is still not fully understood how H. pylori is involved in gastric tissue damage, one hypothesis is that the inflammation and impaired mucosal defense caused by the action of bacterial PLs creates an environment that, in the presence of gastric acid and cytotoxic compounds, leads to ulceration.7 Given the likely importance of PL in the pathogenesis of H. pylori and the possible significance of PL inhibition in the mechanism of drug action, we constructed an isogenic H. pylori pldA mutant. The pldA mutant was compared, with several in vitro and in vivo assays, to both the wild-type strain and a previously characterized ureB mutant.12,13
Materials and Methods
The bacterial strains and plasmids used in this study are listed in Table 1. The wild-type strain used was the Sydney strain (SS1), which is able to colonize the mouse gastric mucosa and induce humoral immune responses that closely mimic those observed in human H. pylori infections.14,15 H. pylori strains were stored at ⫺80°C in brain-heart infusion (BHI) broth (Oxoid, Basingstoke, England) containing 15% glycerol and 10% fetal calf serum (Sigma, Poole, England). Strains were grown in BHI broth supplemented with 10% fetal calf serum or on Helicobacter-selective agar (DENT), consisting of blood agar base no. 2 (Oxoid) supplemented with 7% lysed defibrinated horse blood (TCS Microbiology, Botolph Claydon, England) and DENT’s selective supplement (Oxoid) in a microaerobic atmosphere at 37°C. Egg yolk agar was prepared as follows: egg yolk was aseptically separated from commerTable 1. Bacterial Strains and Plasmids Used in This Study
Strains H. pylori 26695 SS1 ND5 ND3 E. coli XL2-Blue MRF8 Plasmids pUC18 pJMK30 pND5 pND5-TI pND5-TIK
Relevant characteristics
Source
Virulent wild-type strain Virulent wild-type strain Knr H. pylori SS1 pldA mutant Knr H. pylori SS1 ureB mutant
Tomb et al.8 Lee et al.14 Current study Current study
Cloning strain
Stratagenea
Apr Knr; source of Knr BamHI cassette pUC19 plus 0.47-kb PCR gene fragment of H. pylori pldA pND5 with 10-bp deletion in pldA pND5-TI plus Knr
Pharmaciab Trieu-Cuot et al.33 Current study
Apr, ampicillin resistant; Knr, kanamycin resistant. The Netherlands. bSt. Albans, United Kingdom. aAmsterdam,
Name
PCR method
Strand
Sequence (58–38)
ND5F ND5R ND5 TIF ND5 TIR
PCR PCR IPCRM IPCRM
⫹ ⫺ ⫹ ⫺
ATGAAAAGCATTTTGCTCTTTATA GCATGAAATTTAATCATTCGCATG GCGAGATCTTTGCCTTTTTATCAT GCGAGATCTCCTAGATAATCCATC
NOTE. Underlined nucleotides represent Bgl II (ND5 TIF and ND5 TIR) restriction endonuclease sites.
cially bought eggs, mixed in a 1:1 ratio with sterile phosphatebuffered saline (PBS; pH 7.4), and then mixed with molten BHI agar (Oxoid) at 50°C in a ratio of 1 mL of yolk suspension per 20-mL plate. Escherichia coli strains were routinely grown in Luria–Bertani broth or on Luria–Bertani agar. The antibiotics used for selection purposes were ampicillin (100 mg · mL⫺1) and kanamycin (20 mg · mL⫺1 for H. pylori and 50 mg · mL⫺1 for E. coli).
DNA Manipulations
Bacterial Strains, Plasmids, and Growth Conditions
Strain/plasmid
Table 2. Oligonucleotides Used for PCR
Current study Current study
Unless otherwise stated, plasmid and chromosomal DNA extractions, restriction enzyme digests, DNA ligations, and transformations into E. coli were performed by standard procedures16 using enzymes supplied by Promega (Southampton, England). All chemicals were purchased from Sigma. The oligonucleotide primers used for PCRs were purchased from Genosys Biotechnologies (Europe) Ltd. (Pampisford, England) and are summarized in Table 2. The statistical significance of experimental data was determined using the unpaired Student t test performed with the InStat Statistical Package (Sigma).
Cloning of H. pylori pldA Gene The putative H. pylori pldA gene (HP0499) was amplified by PCR using H. pylori 26695 chromosomal DNA as a template. Primers ND5F and ND5R were designed from the HP0499 sequence to amplify a 471–base pair (bp) gene fragment. The amplified PCR product was cloned into pUC18 to produce pND5. pND5 was sequenced by the dideoxynucleotide chain termination method with a PRISM sequencing kit (Applied Biosystems, Warrington, England). The data were compared with the HP0499 sequence on the TIGR website (http://www.tigr.org/tdb/mdb/hpdb/hpdb.html). The H. pylori ureB gene (HP0072) was also cloned using the same method.
Construction of H. pylori pldA Mutant A 10-bp deletion and a unique BglII site were introduced into the cloned pldA gene fragment in pND5 by inverse PCR mutagenesis using primers ND5 TIF and ND5 TIR to produce pND5-TI, as described previously.17,18 A 1.4-kilobase BamHI restriction fragment of plasmid pJMK30 containing a gene encoding resistance to kanamycin (aph38-III12) was cloned into the unique BglII site of pND5-TI to form pND5-TIK. This construct was introduced into H. pylori SS1 wild-type strain by electroporation as described previously.19 Kmr colonies were selected after 4–5 days’ growth. An isogenic ureB mutant was also constructed using the same method.
1100 DORRELL ET AL.
Detection of PLA2 Activity Bacteria were grown on DENT agar for 48 hours and then for 24 hours in broth, until the bacteria were in the mid to late log phase of growth (optical density at 600 nm [OD600], 1.1–1.8) and in the spiral-shaped form. Cells were washed in PBS and resuspended in 1 mL of sonication buffer (0.1 mol/L sodium phosphate buffer, pH 8.0) for every 0.4 g of wet cells to give a final suspension of ⬃40%. The cells were lysed by five 30-second bursts of ultrasound (Ultrasonic Processor, Jencons Scientific Ltd., Leighton Buzzard, England) with 30-second cooling periods on ice between each burst. The insoluble debris was removed by centrifugation at 13,000 rpm for 20 minutes, and the soluble fraction was harvested. Quantitation of the total protein content was performed using a BCA protein assay kit (Pierce, Rockford, IL). Calculation of the amount of PLA2 in the bacterial lysates was performed by using a PLA2 detection kit (Assay Designs, Ann Arbor, MI). The assay quantitatively determines the amount of PLA2 in biological fluids. Each strain was tested in triplicate, and the results were expressed as units of PLA2 per milligram of total protein.
Assay for Hemolysis of Red Blood Cells Red blood cells (RBCs) from defibrinated horse blood were washed in PBS and resuspended to the initial volume with PBS. The suspension obtained was assumed to be 100% RBCs. Cultures of SS1, ND5, and ND3 were prepared as described above and resuspended in PBS to obtain a 20% (wt/vol) suspension. Duplicate reactions containing 4% and 2% H. pylori were incubated with a final concentration of 2% RBCs for 2 hours at 37°C, with shaking at 200 rpm. Negative controls, replacing the bacterial suspension with PBS, were also included. The samples were centrifuged at 4000 rpm for 5 minutes, and OD540 readings were recorded in duplicate. Samples were then sonicated for 30 seconds and centrifuged as before, and OD540 readings were recorded in duplicate to give a reference for 100% hemolysis. Each strain was tested in triplicate, and the results were expressed as a percentage of 100% hemolysis.
Adherence to Human Gastric Adenocarcinoma Cells The adherence assay was performed as described previously.20 H. pylori (5 ⫻ 108 organisms) were incubated with human gastric adenocarcinoma (AGS) cells (5 ⫻ 106 cells) at 37°C for 1 hour with agitation (150 rpm). Nonadherent bacteria were removed by washing with 10 mL of 15% sucrose solution. Cells were washed once with PBS and subsequently incubated with a 1:5 dilution of polyclonal anti–H. pylori antibody (SkyTek Laboratories, Logan, UT) on ice for 30 minutes. After being washed with 15 mL of PBS, the cells were then incubated for an additional 30 minutes on ice in a 1:20 dilution of fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Sigma). The cells were subsequently washed
GASTROENTEROLOGY Vol. 117, No. 5
and resuspended in 1 mL of 1% formaldehyde for flow cytometric analysis. A FACScan flow cytometer (Becton Dickinson, San Jose, CA) was used to measure bacteria adhering to AGS cells and was gated to include single cells and to exclude cell debris and unbound bacteria. The results are presented as a percentage figure calculated from the number of AGS cells adhered to by H. pylori strains and the total number of AGS cells analyzed by flow cytometry.
Colonization of H. pylori Mouse Model Female outbred mice (HSD/ICR strain, Harlan Ltd., Bicester, England) of ⬃20 g body wt (4–6 weeks old) were challenged orally on successive days with SS1, ND5, or ND3. Before challenge, both SS1 and ND5 were pretreated with acidified 5 mmol/L urea (pH 2) to boost urease activity and thus optimize colonization potential.21 ND3 was not pretreated, because this strain is an isogenic ureB mutant. Challenge inocula were 1-mL volumes of 24-hour tryptose soya broth (Oxoid) cultures containing between 1 ⫻ 107 and 1 ⫻ 108 colony-forming units (CFU). At 2 and 8 weeks, 10 mice from each group were culled by CO2 inhalation, and their stomachs were removed and opened along the greater curvature. After the stomach contents were washed away, the entire mucosal surface was spread evenly over the surface of a Columbia chocolate agar (Oxoid) plate containing selective antibiotics for ⬃10 seconds21 before plates were incubated microaerobically for 7 days at 37°C. The culture plates were then evaluated for H. pylori growth. Growth of even a single colony is sufficient to record an animal as being H. pylori positive.21 At 8 weeks, the mice were exsanguinated, and the individual serum samples were stored at ⫺20°C.
Whole Cell Serum Enzyme-Linked Immunosorbent Assay H. pylori SS1 cells were harvested from DENT agar plates, washed twice with PBS, and lysed by three 30-second bursts of ultrasound, with 30-second cooling periods on ice between each burst. The insoluble material was removed (13,000 rpm for 20 minutes), and the soluble material was used to coat wells of an EIA/RIA 96-well plate (Corning Costar, High Wycombe, England) for 18 hours at 4°C (1 µg/well in 0.1 mol/L NaHCO3, pH 9.5). The antibody levels within individual serum samples were determined by end-point titration, as described previously.22 Essentially, antigen-coated wells were incubated with serum samples serially diluted 2-fold in PBS. Bound antibody was visualized using a polyvalent anti-mouse immunoglobulin horseradish peroxidase conjugate (Sigma) and o-phenylenediamine as a substrate. Enzyme-linked immunosorbent assay (ELISA) titers were determined as the reciprocal of the highest serum dilution that gave an OD490 value of 0.5 U above the background. All titers were standardized against an anti–H. pylori whole cell antiserum.
November 1999
H. PYLORI PHOSPHOLIPASE 1101
Results Construction of an Isogenic H. pylori pldA Mutant The putative H. pylori PldA shows 33.8% identity and 54.1% similarity to the E. coli PldA.8 A putative PldA was identified from the recently sequenced Campylobacter jejuni 11168 genome on the Sanger Centre website (http://www.sanger.ac.uk/Projects/C_jejuni/), which had 27.7% identity and 56.5% similarity to the H. pylori PldA. PCR experiments with primers ND5F and ND5R consistently amplified a single band of 471 bp from H. pylori 26695 chromosomal DNA, which represents 44.2% of the H. pylori pldA gene (HP0499). The nucleotide sequences of 2 independently derived pldA clones were determined and found to be identical to each other and to the sequence of HP0499 (data not shown). The H. pylori pldA mutant was constructed by allelic replacement, as summarized previously.23 The H. pylori pldA cloned gene fragment was mutated by inverse PCR mutagenesis through introduction of a 10-bp deletion and the insertion of a kanamycin resistance cassette.17,18 Typically, electroporation resulted in 800 kanamycinresistant colonies per experiment. PCR analysis using primers ND5F and ND5R confirmed that a doublerecombination event had occurred (data not shown). Southern blot analysis of ND5 DNA using a 471-bp H. pylori pldA probe confirmed that the mutated pldA gene had undergone a double-recombination event (data not shown). To check for possible polar effects caused by the mutation in the pldA gene, reverse-transcription PCR/ complementary DNA analysis was performed, showing transcription of the adjacent genes HP0498 and HP0500 (data not shown). An isogenic H. pylori ureB mutant (ND3) was also constructed to act as a control in the in vitro and in vivo studies.12,13
Figure 1. Egg yolk agar clearing by H. pylori strains SS1 and ND3 (ureB). H. pylori strain ND5 (pldA) shows the loss of lecithinase activity. Some bacterial cells have been removed from the agar, showing the clearing of the egg yolk agar by SS1 and ND3, but not by ND5.
0.01), whereas those between SS1 and ND3 were not significant (P ⬎ 0.01). H. pylori suspensions were analyzed for the quantitative hemolysis of RBCs, and the results are presented as a percentage of 100% hemolysis (Figure 3). Hemolytic activity was markedly reduced in ND5 (P ⬍ 0.01). Activity in ND3 (P ⬎ 0.01) was similar to that in the wild-type SS1 strain. PLA2 and hemolysis assays were performed on a second pldA mutant constructed independently from ND5. Similar results were observed, strongly suggesting that a mutation of the pldA gene, and not an unrelated
In Vitro Characterization of the pldA Mutant No differences in colony morphology or growth rate were observed between the pldA (ND5) or ureB (ND3) mutants and the wild-type strain SS1 when grown on DENT plates. However, ND5 showed no observable zones of clearing when grown on egg yolk agar, in contrast to ND3 and SS1 (Figure 1).24 Bacterial lysates from SS1, ND5, and ND3 were assayed for PLA2 activity, and the results are presented as units of PLA2 per milligram of total protein (Figure 2). Statistical analysis showed the differences in PLA2 activity between SS1 and ND5 to be very significant (P ⬍
Figure 2. Quantitative determination of PLA2 activity in H. pylori lysates. The results are presented as units of PLA2 per milligram of the total protein content present in the lysates.
1102 DORRELL ET AL.
GASTROENTEROLOGY Vol. 117, No. 5
seroconverted, and the mean antibody titer generated by ND5-challenged mice, were not significantly different (P ⬎ 0.05) from values in the control group of mice challenged with ND3.
Discussion
Figure 3. Quantitative determination of hemolytic activity of H. pylori strains, showing the level of hemolysis of red blood cells after 2 hours at 37°C when coincubated with either 2% (§) or 4% (R) H. pylori suspensions. The level of hemolysis is presented as a percentage of 100% hemolysis determined by sonication.
mutation elsewhere on the chromosome, caused the phenotype. All strains were analyzed for the ability to adhere to cultured human AGS cells. Both ND5 and ND3 adhered to AGS cells at a level comparable with that in SS1. ND5 adherence was measured as 92.0% ⫾ 1.3% and ND3 as 95.6% ⫾ 2.6%, compared with the 92.8% ⫾ 2.6% observed with SS1. The results suggest that adherence to epithelial cells is unaffected by mutations in either the pldA or ureB genes. Colonization of H. pylori Mouse Model Three groups of 20 mice were infected with 1-mL volumes of overnight cultures of SS1 (1.05 ⫻ 108 CFU/6.4 ⫻ 107 CFU), ND5 (1.1 ⫻ 107 CFU/3.7 ⫻ 107 CFU), and ND3 (6.4 ⫻ 107 CFU/5.7 ⫻ 107 CFU), respectively (values in parentheses are numbers of viable bacteria administered to each mouse on successive days). All mice inoculated with SS1 were colonized at 2 and 8 weeks after infection. According to the scoring system for colonization described previously, the results showed 58% colonization at 2 weeks and 94% colonization at 8 weeks,21 which is indicative of growth in vivo. However, mice inoculated with ND5 or ND3 showed no colonization at either 2 or 8 weeks after infection.
Bacterial PLs are a diverse group of enzymes with a wide range of actions both in vitro and in vivo.25,26 These vary from minor alterations in cell membrane composition and function and controlled destruction of intracellular vacuoles to overt cytolysis. Although a definitive role in pathogenesis has been attributed to some PLs (such as the PLC of Clostridium perfringens, Listeria monocytogenes, and Pseudomonas aeruginosa and the PLD from Corynebacterium pseudotuberculosis), in most other instances the evidence is incomplete. In no case is the molecular basis for pathogenesis known. Further work is required to characterize PLs and thus elucidate their structural and functional similarities and their roles in pathogenesis. Current evidence suggests that H. pylori can produce and release an active PL and indirectly induce production of PLs from inflammatory polymorphonuclear leukocytes. This may result in mucosal damage either through the breakdown of hydrophobic elements within the mucous layer or by catalyzing the hydrolysis of the plasma membrane of gastric epithelial cells. Scrutiny of the genome sequence of H. pylori 26695 revealed the presence of only 1 putative enzyme with homology to a known PL.8 Open reading frame HP0499 shows 33.8% identity and 54.1% similarity to the E. coli PldA (http://www.tigr.org/tdb/mdb/hpdb/hpdb.html) and also high homology to PldA enzymes from other bacteria.10 The H. pylori pldA gene encodes a protein of ⬃42.5 kilodaltons. We have investigated the role of this putative H. pylori pldA gene in the pathogenicity of H. pylori
Anti–H. pylori Serum Responses Serum isolated from individual mice 8 weeks after oral inoculations was analyzed for the presence of anti–H. pylori antibodies by ELISA. Only 3 of the 10 mice given ND5 generated a positive anti–H. pylori serum response. In comparison, 9 of the 10 mice challenged with the SS1 wild-type strain seroconverted (Figure 4). In addition, the mean antibody titer induced by ND5 was significantly lower (P ⬍ 0.05) than that found in SS1inoculated mice. The number of mice that positively
Figure 4. Serum anti–H. pylori whole cell immunoglobulin responses 8 weeks after infection. End-point antibody titers from individual mice are shown. Bars denote mean antibody responses.
November 1999
by the construction of an isogenic mutant. This is an example of how a known phenotypic determinant can be investigated at a molecular level by initial analysis of the genome sequence.27 H. pylori has been shown to have a substantially higher PLA2 activity than most other bacteria when tested in vitro, and it has been suggested that these high levels of PLA2 may be clinically significant.7 The levels of PLA2 and lysolecithin (produced by hydrolysis of cell phospholipids) in the basal gastric aspirates of patients infected with H. pylori were found to be significantly higher than those from uninfected patients.7 The proportion of lysolecithin out of the total phospholipid content in these gastric aspirates was also found to be much higher in the infected group, suggesting greater hydrolysis of cell phospholipids in patients infected with H. pylori.7 In this study, both the wild-type SS1 strain and the control ureB mutant tested positive for lecithinase activity by the egg yolk agar assay. In contrast, the pldA mutant showed no observable zones of clearing when grown on egg yolk agar, suggesting that H. pylori PldA has lecithinase activity. A Vibrio cholerae lec mutant also fails to produce zones of clearing when grown on egg yolk agar,4 but there is no similarity between the H. pylori PldA and V. cholerae Lec amino acid sequences. The similarity of the putative H. pylori PldA to other PldA proteins,10 and the observed absence of lecithinase activity with the pldA mutant, suggested that the gene does encode a PL. To test this hypothesis, the H. pylori strains were tested for PLA2 activity. The pldA mutant showed a ⬎90% reduction in PLA2 activity compared with the wild-type strain. In contrast, the control ureB mutant showed PLA2 activity comparable with SS1. Considered together, these 2 observations provide strong evidence that the putative H. pylori PldA protein is indeed an active PL. Hemolysins are known virulence determinants for a number of bacterial pathogens. Several studies have shown erythrocyte lysis to be dependent on PL activity.28 This PL-mediated hemolytic activity is often attributable to the accumulation of lysophospholipids, produced by the hydrolysis of cell phospholipids that destabilize membranes. A Campylobacter coli pldA mutant was shown to have reduced hemolytic activity compared with the wild-type strain, suggesting some role for pldA in Campylobacter virulence.29 The H. pylori pldA mutant showed an ⬃50% reduction in hemolytic activity compared with SS1, whereas the ureB mutant showed hemolytic levels comparable with those in SS1. To determine whether PldA is an important virulence determinant in vivo, the pldA mutant was analyzed for the ability to colonize mice. The pldA mutant was shown
H. PYLORI PHOSPHOLIPASE 1103
to be attenuated in the H. pylori mouse model, showing no sign of colonization either 2 or 8 weeks after infection. These results were comparable with those for the ureB mutant, which has been shown previously to not colonize gnotobiotic piglets.13 Interestingly, both mutants did elicit a humoral immune response in some of the infected mice. Although no detectable colonization was observed with the pldA mutant, it is possible that an acute colonization occurred that could have been detected with earlier gastric sampling. In the gnotobiotic piglet model, nonmotile H. pylori mutants (which cause only a very transient colonization) have been shown to elicit a humoral immune response.30 More recently, a similar result was observed in the mouse model with a flaA mutant of SS1.31 Together these results suggest that some of the aflagellate bacteria must adhere to gastric mucin and persist in the stomach for several days, before leaving the stomach due to their inability to penetrate and colonize the mucous layer. This limited colonization appears to be sufficient to stimulate an immune response. The pldA mutant does not colonize the gastric mucosa but does induce an immune response, suggesting that a similar transient colonization must occur. The pldA mutant is motile and shows similar levels of adhesion to AGS cells as the SS1 wild-type strain. Possibly, the pldA mutant can adhere to mucin on the surface of the gastric mucosa, much like the wild-type strain. However, it seems likely that the pldA mutant fails to colonize the gastric mucosa, not as a result of poor adherence to the gastric mucin or lack of motility but rather because of an inability to break down the mucous layer to allow penetration and colonization. It is known that functional urease activity and full motility are required for colonization of the gastric mucosa by H. pylori.32 The pldA mutant was shown to be both motile and urease positive (data not shown). We postulate that the inability of the pldA mutant to colonize the gastric mucosa arises from a failure to break down the mucous layer sufficiently to allow penetration by the bacteria, because of a lack of functional PL. The lack of colonization by the pldA mutant may cast some light on the mode of action of therapeutic agents such as bismuth salts, sulglycotide, sucralfate, and ebrotidine. These agents are potent inhibitors of H. pylori PLs, and their ultimate therapeutic effect may be to disrupt the actions of the PldA enzyme and thus reduce the ability of H. pylori to maintain colonization of the gastric mucosa. In conclusion, we have shown the pldA gene from the H. pylori 26695 genome sequence to encode an active PL with lecithinase, PLA2, and hemolytic activities. Mutation of the pldA gene abrogates the ability of H. pylori to
1104 DORRELL ET AL.
colonize mice. These results strongly indicate the H. pylori PL to be an important virulence determinant.
References 1. Blaser MJ. Ecology of Helicobacter pylori in the human stomach. J Clin Invest 1997;100:759–762. 2. Kuipers EJ. Helicobacter pylori and the risk and management of associated diseases: gastritis, ulcer disease, atrophic gastritis and gastric cancer. Aliment Pharmacol Ther 1997;11:71–88. 3. Asante M, Ahmed H, Patel P, Davis T, Finlayson C, Mendall M, Northfield T. Gastric mucosal hydrophobicity in duodenal ulceration: role of Helicobacter pylori infection density and mucus lipids. Gastroenterology 1997;113:449–454. 4. Terres AM, Pajares JM, Hopkins AM, Murphy A, Moran A, Baird AW, Kelleher D. Helicobacter pylori disrupts epithelial barrier function in a process inhibited by protein kinase C activators. Infect Immun 1998;66:2943–2950. 5. Ottlecz A, Romero JJ, Hazell SL, Graham DY, Lichtenberger LM. Phospholipase activity of Helicobacter pylori and its inhibition by bismuth salts: biochemical and biophysical studies. Dig Dis Sci 1993;38:2071–2080. 6. Nilius M, Malfertheiner P. Helicobacter pylori enzymes. Aliment Pharmacol Ther 1996;10:65–71. 7. Langton SR, Cesareo SD. Helicobacter pylori associated phospholipase A2 activity: a factor in peptic ulcer production. J Clin Pathol 1992;45:221–224. 8. Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, Ketchum KA, Klenk HP, Gill S, Dougherty BA, Nelson K, Quackenbush J, Zhou LX, Kirkness EF, Peterson S, Loftus B, Richardson D, Dodson R, Khalak HG, Glodek A, McKenney K, Fitzegerald LM, Lee N, Adams MD, Hickey EK, Berg DE, Gocayne JD, Utterback TR, Peterson JD, Kelley JM, Cotton MD, Weidman JM, Fujii C, Bowman C, Watthey L, Wallin E, Hayes WS, Borodovsky M, Karp PD, Smith HO, Fraser CM, Venter JC. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 1997;388:539–547. 9. Brok RGPM, Brinkman E, Vanboxtel R, Bekkers ACAPA, Verheij HM, Tommassen J. Molecular characterization of enterobacterial PldA genes encoding outer membrane phospholipase A. J Bacteriol 1994;176:861–870. 10. Brok RGPM, Boots AP, Dekker N, Verheij HM, Tommassen J. Sequence comparison of outer membrane phospholipases A: implications for structure and for the catalytic mechanism. Res Microbiol 1998;149:703–710. 11. Slomiany BL, Murty VLN, Piotrowski J, Slomiany A. Gastroprotective agents in mucosal defense against Helicobacter pylori. Gen Pharmacol 1994;25:833–841. 12. Ferrero RL, Cussac V, Courcoux P, Labigne A. Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange. J Bacteriol 1992;174:4212–4217. 13. Eaton KA, Krakowka S. Effect of gastric pH on urease-dependent colonization of gnotobiotic piglets by Helicobacter pylori. Infect Immun 1994;62:3604–3607. 14. Lee A, O’Rourke J, DeUngria MC, Robertson B, Daskalopoulos G, Dixon MF. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology 1997; 112:1386–1397. 15. Ferrero RL, Thiberge JM, Huerre M, Labigne A. Immune responses of specific-pathogen-free mice to chronic Helicobacter pylori (strain SS1) infection. Infect Immun 1998;66:1349–1355. 16. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
GASTROENTEROLOGY Vol. 117, No. 5
17. Wren BW, Henderson J, Ketley JM. A PCR-based strategy for the rapid construction of defined bacterial deletion mutants. Biotechniques 1994;16:994–996. 18. Dorrell N, Gyselman VG, Foynes S, Li SR, Wren BW. Improved efficiency of inverse PCR mutagenesis (IPCRM). Biotechniques 1996;21:604–608. 19. Segal ED, Tompkins LS. Transformation of Helicobacter pylori by electroporation. Biotechniques 1993;14:225–226. 20. Dunn BE, Altmann M, Campbell GP. Adherence of Helicobacter pylori to gastric carcinoma cells: analysis by flow cytometry. Rev Infect Dis 1991;13:S657–S664. 21. McColm AA. Nonprimate animal models of H. pylori infection. In: Clayton CL, Mobley HLT, eds. Helicobacter pylori protocols. Totowa, NJ: Humana, 1997: 235–251. 22. Douce G, Fontana M, Pizza M, Rappuoli R, Dougan G. Intranasal immunogenicity and adjuvanticity of site-directed mutant derivatives of cholera toxin. Infect Immun 1997;65:2821–2828. 23. Jenks PJ, Foynes S, Ward SJ, Constantinidou C, Penn CW, Wren BW. A flagellar-specific ATPase (FliI) is necessary for flagellar export in Helicobacter pylori. FEMS Microbiol Lett 1997;152:205– 211. 24. Fiore AE, Michalski JM, Russell RG, Sears CL, Kaper JB. Cloning, characterization, and chromosomal mapping of a phospholipase (lecithinase) produced by Vibrio cholerae. Infect Immun 1997;65: 3112–3117. 25. Songer JG. Bacterial phospholipases and their role in virulence. Trends Microbiol 1997;5:156–161. 26. Titball RW. Bacterial phospholipases. J Appl Microbiol 1998;84: 127S–137S. 27. Dorrell N, Wren BW. From genes to genome biology: a new era in Helicobacter pylori research. Gut 1998;42:451–453. 28. Ansorg R, Rein R, Spies A, von Reckling G. Cell-associated hemolytic activity of Helicobacter pylori. Eur J Clin Microbiol Infect Dis 1993;12:98–104. 29. Grant KA, Belandia IU, Dekker N, Richardson PT, Park SF. Molecular characterization of PldA, the structural gene for a phospholipase A from Campylobacter coli, and its contribution to cell-associated hemolysis. Infect Immun 1997;65:1172–1180. 30. Eaton KA, Suerbaum S, Josenhans C, Krakowka S. Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes. Infect Immun 1996;64:2445–2448. 31. Danon SJ, Eaton KA. Isogenic flagella mutants of Helicobacter pylori: candidates for an attenuated vaccine? Gut 1998;43(suppl 2):A38. 32. Moran AP, Wadstrom T. Pathogenesis of Helicobacter pylori. Curr Opin Gastroenterol 1998;14(suppl 1):S9–S14. 33. Trieu-Cuot P, Gerbaud G, Lambert T, Courvalin P. In vivo transfer of genetic information between gram-positive and gram-negative bacteria. EMBO J 1985;4:3583–3587.
Received January 6, 1999. Accepted July 13, 1999. Address requests for reprints to: Brendan W. Wren, Ph.D., Pathogen Molecular Biology and Biochemistry Unit, Department of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, Keppel Street, London WC1E 7HT, England. e-mail: [email protected]; fax: (44) 171-636-8739. Supported by the Joint Research Board of St Bartholomew’s Hospital and the Medical Research Council, United Kingdom. Dr. Ward’s current address is: Medeva Development, Vaccine Research Unit, Department of Biochemistry, Imperial College of Science, Technology and Medicine, London, England. The authors thank Angela Whiley and Lynne Batty for technical assistance and Richard Ferrero for the generous gift of strain SS1.
Characterization of Helicobacter pylori PldA, a Phospholipase With a Role in Colonization of the Gastric Mucosa NICK DORRELL,* M. CELESTE MARTINO,‡ RICHARD A. STABLER,* STEPHEN J. WARD,* ZUN W. ZHANG,§ ANDY A. McCOLM,\ MICHAEL J. G. FARTHING,§ and BRENDAN W. WREN* *Pathogen Molecular Biology and Biochemistry Unit, Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London, England; ‡Department of Pharmacology and Pharmacognosy, La Sapienze University, Rome, Italy; §Digestive Diseases Research Centre, St. Bartholomew’s and the Royal London School of Medicine and Dentistry, London, England; and \Systems Biology Unit, GlaxoWellcome Research and Development, Stevenage, England
Background & Aims: Phospholipase activity may play a role in the pathogenicity of Helicobacter pylori. Furthermore, some drugs that are effective against H. pylori infection are phospholipase inhibitors. Scrutiny of the H. pylori 26695 genome sequence revealed the presence of a putative protein with homology to Esherichia coli outer membrane phospholipase A (PldA). The aim of this study was to investigate the role of this putative PldA in the pathogenicity of H. pylori. Methods: An isogenic pldA mutant was constructed and analyzed for in vitro phospholipase A2 and hemolytic activity. Adherence of the mutant to human gastric adenocarcinoma cells and the ability to colonize mice were also investigated. Results: The pldA mutant showed a marked reduction in phospholipase A2 and hemolytic activity compared with the wild-type strain. The mutant was unable to colonize mice at 2 and 8 weeks, but it did induce a significant immune response. In contrast, the ability of the mutant to adhere to human gastric adenocarcinoma cells was unaffected. Conclusions: The results suggest a role for PldA in colonization of the gastric mucosa and possibly tissue damage after colonization.
elicobacter pylori is a gram-negative gastric pathogen that colonizes the stomachs of at least half the human population.1 Most infected individuals are asymptomatic; however, for approximately 1 in 10 people, infection with H. pylori is associated with the development of gastric disease, including duodenal and gastric ulcers and gastric adenocarcinoma.2 H. pylori survives largely within the gastric mucous layer without attaching to host cells.1 Infection with H. pylori is associated with an increase in gastric acid output and a reduction in the thickness of the mucous layer and in gastric mucosal hydrophobicity.3 H. pylori has been shown to alter the barrier properties of the epithelium in vitro.4 H. pylori possesses several different phospholipase (PL) activities such as PLA1, PLA2, and PLC.5 The main activity of these PLs is thought to be degradation of the
H
phospholipid components of the mucosal barrier.6 Lipids constitute about 20% of the dry weight of the human gastric mucus and are believed to be important in generating a hydrophobic barrier. Theoretically, PLs produced by mucosal pathogens such as H. pylori could be important in the breakdown of gastric surface integrity. PLs could be secreted in sufficient concentration to hydrolyze membrane phospholipids and initiate the inflammatory process found in gastritis.7 Although PL activity has been characterized in H. pylori, the gene(s) and protein(s) that contribute to this have not been identified. Scrutiny of the H. pylori 26695 genome sequence has revealed only one open reading frame with homology to characterized PL enzymes.8 HP0499 has homology to the outer membrane PldA group of enzymes, which are found in many Enterobacteriaceae.9,10 In addition to direct disruption of the mucosal barrier, PLs are also able to liberate leukotrienes and other eicosanoids, converted from arachidonic acid, which could also affect membrane permeability and mucous discharge.6 Hydrolysis of cell phospholipids also produces other cytotoxic products, such as lysolecithin,7 which is itself capable of producing tissue damage but is also a precursor for platelet-activating factor, a powerful ulcerogenic agent.7 H. pylori can also induce the release of PLA2 and other proteolytic enzymes from polymorphonuclear leukocytes recruited to sites of gastric injury, thus exacerbating the primary H. pylori–induced mucosal injury.5 Gastroprotective agents such as bismuth salts, sulglycotide, sucralfate, and ebrotidine, which have been used in the treatment of gastric ulcers, are thought to be Abbreviations used in this paper: AGS, human gastric adenocarcinoma (cells); bp, base pair; BHI, brain-heart infusion; CFU, colonyforming unit; ELISA, enzyme-linked immunosorbent assay; OD, optical density; PCR, polymerase chain reaction; PL, phospholipase; RBC, red blood cell. r 1999 by the American Gastroenterological Association 0016-5085/99/$10.00
November 1999
H. PYLORI PHOSPHOLIPASE 1099
potent inhibitors of H. pylori PLs.5,11 This suggests a possible role for PL in H. pylori–induced disease. Although it is still not fully understood how H. pylori is involved in gastric tissue damage, one hypothesis is that the inflammation and impaired mucosal defense caused by the action of bacterial PLs creates an environment that, in the presence of gastric acid and cytotoxic compounds, leads to ulceration.7 Given the likely importance of PL in the pathogenesis of H. pylori and the possible significance of PL inhibition in the mechanism of drug action, we constructed an isogenic H. pylori pldA mutant. The pldA mutant was compared, with several in vitro and in vivo assays, to both the wild-type strain and a previously characterized ureB mutant.12,13
Materials and Methods
The bacterial strains and plasmids used in this study are listed in Table 1. The wild-type strain used was the Sydney strain (SS1), which is able to colonize the mouse gastric mucosa and induce humoral immune responses that closely mimic those observed in human H. pylori infections.14,15 H. pylori strains were stored at ⫺80°C in brain-heart infusion (BHI) broth (Oxoid, Basingstoke, England) containing 15% glycerol and 10% fetal calf serum (Sigma, Poole, England). Strains were grown in BHI broth supplemented with 10% fetal calf serum or on Helicobacter-selective agar (DENT), consisting of blood agar base no. 2 (Oxoid) supplemented with 7% lysed defibrinated horse blood (TCS Microbiology, Botolph Claydon, England) and DENT’s selective supplement (Oxoid) in a microaerobic atmosphere at 37°C. Egg yolk agar was prepared as follows: egg yolk was aseptically separated from commerTable 1. Bacterial Strains and Plasmids Used in This Study
Strains H. pylori 26695 SS1 ND5 ND3 E. coli XL2-Blue MRF8 Plasmids pUC18 pJMK30 pND5 pND5-TI pND5-TIK
Relevant characteristics
Source
Virulent wild-type strain Virulent wild-type strain Knr H. pylori SS1 pldA mutant Knr H. pylori SS1 ureB mutant
Tomb et al.8 Lee et al.14 Current study Current study
Cloning strain
Stratagenea
Apr Knr; source of Knr BamHI cassette pUC19 plus 0.47-kb PCR gene fragment of H. pylori pldA pND5 with 10-bp deletion in pldA pND5-TI plus Knr
Pharmaciab Trieu-Cuot et al.33 Current study
Apr, ampicillin resistant; Knr, kanamycin resistant. The Netherlands. bSt. Albans, United Kingdom. aAmsterdam,
Name
PCR method
Strand
Sequence (58–38)
ND5F ND5R ND5 TIF ND5 TIR
PCR PCR IPCRM IPCRM
⫹ ⫺ ⫹ ⫺
ATGAAAAGCATTTTGCTCTTTATA GCATGAAATTTAATCATTCGCATG GCGAGATCTTTGCCTTTTTATCAT GCGAGATCTCCTAGATAATCCATC
NOTE. Underlined nucleotides represent Bgl II (ND5 TIF and ND5 TIR) restriction endonuclease sites.
cially bought eggs, mixed in a 1:1 ratio with sterile phosphatebuffered saline (PBS; pH 7.4), and then mixed with molten BHI agar (Oxoid) at 50°C in a ratio of 1 mL of yolk suspension per 20-mL plate. Escherichia coli strains were routinely grown in Luria–Bertani broth or on Luria–Bertani agar. The antibiotics used for selection purposes were ampicillin (100 mg · mL⫺1) and kanamycin (20 mg · mL⫺1 for H. pylori and 50 mg · mL⫺1 for E. coli).
DNA Manipulations
Bacterial Strains, Plasmids, and Growth Conditions
Strain/plasmid
Table 2. Oligonucleotides Used for PCR
Current study Current study
Unless otherwise stated, plasmid and chromosomal DNA extractions, restriction enzyme digests, DNA ligations, and transformations into E. coli were performed by standard procedures16 using enzymes supplied by Promega (Southampton, England). All chemicals were purchased from Sigma. The oligonucleotide primers used for PCRs were purchased from Genosys Biotechnologies (Europe) Ltd. (Pampisford, England) and are summarized in Table 2. The statistical significance of experimental data was determined using the unpaired Student t test performed with the InStat Statistical Package (Sigma).
Cloning of H. pylori pldA Gene The putative H. pylori pldA gene (HP0499) was amplified by PCR using H. pylori 26695 chromosomal DNA as a template. Primers ND5F and ND5R were designed from the HP0499 sequence to amplify a 471–base pair (bp) gene fragment. The amplified PCR product was cloned into pUC18 to produce pND5. pND5 was sequenced by the dideoxynucleotide chain termination method with a PRISM sequencing kit (Applied Biosystems, Warrington, England). The data were compared with the HP0499 sequence on the TIGR website (http://www.tigr.org/tdb/mdb/hpdb/hpdb.html). The H. pylori ureB gene (HP0072) was also cloned using the same method.
Construction of H. pylori pldA Mutant A 10-bp deletion and a unique BglII site were introduced into the cloned pldA gene fragment in pND5 by inverse PCR mutagenesis using primers ND5 TIF and ND5 TIR to produce pND5-TI, as described previously.17,18 A 1.4-kilobase BamHI restriction fragment of plasmid pJMK30 containing a gene encoding resistance to kanamycin (aph38-III12) was cloned into the unique BglII site of pND5-TI to form pND5-TIK. This construct was introduced into H. pylori SS1 wild-type strain by electroporation as described previously.19 Kmr colonies were selected after 4–5 days’ growth. An isogenic ureB mutant was also constructed using the same method.
1100 DORRELL ET AL.
Detection of PLA2 Activity Bacteria were grown on DENT agar for 48 hours and then for 24 hours in broth, until the bacteria were in the mid to late log phase of growth (optical density at 600 nm [OD600], 1.1–1.8) and in the spiral-shaped form. Cells were washed in PBS and resuspended in 1 mL of sonication buffer (0.1 mol/L sodium phosphate buffer, pH 8.0) for every 0.4 g of wet cells to give a final suspension of ⬃40%. The cells were lysed by five 30-second bursts of ultrasound (Ultrasonic Processor, Jencons Scientific Ltd., Leighton Buzzard, England) with 30-second cooling periods on ice between each burst. The insoluble debris was removed by centrifugation at 13,000 rpm for 20 minutes, and the soluble fraction was harvested. Quantitation of the total protein content was performed using a BCA protein assay kit (Pierce, Rockford, IL). Calculation of the amount of PLA2 in the bacterial lysates was performed by using a PLA2 detection kit (Assay Designs, Ann Arbor, MI). The assay quantitatively determines the amount of PLA2 in biological fluids. Each strain was tested in triplicate, and the results were expressed as units of PLA2 per milligram of total protein.
Assay for Hemolysis of Red Blood Cells Red blood cells (RBCs) from defibrinated horse blood were washed in PBS and resuspended to the initial volume with PBS. The suspension obtained was assumed to be 100% RBCs. Cultures of SS1, ND5, and ND3 were prepared as described above and resuspended in PBS to obtain a 20% (wt/vol) suspension. Duplicate reactions containing 4% and 2% H. pylori were incubated with a final concentration of 2% RBCs for 2 hours at 37°C, with shaking at 200 rpm. Negative controls, replacing the bacterial suspension with PBS, were also included. The samples were centrifuged at 4000 rpm for 5 minutes, and OD540 readings were recorded in duplicate. Samples were then sonicated for 30 seconds and centrifuged as before, and OD540 readings were recorded in duplicate to give a reference for 100% hemolysis. Each strain was tested in triplicate, and the results were expressed as a percentage of 100% hemolysis.
Adherence to Human Gastric Adenocarcinoma Cells The adherence assay was performed as described previously.20 H. pylori (5 ⫻ 108 organisms) were incubated with human gastric adenocarcinoma (AGS) cells (5 ⫻ 106 cells) at 37°C for 1 hour with agitation (150 rpm). Nonadherent bacteria were removed by washing with 10 mL of 15% sucrose solution. Cells were washed once with PBS and subsequently incubated with a 1:5 dilution of polyclonal anti–H. pylori antibody (SkyTek Laboratories, Logan, UT) on ice for 30 minutes. After being washed with 15 mL of PBS, the cells were then incubated for an additional 30 minutes on ice in a 1:20 dilution of fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Sigma). The cells were subsequently washed
GASTROENTEROLOGY Vol. 117, No. 5
and resuspended in 1 mL of 1% formaldehyde for flow cytometric analysis. A FACScan flow cytometer (Becton Dickinson, San Jose, CA) was used to measure bacteria adhering to AGS cells and was gated to include single cells and to exclude cell debris and unbound bacteria. The results are presented as a percentage figure calculated from the number of AGS cells adhered to by H. pylori strains and the total number of AGS cells analyzed by flow cytometry.
Colonization of H. pylori Mouse Model Female outbred mice (HSD/ICR strain, Harlan Ltd., Bicester, England) of ⬃20 g body wt (4–6 weeks old) were challenged orally on successive days with SS1, ND5, or ND3. Before challenge, both SS1 and ND5 were pretreated with acidified 5 mmol/L urea (pH 2) to boost urease activity and thus optimize colonization potential.21 ND3 was not pretreated, because this strain is an isogenic ureB mutant. Challenge inocula were 1-mL volumes of 24-hour tryptose soya broth (Oxoid) cultures containing between 1 ⫻ 107 and 1 ⫻ 108 colony-forming units (CFU). At 2 and 8 weeks, 10 mice from each group were culled by CO2 inhalation, and their stomachs were removed and opened along the greater curvature. After the stomach contents were washed away, the entire mucosal surface was spread evenly over the surface of a Columbia chocolate agar (Oxoid) plate containing selective antibiotics for ⬃10 seconds21 before plates were incubated microaerobically for 7 days at 37°C. The culture plates were then evaluated for H. pylori growth. Growth of even a single colony is sufficient to record an animal as being H. pylori positive.21 At 8 weeks, the mice were exsanguinated, and the individual serum samples were stored at ⫺20°C.
Whole Cell Serum Enzyme-Linked Immunosorbent Assay H. pylori SS1 cells were harvested from DENT agar plates, washed twice with PBS, and lysed by three 30-second bursts of ultrasound, with 30-second cooling periods on ice between each burst. The insoluble material was removed (13,000 rpm for 20 minutes), and the soluble material was used to coat wells of an EIA/RIA 96-well plate (Corning Costar, High Wycombe, England) for 18 hours at 4°C (1 µg/well in 0.1 mol/L NaHCO3, pH 9.5). The antibody levels within individual serum samples were determined by end-point titration, as described previously.22 Essentially, antigen-coated wells were incubated with serum samples serially diluted 2-fold in PBS. Bound antibody was visualized using a polyvalent anti-mouse immunoglobulin horseradish peroxidase conjugate (Sigma) and o-phenylenediamine as a substrate. Enzyme-linked immunosorbent assay (ELISA) titers were determined as the reciprocal of the highest serum dilution that gave an OD490 value of 0.5 U above the background. All titers were standardized against an anti–H. pylori whole cell antiserum.
November 1999
H. PYLORI PHOSPHOLIPASE 1101
Results Construction of an Isogenic H. pylori pldA Mutant The putative H. pylori PldA shows 33.8% identity and 54.1% similarity to the E. coli PldA.8 A putative PldA was identified from the recently sequenced Campylobacter jejuni 11168 genome on the Sanger Centre website (http://www.sanger.ac.uk/Projects/C_jejuni/), which had 27.7% identity and 56.5% similarity to the H. pylori PldA. PCR experiments with primers ND5F and ND5R consistently amplified a single band of 471 bp from H. pylori 26695 chromosomal DNA, which represents 44.2% of the H. pylori pldA gene (HP0499). The nucleotide sequences of 2 independently derived pldA clones were determined and found to be identical to each other and to the sequence of HP0499 (data not shown). The H. pylori pldA mutant was constructed by allelic replacement, as summarized previously.23 The H. pylori pldA cloned gene fragment was mutated by inverse PCR mutagenesis through introduction of a 10-bp deletion and the insertion of a kanamycin resistance cassette.17,18 Typically, electroporation resulted in 800 kanamycinresistant colonies per experiment. PCR analysis using primers ND5F and ND5R confirmed that a doublerecombination event had occurred (data not shown). Southern blot analysis of ND5 DNA using a 471-bp H. pylori pldA probe confirmed that the mutated pldA gene had undergone a double-recombination event (data not shown). To check for possible polar effects caused by the mutation in the pldA gene, reverse-transcription PCR/ complementary DNA analysis was performed, showing transcription of the adjacent genes HP0498 and HP0500 (data not shown). An isogenic H. pylori ureB mutant (ND3) was also constructed to act as a control in the in vitro and in vivo studies.12,13
Figure 1. Egg yolk agar clearing by H. pylori strains SS1 and ND3 (ureB). H. pylori strain ND5 (pldA) shows the loss of lecithinase activity. Some bacterial cells have been removed from the agar, showing the clearing of the egg yolk agar by SS1 and ND3, but not by ND5.
0.01), whereas those between SS1 and ND3 were not significant (P ⬎ 0.01). H. pylori suspensions were analyzed for the quantitative hemolysis of RBCs, and the results are presented as a percentage of 100% hemolysis (Figure 3). Hemolytic activity was markedly reduced in ND5 (P ⬍ 0.01). Activity in ND3 (P ⬎ 0.01) was similar to that in the wild-type SS1 strain. PLA2 and hemolysis assays were performed on a second pldA mutant constructed independently from ND5. Similar results were observed, strongly suggesting that a mutation of the pldA gene, and not an unrelated
In Vitro Characterization of the pldA Mutant No differences in colony morphology or growth rate were observed between the pldA (ND5) or ureB (ND3) mutants and the wild-type strain SS1 when grown on DENT plates. However, ND5 showed no observable zones of clearing when grown on egg yolk agar, in contrast to ND3 and SS1 (Figure 1).24 Bacterial lysates from SS1, ND5, and ND3 were assayed for PLA2 activity, and the results are presented as units of PLA2 per milligram of total protein (Figure 2). Statistical analysis showed the differences in PLA2 activity between SS1 and ND5 to be very significant (P ⬍
Figure 2. Quantitative determination of PLA2 activity in H. pylori lysates. The results are presented as units of PLA2 per milligram of the total protein content present in the lysates.
1102 DORRELL ET AL.
GASTROENTEROLOGY Vol. 117, No. 5
seroconverted, and the mean antibody titer generated by ND5-challenged mice, were not significantly different (P ⬎ 0.05) from values in the control group of mice challenged with ND3.
Discussion
Figure 3. Quantitative determination of hemolytic activity of H. pylori strains, showing the level of hemolysis of red blood cells after 2 hours at 37°C when coincubated with either 2% (§) or 4% (R) H. pylori suspensions. The level of hemolysis is presented as a percentage of 100% hemolysis determined by sonication.
mutation elsewhere on the chromosome, caused the phenotype. All strains were analyzed for the ability to adhere to cultured human AGS cells. Both ND5 and ND3 adhered to AGS cells at a level comparable with that in SS1. ND5 adherence was measured as 92.0% ⫾ 1.3% and ND3 as 95.6% ⫾ 2.6%, compared with the 92.8% ⫾ 2.6% observed with SS1. The results suggest that adherence to epithelial cells is unaffected by mutations in either the pldA or ureB genes. Colonization of H. pylori Mouse Model Three groups of 20 mice were infected with 1-mL volumes of overnight cultures of SS1 (1.05 ⫻ 108 CFU/6.4 ⫻ 107 CFU), ND5 (1.1 ⫻ 107 CFU/3.7 ⫻ 107 CFU), and ND3 (6.4 ⫻ 107 CFU/5.7 ⫻ 107 CFU), respectively (values in parentheses are numbers of viable bacteria administered to each mouse on successive days). All mice inoculated with SS1 were colonized at 2 and 8 weeks after infection. According to the scoring system for colonization described previously, the results showed 58% colonization at 2 weeks and 94% colonization at 8 weeks,21 which is indicative of growth in vivo. However, mice inoculated with ND5 or ND3 showed no colonization at either 2 or 8 weeks after infection.
Bacterial PLs are a diverse group of enzymes with a wide range of actions both in vitro and in vivo.25,26 These vary from minor alterations in cell membrane composition and function and controlled destruction of intracellular vacuoles to overt cytolysis. Although a definitive role in pathogenesis has been attributed to some PLs (such as the PLC of Clostridium perfringens, Listeria monocytogenes, and Pseudomonas aeruginosa and the PLD from Corynebacterium pseudotuberculosis), in most other instances the evidence is incomplete. In no case is the molecular basis for pathogenesis known. Further work is required to characterize PLs and thus elucidate their structural and functional similarities and their roles in pathogenesis. Current evidence suggests that H. pylori can produce and release an active PL and indirectly induce production of PLs from inflammatory polymorphonuclear leukocytes. This may result in mucosal damage either through the breakdown of hydrophobic elements within the mucous layer or by catalyzing the hydrolysis of the plasma membrane of gastric epithelial cells. Scrutiny of the genome sequence of H. pylori 26695 revealed the presence of only 1 putative enzyme with homology to a known PL.8 Open reading frame HP0499 shows 33.8% identity and 54.1% similarity to the E. coli PldA (http://www.tigr.org/tdb/mdb/hpdb/hpdb.html) and also high homology to PldA enzymes from other bacteria.10 The H. pylori pldA gene encodes a protein of ⬃42.5 kilodaltons. We have investigated the role of this putative H. pylori pldA gene in the pathogenicity of H. pylori
Anti–H. pylori Serum Responses Serum isolated from individual mice 8 weeks after oral inoculations was analyzed for the presence of anti–H. pylori antibodies by ELISA. Only 3 of the 10 mice given ND5 generated a positive anti–H. pylori serum response. In comparison, 9 of the 10 mice challenged with the SS1 wild-type strain seroconverted (Figure 4). In addition, the mean antibody titer induced by ND5 was significantly lower (P ⬍ 0.05) than that found in SS1inoculated mice. The number of mice that positively
Figure 4. Serum anti–H. pylori whole cell immunoglobulin responses 8 weeks after infection. End-point antibody titers from individual mice are shown. Bars denote mean antibody responses.
November 1999
by the construction of an isogenic mutant. This is an example of how a known phenotypic determinant can be investigated at a molecular level by initial analysis of the genome sequence.27 H. pylori has been shown to have a substantially higher PLA2 activity than most other bacteria when tested in vitro, and it has been suggested that these high levels of PLA2 may be clinically significant.7 The levels of PLA2 and lysolecithin (produced by hydrolysis of cell phospholipids) in the basal gastric aspirates of patients infected with H. pylori were found to be significantly higher than those from uninfected patients.7 The proportion of lysolecithin out of the total phospholipid content in these gastric aspirates was also found to be much higher in the infected group, suggesting greater hydrolysis of cell phospholipids in patients infected with H. pylori.7 In this study, both the wild-type SS1 strain and the control ureB mutant tested positive for lecithinase activity by the egg yolk agar assay. In contrast, the pldA mutant showed no observable zones of clearing when grown on egg yolk agar, suggesting that H. pylori PldA has lecithinase activity. A Vibrio cholerae lec mutant also fails to produce zones of clearing when grown on egg yolk agar,4 but there is no similarity between the H. pylori PldA and V. cholerae Lec amino acid sequences. The similarity of the putative H. pylori PldA to other PldA proteins,10 and the observed absence of lecithinase activity with the pldA mutant, suggested that the gene does encode a PL. To test this hypothesis, the H. pylori strains were tested for PLA2 activity. The pldA mutant showed a ⬎90% reduction in PLA2 activity compared with the wild-type strain. In contrast, the control ureB mutant showed PLA2 activity comparable with SS1. Considered together, these 2 observations provide strong evidence that the putative H. pylori PldA protein is indeed an active PL. Hemolysins are known virulence determinants for a number of bacterial pathogens. Several studies have shown erythrocyte lysis to be dependent on PL activity.28 This PL-mediated hemolytic activity is often attributable to the accumulation of lysophospholipids, produced by the hydrolysis of cell phospholipids that destabilize membranes. A Campylobacter coli pldA mutant was shown to have reduced hemolytic activity compared with the wild-type strain, suggesting some role for pldA in Campylobacter virulence.29 The H. pylori pldA mutant showed an ⬃50% reduction in hemolytic activity compared with SS1, whereas the ureB mutant showed hemolytic levels comparable with those in SS1. To determine whether PldA is an important virulence determinant in vivo, the pldA mutant was analyzed for the ability to colonize mice. The pldA mutant was shown
H. PYLORI PHOSPHOLIPASE 1103
to be attenuated in the H. pylori mouse model, showing no sign of colonization either 2 or 8 weeks after infection. These results were comparable with those for the ureB mutant, which has been shown previously to not colonize gnotobiotic piglets.13 Interestingly, both mutants did elicit a humoral immune response in some of the infected mice. Although no detectable colonization was observed with the pldA mutant, it is possible that an acute colonization occurred that could have been detected with earlier gastric sampling. In the gnotobiotic piglet model, nonmotile H. pylori mutants (which cause only a very transient colonization) have been shown to elicit a humoral immune response.30 More recently, a similar result was observed in the mouse model with a flaA mutant of SS1.31 Together these results suggest that some of the aflagellate bacteria must adhere to gastric mucin and persist in the stomach for several days, before leaving the stomach due to their inability to penetrate and colonize the mucous layer. This limited colonization appears to be sufficient to stimulate an immune response. The pldA mutant does not colonize the gastric mucosa but does induce an immune response, suggesting that a similar transient colonization must occur. The pldA mutant is motile and shows similar levels of adhesion to AGS cells as the SS1 wild-type strain. Possibly, the pldA mutant can adhere to mucin on the surface of the gastric mucosa, much like the wild-type strain. However, it seems likely that the pldA mutant fails to colonize the gastric mucosa, not as a result of poor adherence to the gastric mucin or lack of motility but rather because of an inability to break down the mucous layer to allow penetration and colonization. It is known that functional urease activity and full motility are required for colonization of the gastric mucosa by H. pylori.32 The pldA mutant was shown to be both motile and urease positive (data not shown). We postulate that the inability of the pldA mutant to colonize the gastric mucosa arises from a failure to break down the mucous layer sufficiently to allow penetration by the bacteria, because of a lack of functional PL. The lack of colonization by the pldA mutant may cast some light on the mode of action of therapeutic agents such as bismuth salts, sulglycotide, sucralfate, and ebrotidine. These agents are potent inhibitors of H. pylori PLs, and their ultimate therapeutic effect may be to disrupt the actions of the PldA enzyme and thus reduce the ability of H. pylori to maintain colonization of the gastric mucosa. In conclusion, we have shown the pldA gene from the H. pylori 26695 genome sequence to encode an active PL with lecithinase, PLA2, and hemolytic activities. Mutation of the pldA gene abrogates the ability of H. pylori to
1104 DORRELL ET AL.
colonize mice. These results strongly indicate the H. pylori PL to be an important virulence determinant.
References 1. Blaser MJ. Ecology of Helicobacter pylori in the human stomach. J Clin Invest 1997;100:759–762. 2. Kuipers EJ. Helicobacter pylori and the risk and management of associated diseases: gastritis, ulcer disease, atrophic gastritis and gastric cancer. Aliment Pharmacol Ther 1997;11:71–88. 3. Asante M, Ahmed H, Patel P, Davis T, Finlayson C, Mendall M, Northfield T. Gastric mucosal hydrophobicity in duodenal ulceration: role of Helicobacter pylori infection density and mucus lipids. Gastroenterology 1997;113:449–454. 4. Terres AM, Pajares JM, Hopkins AM, Murphy A, Moran A, Baird AW, Kelleher D. Helicobacter pylori disrupts epithelial barrier function in a process inhibited by protein kinase C activators. Infect Immun 1998;66:2943–2950. 5. Ottlecz A, Romero JJ, Hazell SL, Graham DY, Lichtenberger LM. Phospholipase activity of Helicobacter pylori and its inhibition by bismuth salts: biochemical and biophysical studies. Dig Dis Sci 1993;38:2071–2080. 6. Nilius M, Malfertheiner P. Helicobacter pylori enzymes. Aliment Pharmacol Ther 1996;10:65–71. 7. Langton SR, Cesareo SD. Helicobacter pylori associated phospholipase A2 activity: a factor in peptic ulcer production. J Clin Pathol 1992;45:221–224. 8. Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, Ketchum KA, Klenk HP, Gill S, Dougherty BA, Nelson K, Quackenbush J, Zhou LX, Kirkness EF, Peterson S, Loftus B, Richardson D, Dodson R, Khalak HG, Glodek A, McKenney K, Fitzegerald LM, Lee N, Adams MD, Hickey EK, Berg DE, Gocayne JD, Utterback TR, Peterson JD, Kelley JM, Cotton MD, Weidman JM, Fujii C, Bowman C, Watthey L, Wallin E, Hayes WS, Borodovsky M, Karp PD, Smith HO, Fraser CM, Venter JC. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 1997;388:539–547. 9. Brok RGPM, Brinkman E, Vanboxtel R, Bekkers ACAPA, Verheij HM, Tommassen J. Molecular characterization of enterobacterial PldA genes encoding outer membrane phospholipase A. J Bacteriol 1994;176:861–870. 10. Brok RGPM, Boots AP, Dekker N, Verheij HM, Tommassen J. Sequence comparison of outer membrane phospholipases A: implications for structure and for the catalytic mechanism. Res Microbiol 1998;149:703–710. 11. Slomiany BL, Murty VLN, Piotrowski J, Slomiany A. Gastroprotective agents in mucosal defense against Helicobacter pylori. Gen Pharmacol 1994;25:833–841. 12. Ferrero RL, Cussac V, Courcoux P, Labigne A. Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange. J Bacteriol 1992;174:4212–4217. 13. Eaton KA, Krakowka S. Effect of gastric pH on urease-dependent colonization of gnotobiotic piglets by Helicobacter pylori. Infect Immun 1994;62:3604–3607. 14. Lee A, O’Rourke J, DeUngria MC, Robertson B, Daskalopoulos G, Dixon MF. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology 1997; 112:1386–1397. 15. Ferrero RL, Thiberge JM, Huerre M, Labigne A. Immune responses of specific-pathogen-free mice to chronic Helicobacter pylori (strain SS1) infection. Infect Immun 1998;66:1349–1355. 16. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
GASTROENTEROLOGY Vol. 117, No. 5
17. Wren BW, Henderson J, Ketley JM. A PCR-based strategy for the rapid construction of defined bacterial deletion mutants. Biotechniques 1994;16:994–996. 18. Dorrell N, Gyselman VG, Foynes S, Li SR, Wren BW. Improved efficiency of inverse PCR mutagenesis (IPCRM). Biotechniques 1996;21:604–608. 19. Segal ED, Tompkins LS. Transformation of Helicobacter pylori by electroporation. Biotechniques 1993;14:225–226. 20. Dunn BE, Altmann M, Campbell GP. Adherence of Helicobacter pylori to gastric carcinoma cells: analysis by flow cytometry. Rev Infect Dis 1991;13:S657–S664. 21. McColm AA. Nonprimate animal models of H. pylori infection. In: Clayton CL, Mobley HLT, eds. Helicobacter pylori protocols. Totowa, NJ: Humana, 1997: 235–251. 22. Douce G, Fontana M, Pizza M, Rappuoli R, Dougan G. Intranasal immunogenicity and adjuvanticity of site-directed mutant derivatives of cholera toxin. Infect Immun 1997;65:2821–2828. 23. Jenks PJ, Foynes S, Ward SJ, Constantinidou C, Penn CW, Wren BW. A flagellar-specific ATPase (FliI) is necessary for flagellar export in Helicobacter pylori. FEMS Microbiol Lett 1997;152:205– 211. 24. Fiore AE, Michalski JM, Russell RG, Sears CL, Kaper JB. Cloning, characterization, and chromosomal mapping of a phospholipase (lecithinase) produced by Vibrio cholerae. Infect Immun 1997;65: 3112–3117. 25. Songer JG. Bacterial phospholipases and their role in virulence. Trends Microbiol 1997;5:156–161. 26. Titball RW. Bacterial phospholipases. J Appl Microbiol 1998;84: 127S–137S. 27. Dorrell N, Wren BW. From genes to genome biology: a new era in Helicobacter pylori research. Gut 1998;42:451–453. 28. Ansorg R, Rein R, Spies A, von Reckling G. Cell-associated hemolytic activity of Helicobacter pylori. Eur J Clin Microbiol Infect Dis 1993;12:98–104. 29. Grant KA, Belandia IU, Dekker N, Richardson PT, Park SF. Molecular characterization of PldA, the structural gene for a phospholipase A from Campylobacter coli, and its contribution to cell-associated hemolysis. Infect Immun 1997;65:1172–1180. 30. Eaton KA, Suerbaum S, Josenhans C, Krakowka S. Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes. Infect Immun 1996;64:2445–2448. 31. Danon SJ, Eaton KA. Isogenic flagella mutants of Helicobacter pylori: candidates for an attenuated vaccine? Gut 1998;43(suppl 2):A38. 32. Moran AP, Wadstrom T. Pathogenesis of Helicobacter pylori. Curr Opin Gastroenterol 1998;14(suppl 1):S9–S14. 33. Trieu-Cuot P, Gerbaud G, Lambert T, Courvalin P. In vivo transfer of genetic information between gram-positive and gram-negative bacteria. EMBO J 1985;4:3583–3587.
Received January 6, 1999. Accepted July 13, 1999. Address requests for reprints to: Brendan W. Wren, Ph.D., Pathogen Molecular Biology and Biochemistry Unit, Department of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, Keppel Street, London WC1E 7HT, England. e-mail: [email protected]; fax: (44) 171-636-8739. Supported by the Joint Research Board of St Bartholomew’s Hospital and the Medical Research Council, United Kingdom. Dr. Ward’s current address is: Medeva Development, Vaccine Research Unit, Department of Biochemistry, Imperial College of Science, Technology and Medicine, London, England. The authors thank Angela Whiley and Lynne Batty for technical assistance and Richard Ferrero for the generous gift of strain SS1.