Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases

BBAPAP-39424; No. of pages: 11; 4C: 4, 9 Biochimica et Biophysica Acta xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbapap

4Q5

Anna S. Chalova a, Maria V. Sudnitsyna a, Sergei V. Strelkov b, Nikolai B. Gusev a,⁎

7

a r t i c l e

8 9 10 11 12

Article history: Received 22 June 2014 Received in revised form 29 August 2014 Accepted 4 September 2014 Available online xxxx

13 14 15 16 17 18 19

Keywords: Peripheral neuropathy Small heat shock protein Oligomeric structure Thermal stability Hydrophobic property Chaperone-like activity

Department of Biochemistry, School of Biology, Moscow State University, Moscow 119991, Russian Federation Laboratory for Biocrystallography, Department of Pharmaceutical and Pharmacological Sciences, KU Leuven, Belgium

a b s t r a c t

P

i n f o

Physico-chemical properties of four mutants (T164A, T180I, P182S and R188W) of human small heat shock protein HspB1 (Hsp27) associated with neurodegenerative diseases were analyzed by means of fluorescence spectroscopy, dynamic light scattering, size-exclusion chromatography and measurement of chaperone-like activity. Mutation T164A was accompanied by destabilization of the quaternary structure and decrease of thermal stability without any significant changes of chaperone-like activity. Mutations T180I and P182S are adjacent or within the conserved C-terminal motif IPI/V. Replacement of T180I leading to the formation of hydrophobic cluster consisting of three Ile produced small increase of thermal stability without changes of chaperone-like activity. Mutation P182S induced the formation of metastable large oligomers of HspB1 with apparent molecular weight of more than 1000 kDa. Oligomers of P182S have very low thermal stability and undergo irreversible aggregation at low temperature. The P182S mutant forms mixed oligomers with the wild type HspB1 and the properties of these mixed oligomers are intermediate between those of the wild type HspB1 and its mutant. Mutation R188W did not significantly affect quaternary structure or thermal stability of HspB1, but was accompanied by a pronounced decrease of its chaperone-like activity. All mutations analyzed are associated with hereditary motor neuropathies or Charcot–Marie–Tooth disease type 2; however, molecular mechanisms underlying pathological effects are specific for each of these mutants. © 2014 Published by Elsevier B.V.

E

T

C

E

b

35

R

39 37 36 38

41 42

1. Introduction

R

40

O

a

R O

5 6

D

2

F

3

Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases

1

U

N C O

Small heat shock proteins (sHsps) form a large family of proteins having small molecular weight (12–43 kDa) of monomers and 43 expressed in practically all kingdoms including viruses, bacteria, plants 44 and vertebrate and invertebrate animals [1–3]. Ten members of this 45 family (HspB1–HspB10) are encoded in human genome and certain 46 Q9 members of them (HspB1, HspB5, HspB6, HspB8) are ubiquitously 47 expressed in practically all human tissues [4–6]. These proteins have 48 similar primary structure consisting of conservative α-crystallin 49 domain (~90 residues) and variable N- and C-terminal domains [2,3]. 50 As a rule, the small heat shock proteins form homo- or heterooligomers 51 Q10 possessing highly dynamic structure and being able to easily exchange 52 their subunits [7,8]. The small heat shock proteins play important role 53 in protein homeostasis (proteostasis) protecting the cell from different 54 unfavorable conditions [9]. Possessing the so-called chaperone-like

Abbreviations:ACD,α-crystallin domain;DLS,dynamiclight scattering;IPTG, isopropylβ-thiogalactoside; ME, β-mercaptoethanol; SEC, size exclusion chromatography; sHsps, small heat shock proteins; WT, wild type ⁎ Corresponding author. Tel.:/fax: +7 495 939 2747. E-mail address: [email protected] (N.B. Gusev).

activity, the members of sHsp family prevent accumulation of aggregates of mutated or denatured proteins [9,10], regulate proteolytic elimination of denatured proteins [11], are involved in regulation of cellular redox state [7], stabilize the cytoskeleton [12], possess antiapoptotic activity [13] and participate in many other vital processes. Therefore mutations of small heat shock proteins are often associated with different congenital human diseases [14,15]. At present about twenty different mutations of HspB1 associated with distal hereditary motor neuropathy and Charcot–Marie–Tooth disease of the second type are described in the literature [14,15] and presented in mutation database HMGD Pro v.2014.2. Molecular mechanisms underlying the probable participation of mutated HspB1 in the development of distal neuropathy remain poorly characterized. Therefore it seems reasonable to analyze and compare some properties of the wild type HspB1 and its mutants associated with different forms of neuropathy. Along these lines, very recently some biochemical properties of HspB1 mutants carrying mutations in the α-crystallin domain were analyzed [16–19]. This paper deals with the analysis of some properties of four HspB1 mutants T164A [20], T180I [21], P182S [22] and R188W [23] all associated with different forms of hereditary motor neuropathy. These mutations reside either in the last β-strand of the α-crystallin domain (T164A), in the C-terminal domain (T180I, P182S) or in the so-called C-terminal

http://dx.doi.org/10.1016/j.bbapap.2014.09.005 1570-9639/© 2014 Published by Elsevier B.V.

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

20 21 22 23 24 Q6 25 26 27 28 29 30 31 32 33 34

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76

83 84

102

cDNA of the wild type HspB1 in pET23b [25] was used for obtaining all mutants. For obtaining T164A mutant we used the following forward (fw) (5′-CCCCTGAGGGCACACTGGCCGTG-3′) and reverse (rev) (5′TCCACGGCCAGTGTGCCCTCAGGGG-3′) primers. The following fw (CCCAAGCTAGCCACGCAGTCCAACGAGATCATAATCCCAG) and rev (5′GCGTGGCTAGCTTGGGCATGGGG-3′) primers were used for obtaining T180I mutant of HspB1. Two rounds of PCR were performed. In the first round using wild type HspB1 f. and mutant rev primers and mutant fw and wild type rev primers we obtained two overlapping fragments. After purification these fragments were annealed by using wild type HspB1 f. and wild type HspB1 rev primers. For obtaining R188W mutant we used the megaprimer method [26] utilizing 5′-GAGTCGTGGGCCCA GCTTGGG-3′ forward and gene-specific rev primer (5′-ATTAACTCGA GTTACTTGGCGGCAGTC-3′). This method is simpler, but was not suitable for preparation of two above-mentioned mutants due to the very large size of megaprimers in the case of T164A and T180I mutants. Molecular constructs encoding P182S mutant were prepared in Eurogen (Moscow). All constructs were cloned into pET23b vector at NdeI and XhoI sites and integrity of HspB1 sequence and lack of additional mutations were confirmed by DNA sequencing.

103 104

2.2. Expression and purification of recombinant HspB1 and its C-terminal mutants

105

Expression of the wild type HspB1 and its T164A, T180I and R188W mutants was performed as described earlier [18]. Briefly Escherichia coli (BL21 pLysS) was grown on standard Luria–Bertani (LB) media at 37 °C and expression was induced by addition of 0.5 mM IPTG and lasted for 4 h. Bacterial cells were collected by centrifugation and stored at −20 °C before further purification. Under the conditions described the wild type protein and its T164A, T180I and R188W mutants were predominantly accumulated in the soluble fraction. Under the same conditions expression of P182S was accompanied by accumulation of recombinant protein in inclusion bodies. In an attempt to avoid this problem we used two different E. coli strains, namely C41 and C43, and expressed P182S mutant at two different temperatures, i.e. 30 and 37 °C. We also tried the autoinduction method [27] growing three different strains of E. coli (BL21 pLysS, C41 and C43) in 3-fold LB media at different temperatures. Finally we used Arctic express strain of E. coli and tried to express P182S mutant of HspB1 at low (12 °C) temperature. Unfortunately, under all conditions used P182S was accumulated exclusively in inclusion bodies complicating its further purification. The earlier described method [18] was used for purification of the wild type protein and it's T164A, T180I and R188W mutants. This method consisted in sonication of bacterial cells followed by centrifugation and subjection of the soluble fraction to ammonium sulfate fractionation, ion-exchange chromatography on high TrapQ and size exclusion chromatography on Superdex 200. The final preparations of these proteins were dialyzed, concentrated and stored in buffer B (20 mM Tris-acetate pH 7.6, containing 10 mM NaCl, 0.1 mM EDTA, 0.1 mM PMSF and 1 mM DTT) at −20 °C. In the case of P182S mutant bacterial cells were sonicated in lysis buffer (50 mM Tris–HCl pH 8.0, containing 100 mM NaCl, 0.1 mM EDTA, 0.1 mM PMSF and 15 mM β-mercaptoethanol (ME)) and subjected to centrifugation. The pellet of inclusion bodies was resuspended in lysis buffer and washed in this buffer for 3 times. The pellet obtained

100 101

106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137

C

98 99

E

96 97

R

95

R

93 94

O

91 92

C

89 90

N

87 88

U

85 86

2.3. Fluorescence spectroscopy

150

F

2.1. Cloning of the wild type HspB1 and its mutants

140 141 142 143 144 145 146 147 148 149

All fluorescence measurements were performed on Cary Eclipse spectrofluorometer (Varian). Intrinsic Trp fluorescence of different protein samples (0.1 mg/ml) was recorded in buffer F (20 mM HEPES/ NaOH pH 7.5, containing 100 mM NaCl and 2 mM DTT). Fluorescence was excited at 297 nm and recorded in the range of 300–400 nm (both slits width 5 nm). Temperature dependence of intrinsic Trp fluorescence of different proteins was measured by recording dependence of fluorescence excited at 297 nm and recorded at 320 and 365 nm (both slits width 5 nm) upon heating. All measurements were performed in buffer F. The protein samples (0.1 or 0.3 mg/ml) in automatic Peltier cell holder were heated in the range of 20–90 °C with constant rate of 1 °C/min. In the range of thermal transition the intensity of fluorescence I = (1 − α) ∗ In + Id ∗ α, where In and Id are the intensities of fluorescence of native and denatured proteins and α is equal to the fraction of conversion from native to denatured state. Outside of the range of thermal transition there is a linear dependence of reciprocal intensity of fluorescence upon the absolute temperature, i.e. 1/I = a + b ∗ T / η, where a and b are the constants, T is the absolute temperature and η is the viscosity (in cPs) [29]. By using this equation we were able to determine In (before thermal transition) and Id (after thermal transition) and to plot dependence of α on temperature in the range of thermal transition and thus determine the temperature of half transition between native and denatured states of different proteins. Alternatively we determined the temperature of half-transition by using the so-called phase plot, i.e. dependence of intensity of fluorescence at 320 nm (I320) upon fluorescence at 360 nm (I360) at different temperatures [30]. Before and after thermal transition this plot is linear and in the range of thermal transition it becomes non-linear. Using this plot we were also able to determine the temperature of half-maximal transition. Both approaches gave similar results and were used for the estimation of thermal stability of different proteins. Titration with fluorescent probe bis-ANS was used for the investigation of hydrophobic properties of HspB1 and its C-terminal mutants. Proteins (0.1 mg/ml) in buffer FF (50 mM phosphate pH 7.5, containing 150 mM NaCl and 2 mM DTT) were titrated at 25 °C with bis-ANS so that the final concentration of fluorescent probe was varied in the range of 0–12 μM. Fluorescence was excited at 395 nm and recorded at 485 nm (slit width 2 and 5 nm respectively). Plotting dependence of fluorescence on the total concentration of bis-ANS added we were able to estimate the apparent dissociation constant of the complex formed by bis-ANS and different species of HspB1 and the total concentration of bis-ANS-binding sites [31].

151

2.4. Temperature dependence of light scattering

193

The protein samples (0.1–0.3 mg/ml) in buffer F were heated with constant rate of 1 °C/min in the range of 20–90 °C in automatic Peltier cell holder of Cary Eclipse spectrofluorometer. Light scattering was recorded by illuminating the sample at 340 nm (slit width 2.5 nm) and recording the signal at 340 nm (slit width 2.5 nm).

194 195

O

82

R O

2. Materials and methods

138 139

P

81

was dissolved in small volume of lysis buffer containing 8 M urea and centrifuged for 20 min at 14.000 g. Thus obtained supernatant was dialyzed overnight against buffer B and subjected to centrifugation (30 min, 105.000 g). The soluble fraction was used for purification of P182S mutant by means of ion-exchange chromatography on high TrapQ and size exclusion chromatography on Superdex 200 under conditions used for purification of all other proteins. At least two different preparations of the wild type HspB1 and its mutants were used for this study. The purity of each protein sample was not less than 95% according to SDS gel electrophoresis [28] and no significant differences were observed for different batches of the same protein.

T

79 80

extension (R188W). Notably, the mutation P182S changes the middle residue of the highly conserved C-terminal ‘anchoring motif’ IPI/V that has been suggested to have a role in the oligomer assembly process [8,24] and the residue T180 immediately precedes this motif.

D

77 78

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

E

2

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

152 153 154 155 156 157 158 159 160 161 162 163 Q11 164 165 Q12 166 167 168 Q13 169 170 171 172 173 Q14 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192

196 197 198

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

207

Dynamic light scattering was used for the estimation of the size of HspB1 particles. All measurements were performed in buffer D (20 mM Tris-acetate pH 7.6, 150 mM NaCl, 0.1 mM EDTA, 0.1 mM PMSF, 15 mM ME) at protein concentration 0.3 mg/ml on Zetasizer Nano (Malvern) at 25 °C. For each protein sample we performed 100 measurements each lasting for 15 s. The data presented were obtained from number distribution calculated by built-in program of Zetasizer Nano.

208

2.6. Size-exclusion chromatography (SEC)

209 210

Size exclusion chromatography was used for the investigation of oligomeric structure of HspB1 and its mutants. All experiments were performed at room temperature on Superdex 200 HR 10/30 column equilibrated with buffer D and run at the rate of 0.5 ml/min. The sample (150 μl) containing different quantities of protein (10–120 μg) was loaded on the column and eluted with the rate of 0.5 ml/min. The column was calibrated with protein standards thyroglobulin (669 kDa), ferritin (440 kDa), bovine serum albumin (68 kDa), ovalbumin (43 kDa) and chymotrypsinogen (25 kDa).

211 212 213 214 215 216 217 218 219 220 221

226

2.8. Chaperone-like activity

227

Three different model protein substrates were used for the determination of chaperone-like activity of the wild type HspB1 and its mutants. In the first case we analyzed the effect of HspB1 on reduction-induced aggregation of egg white lysozyme (Helicon). All experiments were performed at 37 °C in buffer L (50 mM phosphate buffer, pH 7.5) at variable concentrations of HspB1 and at lysozyme concentration equal to 0.2 mg/ml. The samples of HspB1 and its mutants were preincubated for 20 min at 45 °C in the presence of 20 mM DTT. This operation was performed in order to achieve complete reduction of HspB1 SH groups which can undergo spontaneous oxidation with the formation of intersubunit disulfide bond [32]. Afterwards the temperature of incubation was decreased to 37 °C and reaction was started by addition of stock solution of lysozyme. Aggregation kinetics of reduced lysozyme was followed by the increase of optical density at 340 nm. In the second case we analyzed the effect of HspB1 and its mutants on the heat induced aggregation of subfragment-1 (S1) of rabbit skeletal myosin obtained as described earlier [33]. Reaction was performed at 42 °C in S buffer (20 mM HEPES/NaOH pH 7.0, 115 mM NaCl, containing 20 mM DTT) at S1 concentration equal to 0.4 mg/ml and variable concentrations (0.05 or 0.1 mg/ml) of HspB1. The samples of HspB1 and its mutants were preincubated in buffer S at 42 °C for 20 min and reaction was started by addition of S1. Heat-induced aggregation of S1 was followed by the increase of optical density at 340 nm. In the third case we investigated the effect of HspB1 on the heat induced aggregation of porcine mitochondria malate dehydrogenase (MDH) (Serva). Ammonium sulfate suspension of MDH was added to the buffer M (10 mM phosphate buffer, pH 7.4 containing 2 mM DTT) up to the final concentration of ~2 mg/ml and subjected to centrifugation for 5 min at 12.000 g. The samples of HspB1 and its mutant were reduced by incubation in excess of DTT as described earlier and reaction was started by addition of clarified solution of MDH. All experiments

235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257

C

E

R

233 234

R

231 232

264

260 261 262

265 266 267 268 269 270 271 272 273 274

3.1. Isolation of the wild type HspB1 and its C-terminal mutants

275

By using an earlier described method [18] we were able to obtain homogeneous preparations of the wild type protein and its T164A, T180I and R188W mutants (Fig. 1). At the same time bacterial expression was accompanied by accumulation of recombinant P182S mutant in inclusion bodies and all our attempts to obtain this mutant in soluble state were unsuccessful. Therefore we tried to isolate this mutant from inclusion bodies. For this purpose we dissolved inclusion bodies in the buffer containing 8 M urea and renatured P182S mutants by slow dialysis against buffer B. This procedure resulted in solubilization of the largest part of this protein and provided for effective purification of P182S mutant by the procedure used for all other mutants. According to SDS gel electrophoresis (Fig. 1) P182S mutant has slightly higher electrophoretic mobility than any other HspB1 mutants. We suppose that this can be due to higher SDS binding for this mutant. In this respect it is worthwhile to mention that the apparent molecular weight of the wild type HspB1 determined by SDS gel electrophoresis (~ 27 kDa) is much higher than its real molecular weight (22.8 kDa). Exposure to high concentration of urea used for isolation of P182S mutant can affect protein properties. Therefore in separate experiments we subjected the wild type HspB1 to the same procedure of

276

N C O

229 230

Modeling of T163A mutant was performed as described earlier [18]. Probable location of the C-terminal end was predicted by superposition of the recently published structure of the α-crystallin domain of HspB1 (residues 86–159) co-crystallized with its C-terminal peptide (residues 179–185, ITIPVTF) (PDB entry 4MJH, www.pdb.org) [34] and by analyzing the structure of zebra fish HspB5 fragment (residues 60–166) with similar primary structure of its C-terminal end (PDB entry 3N3E) [35]. Predictions of the secondary structure of the C-terminal end (residues 157–205) of the wild type HspB1 and its mutants were performed by using JPred [36] and PsiPred [37] prediction servers.

U

228

T

224 225

222 223

263

3. Results

2.7. Formation of mixed oligomeric complexes of the wild type HspB1 and its P182S mutant The wild type HspB1 and its P182S mutant were incubated either separately or mixed together for 1 h at 42 °C in buffer D. After finishing of incubation the isolated proteins or their mixture was analyzed by means of light scattering and subjected to the size-exclusion chromatography on the Superdex 200 HR 10/30 column and eluted at the rate of 0.5 ml/min.

2.9. Modeling of the structure of HspB1 mutants

P

205 206

D

204

E

202 203

258 259

F

200 201

were performed at 45 °C at MDH concentration equal to 0.2 mg/ml and variable concentrations of HspB1. Heat-induced aggregation of MDH was followed by the increase of optical density at 340 nm. All experiments were performed in 300 μl microcells on Ultrospec 3100 Pro spectrophotometer.

O

2.5. Dynamic light scattering (DLS)

R O

199

3

Fig. 1. SDS-gel electrophoresis of the final preparations of the wild type HspB1 (WT) and its T164A, T180I, P182S and R188W mutants. Positions of protein markers and their molecular weights are marked by arrows.

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295

303 304 305 306 307

3.2. Fluorescent spectroscopy analysis of some properties of the wild type HspB1 and its mutants

We used fluorescent spectroscopy and light scattering in order to analyze thermal stability of the wild type HspB1 and its mutants. Fluo310 rescent spectroscopy was used for comparison of spectral properties 311 of the wild type HspB1 and its C-terminal mutants. Fluorescent spec312 trum of the wild type HspB1 is indistinguishable from that of T164A, 313 T180I or P182S mutants (Fig. 2A). These data indicate that, as a rule, 314 mutations located in the C-terminal end do not dramatically affect the 315 environment and properties of six Trp residues located in the N316 terminal domain and beginning of α-crystallin domain of HspB1. At 317 the same time, replacement of Arg188 by Trp results in an additional 318 fluorophore, leading to the increase of fluorescence (Fig. 2A). The wild 319 type HspB1 contains six Trp residues, therefore addition of one extra 320 Trp residue will increase the number of intrinsic fluorophores by 321 Q15 about 17%. If all Trp residues have similar fluorescent properties, then

Earlier published data [41] indicate that the wild type HspB1 undergoes temperature-dependent self-aggregation accompanied by the formation of the so-called granules. We compared the process of temperature-dependent self-aggregation for the wild type HspB1 and its C-terminal mutants (Fig. 3). In good agreement with the earlier published results [41,42] we found that in the range of 40–70 °C heating of the wild type HspB1 was accompanied by slow increase of the light scattering. Further heating in the range of 70–80 °C induced a significant increase of the light scattering followed by a decrease of this parameter in the range of 80–90 °C (Fig. 3). The overall shape of dependence of light scattering on the temperature was similar for all mutants analyzed. However, the temperature of half-maximal increase of the light scattering on the temperature was significantly different. For instance, in the case of P182S we did not observe any changes of the light scattering in the range of 20–55 °C, however, further increase of the temperature leads to rapid and large increase of light scattering accompanied by the formation of large protein aggregates which precipitated in the end of incubation. The T164A mutant was also very sensitive to heating

T C E R R O

U

N

C

Wavelength, nm

Fig. 2. A. Intrinsic Trp fluorescence spectra of the wild type HspB1 and its T164A, T180I, P182S and R188W mutants. B. Normalized temperature dependence of intrinsic Trp fluorescence of the wild type HspB1 (WT) and its T164A, T180I mutants. Data are representative of four independent experiments.

322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342

3.3. Temperature-dependent changes of light scattering of HspB1 and its 343 mutants 344

E

308 309

F

302

O

300 301

we might expect that the fluorescence of R188W mutant should be 17% larger than that of the wild type protein. Indeed, the fluorescence of R188W mutant was ~15% larger than that of the wild type proteins and therefore we conclude that the fluorescent properties of the additional Trp residue (Trp188) are comparable with those Trp residues present in the wild type protein. Fluorescence spectroscopy was also used for analysis of thermal stability of HspB1 and its mutants. Heating in the range of 20–60 °C was accompanied by monotonous thermal quenching of Trp fluorescence of all HspB1 samples (Fig. 2B). Further heating resulted in thermal transition which was recorded at different temperatures for different HspB1 samples. Heating of P182S mutant was accompanied by thermal transition of Trp fluorescence at the lowest temperature, however it is difficult to interpret these results since even at lower temperature this protein started to aggregate (see Fig. 3). Thermal transition of T180I mutant was detected at the temperature close to that of the wild type protein and therefore the corresponding curves for P182S and T180I mutants were omitted from Fig. 2B. The data for all HspB1 mutants summarized in Table 1 indicate that according to the temperature dependence of fluorescence the thermal stability for HspB1 species increases in the order T164A b P182S b R188W ~ WT ~ T180I.

R O

298 299

denaturation/renaturation and compared the properties of urea-treated and urea-untreated proteins. We found that in the case of the wild type HspB1 the renaturation procedure used did not affect the oligomeric state determined by size exclusion chromatography, intrinsic Trp fluorescence or the temperature dependence of intrinsic fluorescence or light scattering (Supplement 1). Therefore we assume that such procedure also did not dramatically affect the properties of P182S mutant. This suggestion correlates with the earlier published data where high concentrations of urea were used for isolation of α-crystallin isoforms, their fragments and HspB6 [38–40].

P

296 297

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

D

4

Fig. 3. Temperature dependent changes of the light scattering of the wild type HspB1 (WT) and its T164A, T180I, R188W and R188W mutants. For each protein the light scattering at 20 °C was taken to be equal to 0 and the maximal value of light scattering observed at increased temperature was taken for 100%. Representative results of three independent experiments are shown.

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx Table 1 Temperature of half-maximal transition of Trp fluorescence of the wild type HspB1 and its mutants. The data are mean of at least four independent measurements ± SD.

t1:4

HspB1 species

Temperature of half-maximal transition, °С

t1:5 t1:6 t1:7 t1:8 t1:9

WT T164A T180I P182S R188W

70.2 60.2 71.4 64.4 68.7

374 375

Size exclusion chromatography was used for analysis of oligomeric structure of different HspB1 species. We loaded different quantities of each protein sample on the column of Superdex 200 and analyzed position of the maximum on the elution profile and dependence of elution profile on the quantity of protein loaded on the column. Independent on the quantity of protein loaded on the column the wild type HspB1 was eluted at ~ 10.3 ml which corresponds to apparent molecular weight ~560 kDa relative to a standard protein calibration set (Fig. 4). The T180I and R188W mutants demonstrated similar chromatographic behavior, although at very low concentration the peak of R188W was slightly shifted to the larger elution volume and demonstrated appearance of pronounced trailing (Fig. 4). The largest changes in the oligomeric state were detected for T164A and P182S mutants. At low concentration T164A mutant was eluted in the form of two peaks with elution volumes of 11.0 and 14 ml and increase of the quantity of protein loaded on the column was accompanied by decrease of the amplitude of the peak eluted at 14 ml and increase of the amplitude and shifting of the peak with small elution volume to 10.3 ml (Fig. 4). These data mean that mutation T164A destabilizes the quaternary structure of HspB1 and induces dissociation of large oligomers which was especially pronounced at low protein concentration. Independent on the concentration P182S mutant was eluted on the size-exclusion chromatography in the form of hyper sharp peak with elution volume of 7.8 ml (i.e. close to exclusion volume of the column 7.7 ml) and trailing edge lasting up to elution volume of 11 ml (Fig. 4). These data indicate that the P182S mutant forms very large oligomers with apparent molecular weight of more than 1000 kDa and these oligomers are very stable and do not dissociate even at a very low protein concentration.

368 369 370 371

376 377

T

378 379

O

3.4. Oligomeric structure of HspB1 and its mutants

366 367

R O

373

364 365

P

372

and half-maximal increase of the light scattering was observed at ~ 67 °C, much earlier than the corresponding changes of the light scattering detected in the case of the wild type HspB1 and its R188W mutant (both about 75.5 °C) (Fig. 3). The mutant T180I was the most resistant to the temperature-induced self-aggregation and the halfmaximal increase of the light scattering was observed only at about 78 °C (Fig. 3, Table 2). Thus, the temperature of half-maximal selfassociation increases in the following order P182S b T164A b R188W ~ WT b T180I and is similar to the corresponding order determined from the temperature-dependent changes of fluorescence.

F

0.8 1.2 0.1 0.8 0.2

D

363

± ± ± ± ±

C

380 381 382

E

383 384

R

385 386 387 388

R

389 390

N C O

391 392 393 394 395 396 397 398

U

399 400 401 402 t2:1 t2:2 t2:3

Table 2 Temperature of half-maximal increase of the light scattering of the wild type HspB1 and its mutants. The data are mean of at least three experiments ± SD.

t2:4

HspB1 species

t2:5 t2:6 t2:7 t2:8 t2:9

WT T164A T180I P182S R188W

Temperature of half-maximal increase of the light scattering, °С 76.0 67.1 78.2 59.0 75.2

± ± ± ± ±

0.5 0.7 0.5 0.3 0.8

We also used dynamic light scattering (DLS) for analyzing the size of the particles formed by the wild type HspB1 and its mutants. This method provides independent information on the oligomeric state of analyzed proteins. In good agreement with the earlier published results [19] we found that the diameter of particle formed by the wild type HspB1 was 14.9 nm (Table 3). The particles formed by T180I mutant had similar size, whereas the particles formed by R188W mutant were slightly larger having diameter of 15.9 nm. The largest differences were detected for T164A and P182S mutants. According to the data of size exclusion chromatography T164A mutant tended to dissociate (Fig. 4) and in good agreement with this finding the size of particles formed by this mutant was significantly smaller than those formed by the wild type protein (Table 3). On the contrary P182S mutant tended to form large oligomers (or aggregates) (Fig. 4) and the size of particles formed by this mutant (29.7 nm) was roughly two times larger than that of the wild type HspB1 (14.9 nm) (Table 3). Although analyzed mutants differ in their size, we never detected complete dissociation of their large oligomers to dimers or monomers. In this respect it is worth mentioning that Almeida-Souza et al. [16] found that certain HspB1 mutants tending to monomerization are ‘hyperactive’ as demonstrated by increased protection against thermal shock and increased chaperone-like activity measured in vivo. However, unequivocal interpretation of these results is somewhat problematic. Firstly, all experiments were performed on HspB1 carrying different tags on its C-terminal end, whereas any kind of modification (or even point mutations) can strongly affect HspB1 properties [43,44]. Secondly, the data of size-exclusion chromatography (Fig. 2A in [16]) indicate that the ratio large oligomer/small oligomers (i.e. dimers + suspected monomers) for hyperactive R127W and S135F mutants remains either unchanged or was even increased. This means that the above-mentioned mutations are not accompanied by dissociation of large HspB1 oligomers. Taking into account the high intracellular concentration of small heat shock proteins and crowding conditions in the cell, we conclude that the large oligomers are the predominant state of HspB1 in the cell. However upon phosphorylation [19,45] or S-thiolation [46] large oligomers tend to dissociate predominantly forming dimers or tetramers. In addition, certain mutations in the β7 strand (and probably phosphorylation of certain HspB1 sites) can affect intermonomer interaction inside of large oligomers [16] and by this means modulate the properties of HspB1. The size of oligomers formed by T164A, T180I and R188W mutants was comparable with that of the wild type protein (see Fig. 4 Table 3) and this makes difficult analysis of the structure of mixed complexes formed by these mutants and the wild type HspB1 by means of size exclusion chromatography. At the same time oligomers formed by P182S mutant were much larger than those formed by the wild type HspB1 and this makes possible utilization of size-exclusion chromatography for analysis of interaction of P182S mutant and the wild type HspB1. Mutation P182S is dominant and this means that in the case of Charcot–Marie–Tooth disease associated with this mutation both the wild type HspB1 and its mutant counterpart are simultaneously expressed in the affected cells. Therefore the question arises whether the wild type HspB1 can modify the oligomeric structure and thermal stability of P182S mutant and vice versa. The wild type HspB1 was mixed with P182S mutant and after incubation for 1 h at 42 °C this mixture was loaded on the size-exclusion chromatography column (Fig. 5A). Addition of the wild type protein was accompanied by decrease of the peak eluted at the exclusion volume and appearance of a broad peak with maximum at about 10 ml, i.e. at elution volume close to that of the wild type protein (10.3 ml). These data indicate that the P182S mutant can form mixed oligomers with the wild type protein and under conditions used the size of the mixed complexes formed is intermediate between those formed by the wild type protein and its mutated counterpart. As already mentioned, the P182S mutant is very temperature sensitive and its thermal transitions were detected at a rather low temperature (Fig. 3). Addition of the wild type HspB1 was

E

t1:1 t1:2 t1:3

5

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468

6

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

D

E

D

P

R O

B

O

F

A

E

C

O

R

R

E

C

T

C

Fig. 4. Size-exclusion chromatography of the wild type HspB1 (A) and its T164A (B), T180I (C), P182S (D) and R188W (E) mutants. Normalized elution profiles obtained after loading of 12 (1), 32 (2), 64 (3) and 120 (4) μg of protein on the column are presented.

469 470

aggregation of P182S mutant and the overall shape of dependence of light scattering on temperature was similar to that of the wild type protein (Fig. 5B). The data presented mean that the wild type HspB1 can form mixed complexes with P182S mutant and mixed oligomers possess higher thermal stability than the isolated P182S mutant.

474 475

473

accompanied by increase of thermal stability of P182S mutant. Indeed, the temperature of half maximal changes of light scattering shifted from ~60 °C characteristic for isolated P182S mutant to ~ 70 °C for the mixed oligomer of P182S mutant and the wild type HspB1 (Fig. 5B). Moreover, addition of the wild type HspB1 prevented heat-induced

t3:1 t3:2 t3:3

Table 3 Particle diameter (D) and polydispersity (P di) of the wild type HspB1 and its mutants determined by dynamic light scattering.

3.5. Chaperone-like activity of the wild type HspB1 and its mutants

479

Chaperone-like activity is one of the most important physiological activities of small heat shock proteins therefore it seemed desirable to compare this activity of the wild type protein and its mutants. We have used three different model protein substrates for the estimation of chaperone-like activity. In the first case aggregation of egg white lysozyme was induced by reduction of its disulfide bonds. Addition of excess of DTT was accompanied by rapid reduction of disulfide bonds inducing aggregation of

480

U

471 472

N

Q1

t3:4

Protein

D nm ± SD (number distribution)

P di ± SD

t3:5 Q4 t3:6 t3:7 t3:8 t3:9

WT T164A T180I P182S R188W

14.90 13.22 14.70 29.74 15.97

0.319 0.230 0.301 0.322 0.228

± ± ± ± ±

0.38 0.21 0.72 1.60 0.77

± ± ± ± ±

0.050 0.049 0.057 0.059 0.059

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

476 477 478

481 482 483 484 485 486 487

7

E

C

T

E

D

P

R O

O

F

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508

isolated lysozyme which was followed by increase of the optical density at 340 nm (Fig. 6A, curve Lys). Addition of the wild type HspB1 retarded aggregation of lysozyme and at the end of incubation (60 min) the optical density of the sample containing the wild type protein was about 2 times smaller than that of the sample containing isolated lysozyme (Fig. 6A, curve WT). The chaperone-like activity of T164A and T180I was only slightly lower than that of the wild type protein (Fig. 6A). At the same time R188W and P182S mutants were much less effective in retardation and inhibition of reduced lysozyme aggregation (Fig. 6A curves R188W and P182S respectively). The subfragment S1 of skeletal muscle myosin is temperature sensitive and heating of the sample of S1 is accompanied by its denaturation and aggregation accompanied by increase of the optical density (Fig. 6B, curve S1). Long incubation of isolated S1 at elevated temperature was accompanied by association of large aggregates of denatured S1 and their precipitation which was manifested by decrease of the optical density at 340 nm (Fig. 6B, curve S1 at long time of incubation). The wild type HspB1 effectively retarded the onset of heat-induced aggregation of S1 (Fig. 6B, curve WT) and the T164A mutant was equally effective in inhibition of S1 aggregation (Fig. 6B, curve T164A). The T180I mutant possessed similar although a little bit smaller chaperone-like activity,

U

488 489

N C O

R

R

Fig. 5. Effect of the wild type HspB1 on the oligomeric state (A) and thermal stability (B) of P182S mutant. A. Size-exclusion chromatography of isolated wild type HspB1 (WT), isolated P182S mutant (P182S) and their mixture (MIX). The column was loaded with 29 μg of P182S mutant, 64 μg of the wild type protein or their mixture. All samples were preincubated for 1 h at 42 °C. B. Normalized temperature dependence of light scattering of isolated wild type HspB1 (WT), isolated P182S (P182S) or their mixture. Concentration of each protein in isolated state was equal to 0.3 mg/ml and was equal to 0.15 mg/ml in their mixture.

Fig. 6. Chaperone-like activity of the wild type HspB1 and its mutants with lysozyme (Lys, panel A), subfragment-1 (S1) of skeletal muscle myosin (B) and porcine mitochondria malate dehydrogenase (MDH) (C) as model protein substrates. Aggregation of denatured model protein substrates was followed by recording optical density at 340 nm. The data presented are the mean values of nor less than three measurements with error bars corresponding to standard deviation. The curves marked Lys, S1 and MDH correspond to aggregation of isolated model substrates, whereas the curves marked WT or by the name of mutants correspond to aggregation of the model substrate in the presence of the wild type protein or its mutants. The curves marked control represent the changes of optical density of the probes containing isolated small heat shock proteins. Concentration of lysozyme was equal to 0.2 mg/ml and concentration of the wild type HspB1 and its mutants was equal to 0.1 mg/ml. Concentration of S1 was equal to 0.4 mg/ml and that of small heat shock proteins was equal to 0.1 mg/ml. Concentration of MDH was equal to 0.2 mg/ml and that of HspB1 and its mutants 0.02 mg/ml.

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

534 535 536 537 538 539 540 541 542 543

548

C

532 533

E

530 531

R

528 529

R

526 527

O

524 525

C

522 523

N

520 521

U

518 519

F

In this investigation we analyzed some properties of HspB1 mutants carrying replacements either in the last ninth β-strand of α-crystallin domain (mutation T164A) or in the C-terminal domain of this protein

516 517

O

546 547

515

R O

4. Discussion

513 514

P

545

511 512

(mutations T180I, P182S and R188W). Expression of all these mutants correlates with the development of distal hereditary motor neuropathy or Charcot–Marie–Tooth disease of the second type and all these mutations are dominant [14,15,20–23]. While the structure of the full-length HspB1 has thus far resisted atomic resolution studies, its α-crystallin domain has been resolved by X-ray crystallography [34,47]. Mutation T164A is located in the middle of the last β-strand of α-crystallin domain. The side chain of T164 points to the outside and does not contribute to the α-crystallin dimer interface (Fig. 8A). At this moment, there are no data on whether the mutated Thr side chain is involved in any interactions with the N-terminal or the C-terminal domains, but such interaction cannot be excluded in principle, especially within large HspB1 oligomers. It should be noted that a Thr in this position is very conservative and is present in HspB1 of different species from fishes to mammals (Table 4). Moreover, other human small heat shock proteins tending to form large oligomers (HspB4, HspB5) also contain Thr in this position (Table 4). At the same time this position is occupied by Ser or Ile in two human small heat shock proteins (HspB6 and HspB8) tending to form only small oligomers. Predictions of the secondary structure performed by PsiPred or JPred programs indicate that replacement of Thr164 by Ala can lead to small increase of the length of the ninth β-strand. This increase of the length of the last β-strand probably can affect orientation and mobility of the C-terminal extension and by this way modulate interdimer interactions inside of large oligomers. These considerations hint towards a possible involvement of residue T164 in interdimer interaction within large oligomers. In line with this possibility, we observed that at low concentration oligomers of T164A mutant tend to dissociate forming smaller size particles (Fig. 4, Table 3). Unstable quaternary structure can lead to decreased thermal stability. Indeed, the T164A mutant has the lowest thermal stability determined by both intrinsic Trp fluorescence and light scattering (Figs. 2, 3, Tables 1, 2). Mutation T164A does not affect the surface hydrophobicity of HspB1 (Fig. 7) and the chaperone-like activity is comparable with that of the wild type protein (Fig. 6). The remaining studied mutations locate in the C-terminal domain of HspB1. Parts of this domain were resolved in several recently determined crystal structures. In particular, this year Hochberg et al. [34] reported the crystal structure of human HspB1 fragment corresponding to the α-crystallin domain (residues 86–169) complexed with a peptide corresponding to HspB1 residues 179–185. The latter peptide which includes the conserved IPI/V motif is bound in a hydrophobic groove located at the side of the α-crystallin domain between strands β4 and β8. A similar situation was observed in the crystal structures of Nterminally truncated fragments from HspB4 of Bos taurus and Danio rerio [35,48]. In both cases, the C-terminal domain was retained and seen binding in the β4/β8 groove, but for the B. taurus structure this happened across different dimers, while in the D. rerio structure this ‘patching’ occurred within the same monomer (Fig. 8A). Interestingly, in various crystal structures the C-terminal sequence was bound in opposite directions with respect to the β4/β8 groove, and it is generally believed that the binding in either direction is equally possible in solution. One should therefore consider both the binding of the C-terminal peptide of HspB1 as observed in the most recent Hochberg et al. structure [34] of HspB1, and the binding in the opposite direction as in the D. rerio HspB4 structure [35] (Fig. 8A). This (promiscuous) binding is believed to contribute to the formation of the (heterogenous) large oligomers of HspB1, B4 and B5 [48] although NMR studies revealed only a weak interaction between the C-terminus and the β4/β8 groove [24]. The accumulated structural data allow some interpretation of the effect of mutations in the C-terminal domain of HspB1, even in the absence of the full atomic structures of the corresponding large oligomers. The mutations T180I, P182S and R188W all situate within the conserved C-terminal region, seen in all HspB1, B4 and B5 proteins, that encompasses the IPI/V motif (Fig. 8B). Тhe mutation T180I leads to the formation of a cluster of three consecutive Ile residues (positions 179 to 181). This

T

544

whereas mutation R188W induced pronounced decrease of chaperonelike activity with S1 as a model substrate (Fig. 6B curves T180I and R188W, respectively). The P182S mutant was unable to inhibit heatinduced aggregation of S1 (Fig. 6B, curve P182S). On the contrary, this mutant promoted aggregation of S1 and at the end of incubation the optical density of the sample containing isolated S1 was smaller than that of S1 in the presence of P182S mutant thus probably indicating aggregation and co-precipitation of S1 and P182S mutant of HspB1. Malate dehydrogenase (MDH) is also unstable at elevated temperature and heating up to 45 °C leads to thermal denaturation and aggregation accompanied by increase of the optical density at 340 nm (Fig. 6C, curve MDH). The wild type HspB1 and its T164A and T180I mutants were roughly equal in retardation and inhibition of heat-induced aggregation of MDH (Fig. 6C, curves WT, T164A and T180I respectively). Chaperone-like activity of R188W and especially P182S mutants was significantly less than the corresponding activity of the wild type protein (Fig. 6C, curves R188W and P182S, respectively). Summing up we might conclude that independent on the nature of the model protein substrate or the mode of their denaturation the chaperone-like activity of analyzed proteins decreases in the order WT ≥ T164A ≥ T180I ≫ R188W ≫ P182S. It is assumed that the interaction of small heat shock proteins with their protein substrates is at least partially dependent on hydrophobic interactions. We supposed that the difference detected in the chaperone-like activity of HspB1 and its mutants can be due to the difference in their hydrophobicity. In order to check this suggestion we analyzed hydrophobic properties of HspB1 by using hydrophobic probe bis-ANS. The binding of this probe to the wild type HspB1 is accompanied by significant increase of fluorescence (Fig. 7). Non-linear fitting of titration curve did not reveal any significant differences in affinity or in the number of bis-ANS binding sites for different mutants. Only small insignificant changes of the maximal amplitude of fluorescence were detected for T180I and P182S mutants (Fig. 7). Therefore the changes of chaperone-like activity detected for P182S and R188W mutants cannot be explained simply by the changes in hydrophobic properties of these HspB1 mutants.

D

509 510

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

E

8

Fig. 7. Hydrophobic properties of the wild type HspB1 and its mutants as revealed by titration with hydrophobic fluorescent probe bis-ANS. HspB1 and its mutants (0.1 mg/ml) were titrated by bis-ANS and fluorescence excited at 395 nm was recorded at 485 nm. Titration curve of the buffer in the absence of any proteins is marked as control. Data are representative of three independent experiments.

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 Q16 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614

9

E

D

P

R O

O

F

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

615 616

R

Q3

R

E

Q2

C

T

Fig. 8. A. Location of the mutated residues on the HspB1 dimer structure. With regard to the position of the C-terminal residues, two possibilities should be considered. The first is provided by the crystal structure of human HspB1 fragment (residues 86–169) complexed with a peptide corresponding to residues 179–185 of the same protein [34] (PDB entry 4MJH, www.pdb. org). The ACD dimer is shown as ribbon diagram and as a semitransparent surface. Residue T164 (red) is located in the middle of the last β-strand 9 of the ACD. Residues T180 and P182 (red) locate on the peptide (shown in cyan) which attaches to the β4–β8 groove of one monomer (green). Here the peptide's N- N C direction is roughly antiparallel to strand β8. An alternative possibility for the location of the residues T180, P182 and R188 is provided by the crystal structure of zebrafish HspB4 fragment (residues 60–166) [35] (PDB entry 3N3E). This structure reveals the ACD dimer with the β4–β8 groove of each monomer being patched by the C-terminus of the same monomer. The zebrafish HspB4 ACD dimer (not shown for clarity) superimposes well on the human HspB1 ACD dimer, resulting in the location of the C-terminal domain of the zebrafish protein as shown in yellow. This time the C-terminal residues are in parallel orientation relative to strand 8. The projected location of human HspB1 residues T180, P182 and R188 in this geometry is shown in orange, with stars added to residue labels. B. Amino acid sequence alignment of human HspB1 and zebrafish HspB4. Only the relevant portion comprising the last β-strand 9 (indicated in between of the sequences) and the C-terminal domain is shown. The conserved C-terminal region encompassing the IPV motif (cyan highlight) is indicated with tilde signs. The positions of HspB1 mutations are in red. Crystallographically resolved parts are underlined.

t4:1 t4:2

Table 4 Sequence alignment of the region containing mutation T164A of human HspB1.

t4:3

Species

t4:4

Homo sapiens

t4:5 t4:6

U

617 618

N C O

619 620

hydrophobic cluster does not affect solubility or surface hydrophobicity of T180I mutant (Fig. 7), however it apparently can improve the stability of its structure, as seen from both fluorescence spectroscopy and light scattering (Figs. 2, 3, Tables 1, 2). Mutation T180I also does not affect or only slightly decreases the chaperone-like activity of HspB1 measured on three different model protein substrates (Fig. 6). At the same time,

the residue corresponding to I180 in human HspB1 is a Val or Ile in the HspB1 of some fishes (Salmo salar, Osmerus mordax) [15], suggesting that the conservation of this residue is not essential for HspB1 functioning. Interestingly, the mutation T180I occurring just before the ‘canonical’ IPI/V motif has therefore only a mild effect, compared to the drastic effect of the P182S mutation within this motif, as discussed below.

Small heat shock proteins

UniProt number

HspB1

P04792

Homo sapiens

HspB4

P02489

Homo sapiens

HspB5

P02511

t4:7

Homo sapiens

HspB6

O14558

t4:8

Homo sapiens

HspB8

Q9UJY1

t4:9

Macaca mulatta

HspB1

F6XTF7

t4:10

Rattus norvegicus

HspB1

P42930

t4:11

Bos taurus

HspB1

Q3T149

t4:12

Gallus gallus

HspB1

Q00649

t4:13

Xenopus laevis

HspB1

Q66KY8

t4:14

Danio rerio

HspB1

Q5PR64

Primary structure

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

621 622 623 624 625 626

650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692

725

The authors are grateful to Dr. O.P. Nikolaeva and Prof. D.I. Levitsky (A.N. Bach Institute of Biochemistry, Russian Academy of Sciences) for providing subfragment-1 of rabbit skeletal myosin. This investigation was supported by the Russian Foundation for Basic Research (grant #13-04-00015 to N.B.G.), the Research Foundation Flanders (grant G.0697.08 to S.V.S.) and the KU Leuven (grant OT13/097 to S.V.S.).

726 727

References

732

[1] H. Maaroufi, R.M. Tanguay, Analysis and phylogeny of small heat shock proteins from marine viruses and their cyanobacteria host, PLoS ONE 8 (2013) e81207. [2] E. Basha, H. O'Neill, E. Vierling, Small heat shock proteins and alpha-crystallins: dynamic proteins with flexible functions, Trends Biochem. Sci. 37 (2012) 106–117. [3] E.V. Mymrikov, A.S. Seit-Nebi, N.B. Gusev, Large potentials of small heat shock proteins, Physiol. Rev. 91 (2011) 1123–1159. [4] G. Kappe, E. Franck, P. Verschuure, W.C. Boelens, J.A. Leunissen, W.W. de Jong, The human genome encodes 10 alpha-crystallin-related small heat shock proteins: HspB1–10, Cell Stress Chaperones 8 (2003) 53–61. [5] J.M. Fontaine, J.S. Rest, M.J. Welsh, R. Benndorf, The sperm outer dense fiber protein is the 10th member of the superfamily of mammalian small stress proteins, Cell Stress Chaperones 8 (2003) 62–69. [6] R.P. Taylor, I.J. Benjamin, Small heat shock proteins: a new classification scheme in mammals, J. Mol. Cell. Cardiol. 38 (2005) 433–444. [7] A.P. Arrigo, Human small heat shock proteins: protein interactomes of homo- and hetero-oligomeric complexes: an update, FEBS Lett. 587 (2013) 1959–1969. [8] G.K. Hochberg, J.L. Benesch, Dynamical structure of alphaB-crystallin, Prog. Biophys. Mol. Biol. (2014). [9] V. Kakkar, M. Meister-Broekema, M. Minoia, S. Carra, H.H. Kampinga, Barcoding heat shock proteins to human diseases: looking beyond the heat shock response, Dis. Models Mech. 7 (2014) 421–434. [10] A. Boncoraglio, M. Minoia, S. Carra, The family of mammalian small heat shock proteins (HSPBs): implications in protein deposit diseases and motor neuropathies, Int. J. Biochem. Cell Biol. 44 (2012) 1657–1669. [11] S. Carra, V. Crippa, P. Rusmini, A. Boncoraglio, M. Minoia, E. Giorgetti, H.H. Kampinga, A. Poletti, Alteration of protein folding and degradation in motor neuron diseases: implications and protective functions of small heat shock proteins, Prog. Neurobiol. 97 (2012) 83–100.

733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 Q18 751 752 753 754 755 756 757 758 759 760

O

F

Acknowledgements

R O

648 649

P

646 647

693 694

D

644 645

P182S (Fig. 6). The data of literature indicate that the chaperone-like activity of small heat shock proteins is dependent on the properties of the C-terminal extension and deletion or replacement of polar residues in this part of molecule strongly affects the chaperone-like activity [51–54]. We suppose that replacement of polar and charged Arg188 by bulky hydrophobic Trp affects flexibility and polarity of the C-terminal extension thus decreasing the chaperone-like activity of R188W mutant. Decreased chaperone-like activity, described earlier for K140G mutant [18] and detected in this investigation for P182S and R188W mutants of HspB1, can lead to accumulation of improperly folded proteinsubstrates, their aggregation and cell damage. Thus, molecular mechanisms underlying pathological effect of HspB1 mutants containing amino acid replacement in the C-terminal part of molecule can be completely different. For instance, T164A mutation affects oligomeric structure and thermal stability of HspB1; mutation P182S affecting conservative IPI/V tripeptide induces unordered aggregation of HspB1 oligomers and dramatically decreases their chaperone-like activity, whereas mutation R188W affects polarity of the C-terminal extension and decreases chaperone-like activity of HspB1. Literature data indicate that HspB1 participates in regulation and stabilization of microtubules [17,55], intermediate filaments (neurofilaments) [56,57] and/or actin microfilaments [12]. Decreased thermal stability, increased tendency to aggregation or decreased chaperone-like activity of mutated HspB1 can modify its interaction with different elements of cytoskeleton thus leading to motor neuron damage. Thus our investigation provides first hints as to the possible mechanism of the mutations in the C-terminal part of HspB1 towards the development of distal motor neuropathy and Charcot–Marie– Tooth disease type 2, but further research into the topic is needed. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.bbapap.2014.09.005.

T

642 643

C

640 641

E

638 639

R

636 637

R

634 635

O

633

C

631 632

N

629 630

The Pro residue in position 182 of human HspB1 is central to the IPI/ V motif and is conserved in practically all analyzed HspB1 [15]. The tripeptide IPI/V is highly mobile and can remain either free and unbound or interact with hydrophobic groove formed by β4 and β8 strands of the same monomer or the monomer belonging to the neighboring dimer of large sHSP oligomers [8,49] and therefore plays crucial role in their formation. Clearly, the presence of the conformationally restrained Pro residue in the middle of the IPI/V motif imposes limitations on its geometry. In contrast, the mutation P182S (and probably, P182L) should increase the flexibility of this region. Apparently, this local structural change has a pronounced effect on the interactions made by the IPI/V motif, shifting the above-mentioned equilibrium towards an increased interdimer interaction, which leads to the formation of very large oligomers or aggregates. Indeed, the literature data indicate that the P182L mutant tends to form large aggregates [16,50]. All our attempts to express P182S mutant in soluble state were unsuccessful and independent on conditions or bacterial strain this protein was accumulated in inclusion bodies. We were able to solubilize P182S mutant by short urea treatment followed by renaturation. This procedure provided for purification of this mutant and obtaining it in the soluble state. The earlier published data [38–40] and our experimental results (Supplement 1) indicate that short urea treatment does not dramatically affect the structure and properties of small heat shock proteins. Therefore we suppose that P182S mutant obtained by urea denaturation/renaturation procedure can be used for the investigation of some properties of this mutant. Under normal conditions preparations of P182S were rather stable and did not demonstrate tendency to aggregation. However, even under these conditions the size of oligomers of P182S mutant was significantly larger than that of the native HspB1 (Fig. 4, Table 3). The oligomers of P182S seem to be in metastable state and therefore heating up to ~60 °C was accompanied by changes of Trp fluorescence. Temperature dependence of Trp fluorescence of P182S mutant can be affected by simultaneous rapid and irreversible protein aggregation (Figs. 2, 3, Table 1, 2). The wild type HspB1 can interact with P182S mutant forming mixed oligomers (Fig. 5). The size of mixed oligomers is intermediate between those formed by the wild type protein and its P182S mutant (Fig. 5A). Moreover, mixed oligomers possessed higher thermal stability than the isolated P182S mutant (Fig. 5B). The data of literature [15,22] indicate that mutation P182S is dominant. We suppose that the dominant effect of P182S mutation is at least partially explained by the ability of P182S mutant to interact and to sequestrate the wild type protein thus inhibiting or even preventing its normal functioning. P182S mutant possesses the lowest chaperone-like activity (Fig. 6). It seems probable that due to its metastable structure this mutant tends to co-aggregate with some analyzed model protein substrates. The position homologous to R188 of human HspB1 is well-preserved in practically all mammals and is much less preserved in birds, amphibian and fishes being replaced by different residues [15]. The residue is located at the very end of the C-terminal sequence conserved for HspB1, B4 and B5 (Fig. 8B). The crystal structure of non-3D domain swapped zebrafish HspB4 fragment [35] gives a hint as to where this residue (being a Lys in the latter structure) could locate with respect to the a-crystallin domain (Fig. 8A). The remainder of the C-terminal domain past residue 188 is expected to be highly mobile. Comparing with the wild type the R188W mutant contains additional Trp residue and the spectral properties of this additional residue are similar to other intrinsic Trp residues of the wild type HspB1 (Fig. 2). Additional Trp residue does not significantly affect the surface hydrophobicity of R188W mutant (Fig. 7). R188W mutant forms stable oligomers and the size of these oligomers is comparable with that of the wild type protein (Fig. 4, Table 3). The data of fluorescence spectroscopy and light scattering indicate that the thermal stability of R188W mutant is also comparable with that of the wild type protein (Figs. 2, 3). However, the chaperone-like activity of this mutant was significantly less than the chaperone-like activity of any other analyzed mutants except for

U

627 628

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

E

10

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724

728 729 730 Q17 731

A.S. Chalova et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

897

N C O

R

R

E

C

D

P

R O

O

F

[36] C. Cole, J.D. Barber, G.J. Barton, The Jpred 3 secondary structure prediction server, Nucleic Acids Res. 36 (2008) W197–W201. [37] L.J. McGuffin, K. Bryson, D.T. Jones, The PSIPRED protein structure prediction server, Bioinformatics 16 (2000) 404–405. [38] W.W. de Jong, A. Zweers, M. Versteeg, E.C. Nuy-Terwindt, Primary structures of the alpha-crystallin A chains of twenty-eight mammalian species, chicken and frog, Eur. J. Biochem. 141 (1984) 131–140. [39] K.B. Merck, W.A. De Haard-Hoekman, B.B. Oude Essink, H. Bloemendal, W.W. De Jong, Expression and aggregation of recombinant alpha A-crystallin and its two domains, Biochim. Biophys. Acta 1130 (1992) 267–276. [40] F.A. van de Klundert, R.H. Smulders, M.L. Gijsen, R.A. Lindner, R. Jaenicke, J.A. Carver, W.W. de Jong, The mammalian small heat-shock protein Hsp20 forms dimers and is a poor chaperone, Eur. J. Biochem. 258 (1998) 1014–1021. [41] M. Ehrnsperger, H. Lilie, M. Gaestel, J. Buchner, The dynamics of Hsp25 quaternary structure. Structure and function of different oligomeric species, J. Biol. Chem. 274 (1999) 14867–14874. [42] A.S. Chalova, M.V. Sudnitsyna, P.I. Semenyuk, V.N. Orlov, N.B. Gusev, Effect of disulfide crosslinking on thermal transitions and chaperone-like activity of human small heat shock protein HspB1, Cell Stress Chaperones (2014). [43] H. Sakamoto, T. Mashima, K. Yamamoto, T. Tsuruo, Modulation of heat-shock protein 27 (Hsp27) anti-apoptotic activity by methylglyoxal modification, J. Biol. Chem. 277 (2002) 45770–45775. [44] P.N. Datskevich, N.B. Gusev, Structure and properties of chimeric small heat shock proteins containing yellow fluorescent protein attached to their C-terminal ends, Cell Stress Chaperones 19 (2014) 507–518. [45] T. Rogalla, M. Ehrnsperger, X. Preville, A. Kotlyarov, G. Lutsch, C. Ducasse, C. Paul, M. Wieske, A.P. Arrigo, J. Buchner, M. Gaestel, Regulation of Hsp27 oligomerization, chaperone function, and protective activity against oxidative stress/tumor necrosis factor alpha by phosphorylation, J. Biol. Chem. 274 (1999) 18947–18956. [46] P. Eaton, W. Fuller, M.J. Shattock, S-thiolation of HSP27 regulates its multimeric aggregate size independently of phosphorylation, J. Biol. Chem. 277 (2002) 21189–21196. [47] E.V. Baranova, S.D. Weeks, S. Beelen, O.V. Bukach, N.B. Gusev, S.V. Strelkov, Threedimensional structure of alpha-crystallin domain dimers of human small heat shock proteins HSPB1 and HSPB6, J. Mol. Biol. 411 (2011) 110–122. [48] A. Laganowsky, J.L. Benesch, M. Landau, L. Ding, M.R. Sawaya, D. Cascio, Q. Huang, C.V. Robinson, J. Horwitz, D. Eisenberg, Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function, Protein Sci. 19 (2010) 1031–1043. [49] S.P. Delbecq, R.E. Klevit, One size does not fit all: the oligomeric states of alphaB crystallin, FEBS Lett. 587 (2013) 1073–1080. [50] S. Ackerley, P.A. James, A. Kalli, S. French, K.E. Davies, K. Talbot, A mutation in the small heat-shock protein HSPB1 leading to distal hereditary motor neuronopathy disrupts neurofilament assembly and the axonal transport of specific cellular cargoes, Hum. Mol. Genet. 15 (2006) 347–354. [51] R.A. Lindner, J.A. Carver, M. Ehrnsperger, J. Buchner, G. Esposito, J. Behlke, G. Lutsch, A. Kotlyarov, M. Gaestel, Mouse Hsp25, a small shock protein. The role of its C-terminal extension in oligomerization and chaperone action, Eur. J. Biochem. 267 (2000) 1923–1932. [52] A.M. Morris, T.M. Treweek, J.A. Aquilina, J.A. Carver, M.J. Walker, Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity, FEBS J. 275 (2008) 5885–5898. [53] T.M. Treweek, A. Rekas, M.J. Walker, J.A. Carver, A quantitative NMR spectroscopic examination of the flexibility of the C-terminal extensions of the molecular chaperones, alphaA- and alphaB-crystallin, Exp. Eye Res. (2010). [54] M.V. Sudnitsyna, E.V. Mymrikov, A.S. Seit-Nebi, N.B. Gusev, The role of intrinsically disordered regions in the structure and functioning of small heat shock proteins, Curr. Protein Pept. Sci. 13 (2012) 76–85. [55] L. Almeida-Souza, V. Timmerman, S. Janssens, Microtubule dynamics in the peripheral nervous system: a matter of balance, Bioarchitecture 1 (2011) 267–270. [56] A. Holmgren, D. Bouhy, V. De Winter, B. Asselbergh, J.P. Timmermans, J. Irobi, V. Timmerman, Charcot–Marie–Tooth causing HSPB1 mutations increase Cdk5mediated phosphorylation of neurofilaments, Acta Neuropathol. 126 (2013) 93–108. [57] J. Zhai, H. Lin, J.P. Julien, W.W. Schlaepfer, Disruption of neurofilament network with aggregation of light neurofilament protein: a common pathway leading to motor neuron degeneration due to Charcot–Marie–Tooth disease-linked mutations in NFL and HSPB1, Hum. Mol. Genet. 16 (2007) 3103–3116.

E

T

[12] G. Wettstein, P.S. Bellaye, O. Micheau, P. Bonniaud, Small heat shock proteins and the cytoskeleton: an essential interplay for cell integrity? Int. J. Biochem. Cell Biol. 44 (2012) 1680–1686. [13] J. Acunzo, M. Katsogiannou, P. Rocchi, Small heat shock proteins HSP27 (HspB1), alphaB-crystallin (HspB5) and HSP22 (HspB8) as regulators of cell death, Int. J. Biochem. Cell Biol. 44 (2012) 1622–1631. [14] P.N. Datskevich, V.V. Nefedova, M.V. Sudnitsyna, N.B. Gusev, Mutations of small heat shock proteins and human congenital diseases, Biochemistry 77 (2012) 1500–1514. [15] R. Benndorf, J.L. Martin, S.L. Kosakovsky Pond, J.O. Wertheim, Neuropathy- and myopathy-associated mutations in human small heat shock proteins: characteristics and evolutionary history of the mutation sites, Mutat. Res. (2014). [16] L. Almeida-Souza, S. Goethals, V. de Winter, I. Dierick, R. Gallardo, J. Van Durme, J. Irobi, J. Gettemans, F. Rousseau, J. Schymkowitz, V. Timmerman, S. Janssens, Increased monomerization of mutant HSPB1 leads to protein hyperactivity in Charcot–Marie–Tooth neuropathy, J. Biol. Chem. 285 (2010) 12778–12786. [17] L. Almeida-Souza, B. Asselbergh, C. d'Ydewalle, K. Moonens, S. Goethals, V. de Winter, A. Azmi, J. Irobi, J.P. Timmermans, K. Gevaert, H. Remaut, L. Van Den Bosch, V. Timmerman, S. Janssens, Small heat-shock protein HSPB1 mutants stabilize microtubules in Charcot–Marie–Tooth neuropathy, J. Neurosci. 31 (2011) 15320–15328. [18] V.V. Nefedova, P.N. Datskevich, M.V. Sudnitsyna, S.V. Strelkov, N.B. Gusev, Physicochemical properties of R140G and K141Q mutants of human small heat shock protein HspB1 associated with hereditary peripheral neuropathies, Biochimie 95 (2013) 1582–1592. [19] V.V. Nefedova, M.V. Sudnitsyna, S.V. Strelkov, N.B. Gusev, Structure and properties of G84R and L99M mutants of human small heat shock protein HspB1 correlating with motor neuropathy, Arch. Biochem. Biophys. 538 (2013) 16–24. [20] K.P. Lin, B.W. Soong, C.C. Yang, L.W. Huang, M.H. Chang, I.H. Lee, A. Antonellis, Y.C. Lee, The mutational spectrum in a cohort of Charcot–Marie–Tooth disease type 2 among the Han Chinese in Taiwan, PLoS ONE 6 (2011) e29393. [21] M. Luigetti, G.M. Fabrizi, F. Madia, M. Ferrarini, A. Conte, A. Del Grande, G. Tasca, P.A. Tonali, M. Sabatelli, A novel HSPB1 mutation in an Italian patient with CMT2/dHMN phenotype, J. Neurol. Sci. 298 (2010) 114–117. [22] K. Kijima, C. Numakura, T. Goto, T. Takahashi, T. Otagiri, K. Umetsu, K. Hayasaka, Small heat shock protein 27 mutation in a Japanese patient with distal hereditary motor neuropathy, J. Hum. Genet. 50 (2005) 473–476. [23] S. Capponi, A. Geroldi, P. Fossa, M. Grandis, P. Ciotti, R. Gulli, A. Schenone, P. Mandich, E. Bellone, HSPB1 and HSPB8 in inherited neuropathies: study of an Italian cohort of dHMN and CMT2 patients, J. Peripher. Nerv. Syst. 16 (2011) 287–294. [24] S.P. Delbecq, S. Jehle, R. Klevit, Binding determinants of the small heat shock protein, alphaB-crystallin: recognition of the ‘I × I’ motif, EMBO J. 31 (2012) 4587–4594. [25] O.V. Bukach, A.S. Seit-Nebi, S.B. Marston, N.B. Gusev, Some properties of human small heat shock protein Hsp20 (HspB6), Eur. J. Biochem. 271 (2004) 291–302. [26] Z. Xu, A. Colosimo, D.C. Gruenert, Site-directed mutagenesis using the megaprimer method, Methods Mol. Biol. 235 (2003) 203–207. [27] F.W. Studier, Protein production by auto-induction in high density shaking cultures, Protein Expr. Purif. 41 (2005) 207–234. [28] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [29] T.L. Bushueva, E.P. Busel, E.A. Burstein, Relationship of thermal quenching of protein fluorescence to intramolecular structural mobility, Biochim. Biophys. Acta 534 (1978) 141–152. [30] E.A. Permyakov, E.A. Burstein, Some aspects of studies of thermal transitions in proteins by means of their intrinsic fluorescence, Biophys. Chem. 19 (1984) 265–271. [31] M.V. Medvedeva, T.L. Bushueva, V.P. Shirinsky, T.J. Lukas, D.M. Watterson, N.B. Gusev, Interaction of smooth muscle caldesmon with calmodulin mutants, FEBS Lett. 360 (1995) 89–92. [32] A. Zavialov, R. Benndorf, M. Ehrnsperger, V. Zav'yalov, I. Dudich, J. Buchner, M. Gaestel, The effect of the intersubunit disulfide bond on the structural and functional properties of the small heat shock protein Hsp25, Int. J. Biol. Macromol. 22 (1998) 163–173. [33] A.G. Weeds, R.S. Taylor, Separation of subfragment-1 isoenzymes from rabbit skeletal muscle myosin, Nature 257 (1975) 54–56. [34] G.K. Hochberg, H. Ecroyd, C. Liu, D. Cox, D. Cascio, M.R. Sawaya, M.P. Collier, J. Stroud, J.A. Carver, A.J. Baldwin, C.V. Robinson, D.S. Eisenberg, J.L. Benesch, A. Laganowsky, The structured core domain of alphaB-crystallin can prevent amyloid fibrillation and associated toxicity, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) E1562–E1570. [35] A. Laganowsky, D. Eisenberg, Non-3D domain swapped crystal structure of truncated zebrafish alphaA crystallin, Protein Sci. (2010).

U

761 762 763 764 765 766 767 768 769 770 771 Q19 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 Q20

11

Please cite this article as: A.S. Chalova, et al., Characterization of human small heat shock protein HspB1 that carries C-terminal domain mutations associated with hereditary motor neuron diseases, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbapap.2014.09.005

829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 Q21 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 Q22 884 885 886 887 888 889 890 891 892 893 894 895 896