- Email: [email protected]
Characterization of integrons and their cassettes in Escherichia coli and Salmonella isolates from poultry in Korea
Characterization of integrons and their cassettes in Escherichia coli and Salmonella isolates from poultry in Korea Hirut Kidie Dessie, Dong Hwa Bae,1 and Young Ju Lee1 College of Veterinary Medicine, Kyungpook National University, Daegu 702-701, Republic of Korea sistance to streptomycin/spectinomycin (aadA, aminoglycoside resistance gene), trimethoprim (dfrA, dihydrofolate reductase gene), streptothricin [sat1 and sat2 (streptothricin acetyltransferase), and estX (putative esterases)]. The most common gene cassettes were aadA1+dfrA1 and dfrA1+sat2+aadA1 in class 1 and class 2 integrons, respectively. Other cassettes including aadA5+dfrA7, dfrA12+aadA2, aadA2+aadA1+dfrA12, and aadA5+aadA2/dfrA7 were also identified. Among the Salmonella serovars, Salmonella Malmoe harbored aadA1+dfrA1 and dfrA12+sat2+aadA1 genes. The aadA1, aadA2, sat2, and dfrA1 had wide variation in similarity among themselves and from previously reported genes worldwide. The diverse gene cassettes could be responsible for the prominent resistance profiles observed and a potential source for dissemination of antimicrobial resistance determinants to other bacteria.
Key words: integron, Escherichia coli, Salmonella, poultry 2013 Poultry Science 92:3036–3043 http://dx.doi.org/10.3382/ps.2013-03312
INTRODUCTION Recently, a dramatic increase in antimicrobial resistance in different species of bacteria, particularly multidrug-resistance in Salmonella and Escherichia coli, continue to emerge throughout the world because antimicrobials are extensively used for therapeutic and prophylactic purposes in animals and humans (Hsu et al., 2006). Several mechanisms for the development of antimicrobial resistance exist and are readily spread to a variety of bacterial genera. Bacteria may acquire efflux pumps that extrude the antibacterial agent from the cell before it can reach its target site and exert its effect; efflux pump coding plasmids include tetA, tetB,
©2013 Poultry Science Association Inc. Received May 13, 2013. Accepted July 20, 2013. 1 Corresponding author: [email protected] or youngju@knu. ac.kr
tetC, tetD, and tetG genes for tetracycline resistance (Michalova et al., 2004). Additionally, bacteria may acquire several genes for a metabolic pathway which ultimately produces a metabolite that no longer contains the binding site of an antimicrobial agent. Commonly, sulfonamide resistance in gram-negative bacteria generally arises from the acquisition of 2 genes, sul1 or sul2, encoding forms of dihydropteroate synthase that are not inhibited by the drug (Enne et al., 2001). Recently, a major public health challenge has been the spread of antimicrobial resistance determinants in bacterial populations and consequently the transfer of these genes from animals to humans (Lupo et al., 2012). In addition to plasmids, other genetic elements that participate in resistance gene transfer and the consequent development of antimicrobial resistance in bacteria are transposons and integrons (Wright, 2010). Of these, integrons are capable of capturing and excising gene cassettes according to Hall and Collis (1995), are natural genetic engineering platforms that encode resistance to several antimicrobial agents, and are fre-
3036
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
ABSTRACT Ninety-nine Escherichia coli and 33 Salmonella isolates were assessed for antimicrobial susceptibility (disc diffusion test). Sulfonamide and tetracycline resistance genes were identified through PCR, and class 1 and class 2 integrons with resistance gene cassettes were identified with PCR followed by sequencing. Salmonella (63.6%) and E. coli (85.8%) isolates were multidrug resistant (resistance to 3 or more antimicrobials), and the highest incidences of resistance were observed for tetracycline, nalidixic acid, and sulfamethoxazole. The sul1, sul2, tetA, and tetB resistance determinant genes were predominant in E. coli, whereas only sul2 and tetA were identified in Salmonella isolates. In the E. coli isolates, 54 (54.5%) class 1 integrons, 6 (6.1%) class 2 integrons, and 5 (5.1%) class 1 and class 2 integrons together were detected, whereas only 3 (9.1%) integrons were found in the Salmonella serovars. Around 87% of the integrons in E. coli harbored resistance gene cassettes conferring re-
3037
INTEGRONS AND THEIR CASSETTES
MATERIALS AND METHODS Bacterial Isolates A total of 132 bacterial isolates consisting of 99 E. coli isolated from apparently healthy chicken feces and 33 Salmonella (Salmonella Enteritidis, n = 16 and other serovars, n = 17) isolated from the same chicken after slaughter in 2011 in Korea were investigated in this study. All E. coli and Salmonella isolates were isolated and identified following conventional methods described elsewhere (Kim et al., 2007). Salmonella isolates were previously serotyped according to the Kauffman White scheme by the slide agglutination test using Salmonella-specific O and H antisera (Difco, Detroit, MI).
Antimicrobial Susceptibility Test All E. coli and Salmonella isolates were subjected to a susceptibility test against 14 antimicrobials on Müller-Hinton agar (Difco) with the Kirby-Bauer disc diffusion methodology (Bauer et al., 1966). The following antimicrobial discs (Difco) were used: gentamicin (10 μg), kanamycin (30 μg), ampicillin (10 μg), cefotaxime (30 μg), nalidixic acid (30 μg), ciprofloxacin (5 μg), tetracycline (30 μg), sulfamethoxazole-trimethoprim (1.25/23.75 μg), chloramphenicol (30 μg), ceftazidime (30 μg), amoxicillin-clavulanic acid (30 μg), neomycin (30 μg), ceftriaxone (30 μg), and sulfamethoxazole (100 μg). According to the CLSI (2011) M100-S21 guidelines, inhibition zones were measured and evaluated as susceptible or resistant. An isolate was considered multidrug resistant if it was resistant to 3 or more antimicrobials. Escherichia coli strain ATCC 25922 was used as a reference strain.
Analysis of Antimicrobial Resistance Genes The DNA for all experiments was extracted by the boiling method (De Medici et al., 2003), and aliquots of DNA templates were stored at −20°C until used. Plasmid replicons were examined by PCR for the sulfamethoxazole and tetracycline resistance phenotypes of E. coli and Salmonella isolates with the primers presented in Table 1. Sulfonamide resistance genes sul1 and sul2 (Kerrn et al., 2002) and tetracycline resistance genes tetA, tetB, tetC, tetD, tetE, and tetG were tested as previously described (Zhao and Aoki, 1992; Levy et al., 1999; Miranda et al., 2003).
Characterization of Integrons and Their Cassettes All E. coli and Salmonella isolates were screened for the presence of class 1 and class 2 integrons. The presence of gene cassettes in the integron positive isolates were assessed through PCR assay with primers presented in Table 1. The PCR conditions were as follows: initial denaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 30 s, 58°C for 30 s, and 72°C for 2 min with a final extension at 72°C for 5 min. Furthermore, integron positive isolates were assessed for the entire 3′CS (qacEΔ1-sul1). The PCR products of the gene cassettes were purified using GFX PCR DNA and the Gel band purification kit (Amersham Bioscience, Freiburg, Germany) and sequenced using the Sanger method by the Macrogen company (Daejeon, Korea). Gene cassette homology searches were performed by Basic Local Alignment Search Tool (BLAST) analysis (www.ncbi.nlm.nih.gov/BLAST).
RESULTS Antimicrobial Susceptibilities The results of the antimicrobial susceptibility tests for Salmonella and E. coli are presented in Table 2. The highest incidence of resistance observed were for tetracycline (n = 87; 87.9%), nalidixic acid (n = 77; 77.8%), sulfamethoxazole (n = 73; 73.7%), ampicillin (n = 61; 61.6%), ciprofloxacin (n = 37; 37.4%), and sulfamethoxazole-trimethoprim (n = 36; 36.4%). Among the E. coli isolates, 85.8% were multidrug resistant. Similarly, Salmonella isolates (63.6%) were also multidrug resistant and commonly resistant to tetracycline (n = 23; 69.7%), sulfamethoxazole (n = 31; 93.9%), and nalidixic acid (n = 22; 66.7%) as shown in Table 2. A variety of resistance patterns was found in the E. coli isolates and in isolates that harbored integrons shown in Table 3.
Antimicrobial Resistance Genes From the 99 E. coli isolates tested, 36 isolates harboring integrons and 11 isolates without integrons (n
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
quently associated with the development of multidrug resistance in gram-negative bacteria. Class 1 integrons, the most common type, mostly found as part of the Tn21 or Tn402 transposon family, have been detected in bacteria in many regions (Fluit, 2005). They contain a 5′ conserved segment (5′CS) and a 3′ conserved segment (3′CS). The 5′CS includes the gene for class 1 integrase (intI1) and a recombination site (attI1). The 3′CS includes qacEΔ1 (quaternary ammonium compound) that confers resistance to quaternary ammonium compounds and sul1 that confers resistance to sulfamethoxazole (Carattoli, 2003). Class 2 integrons are similar to class 1 integron in having an integrase gene and a recombination site but not the sul1 gene in the 3′CS. These 2 classes of integrons are usually identified in Enterobacteriaceae. Evolution of bacterial antimicrobial resistance and its spread and emergence represent one of the most threatening health care problems. In this study, antimicrobial susceptibility, resistance genes, integrons, and their cassettes were characterized in E. coli and Salmonella isolates from poultry feces and chicken carcasses, respectively.
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
Class 1 integrase
tetG
tetE
tetD
tetC
tetB
tetA
qacEΔ1
Sul
Class 2 integron cassette
Class 2 integrase
Class 1 integron cassette
Primer GCCTTGCTGTTCTTCTACGG GATGCCTGCTTGTTCTACGG GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA CACGGATATGCGACAAAAAGGT GTAGCAAACGAGTGACGAAATG CGGGATCCCGGACGGCATGCACGATTTGTA GATGCCATCGCAAGTACGAG CTTCGATGAGAGCCGGCGGC GCAAGGCGGAAACCCGCGCC CGGCATCGTCAACATAACC GTGTGCGGATGAAGTCAG ATCGCAATAGTTGGCGAAGT CAAGCTTTTGCCCATGAAGC GTAATTCTGAGCACTGTCGC CTGCCTGGACAACATTGCTT CTCAGTATTCCAAGCCTTTG ACTCCCCTGAGCTTGAGGGG CCTCTTGCGGGATATCGTCC GGTTGAAGGCTCTCAAGGGC GGATATCTCACCGCATCTGC CATCCATCCGGAAGTGATAGC AAACCACATCCTCCATACGC AAATAGGCCACAACCGTCAG GCTCGGTGGTATCTCTGCTC AGCAACAGAATCGGGAACAC
Oligoneucleotide sequence (5′-3′)
468
278
436
505
414
956
400
720
Zhao and Aoki, 1992
Levy et al., 1999
Miranda et al., 2003
Sengeløv et al., 2003
Sengeløv et al., 2003
Sengeløv et al., 2003
Sandvang et al., 1998
Sandvang et al., 1998
Kerrn et al., 2002
White et al., 2001
Variable 433
White et al., 2001
Lévesque et al., 1995
Variable 565
Lévesque et al., 1995
Reference
565
Size (bp)
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Target gene
Table 1. Primers used in the identification of resistance genes
3038 Dessie et al.
3039
INTEGRONS AND THEIR CASSETTES Table 2. Antibiotic resistance of 99 Escherichia coli and 33 Salmonella isolates by the disc diffusion method No. (%) of resistant isolates Antibiotic
87 77 73 61 37 36 24 24 17 11 0 0 0 0
(87.9) (77.8) (73.7) (61.1) (37.4) (36.4) (24.3) (24.3) (17.2) (11.1) (0.0) (0.0) (0.0) (0.0)
Salmonella 23 22 31 4 0 2 0 0 4 0 0 6 2 2
(69.7) (66.7) (93.9) (15.2) (0.0) (6.1) (0.0) (0.0) (12.1) (0.0) (0.0) (18.2) (6.1) (6.1)
= 47; 47.5) had sul1. Among these, 10 isolates did not exhibit resistance to sulfamethoxazole. The sul2 (n = 15; 20.5%), tetA (n = 55; 63.2%), and tetB (n = 30; 34.5%) resistance genes were identified among the sulfamethoxazole- and tetracycline-resistant isolates. However, 3 isolates that did not show resistance to sulfamethoxazole also carried the sul2 gene. In contrast, isolates (n = 13, 14.9%) without the tet genes also showed resistance to tetracycline. Similarly, the sul2 (n = 26; 78.8%) and tetA (n = 8; 24.2%) genes were also found among the Salmonella isolates. However, the sul1 and tetB genes were absent.
Characterization of Integrons and Their Cassettes A total of 70 (70.7%) and 3 (9.1%) integrons were detected in E. coli and Salmonella isolates, respectively. All integrons harboring E. coli isolates were multidrug resistant (Table 3) except for 4 isolates that were resistant to 1 or 2 antibiotics. In the E. coli isolates, class 1 integrons (n = 54; 54.5%), class 2 integrons (n = 6; 6.1%), and class 1 and class 2 integrons mutually (n = 5; 5.1%) were detected. Except for 3 isolates, all E. coli isolates that lacked integrons were also multidrug resistant, ranging from 4 to 8 antibiotics (n = 13) to 3 antibiotics (n = 11). Part of the integral structure of integron qacEΔ1, which confers resistance to compounds derived from quaternary ammonium, was identified in 46 integron harboring E. coli isolates. Among these, 27 isolates had the entire 3′CS (sul1-qacEΔ1) of the integron shown in Table 3, whereas 11 integron harboring E. coli isolates completely lost the 3′CS and the others contained either sul1 or qacEΔ1. Almost 87% (61/70) of the integrons in E. coli harbored resistance gene cassettes, and to identify the type of genes, all cassettes were fully sequenced. The most common cassette amplicon in the class 1 integons was 1,600 bp (n = 32), which had aadA1+dfrA1 in 27 isolates and the dfrA7+aadA1/aadA5, dfrA17,
DISCUSSION Enterobacteriaceae are significant causes of serious infections in humans and animals, and many of the most important members of this genus, particularly E. coli and Salmonella, are becoming increasingly resistant to commercially available antibiotics. The present study showed the highest incidences of resistance to tetracycline, nalidixic acid, sulfamethoxazole, ampicillin, ciprofloxacin, and sulfamethoxazole-trimethoprim, which are the most commonly used antibiotics in humans and in farm animal production. Resistance development is possibly associated with the long-term and widespread use of antimicrobials. More than 600 tonnes of antimicrobial agents are consumed every year as feed additives in Korea (KFDA, 2006), and the relationship between antimicrobial usage and the development of resistance is also well documented despite resistance development being multifactorial (Phillips et al., 2004). The high incidence of multidrug resistance, 85.8% observed in E. coli as
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Tetracycline Nalidixic Sulfamethoxazole Ampicillin Ciprofloxacin Sulfamethoxazole-trimethoprim Kanamycin Neomycin Chloroamphenicol Gentamicin Ceftazidime Amoxicilline-clavulanic acid Cefotaxime Ceftriaxone
E. coli
aadA2+aadA2, and aadA1+aadA2 genes separately in single isolates. In addition, gene cassettes 2,000 bp (n = 11) and 1,000 bp (n = 9) in size were also amplified in the class 1 integrons. Among the 2,000bp cassettes, 4 isolates harbored dfrA12+aadA2, 2 isolates harbored aadA1+dfrA1, and the remaining harbored aadA2+aadA1+dfrA12, aadA5+dfrA17, dfrA7+aadA5/aadA1, and aadA1+aadA1 gene combinations separately in single isolates. The prevalent cassettes amplified for the class 2 integrons with a size of 2,300 bp were dfrA1+sat2+aadA1 (n = 4), followed by sat1+aadA1 (n = 2) and estX+aadA1 (n = 1; Table 3). The gene cassettes detected from the Salmonella serovars are also included in Table 3. It is very important to point out that there was variation between similar genes identified. There were 3 different groups of aadA1 genes as follows: the first group (aadA1b = 35), thirty-four 99% and one 90% sequence identity to GenBank accession no. ACI43574.1; the second group (aadA1b1 = 7), six 99% and one 62% sequence identity to GenBank accession no. ABP35560.1; and the third group (aadA1b2 = 7), 99% sequence identity to GenBank accession no. ABX75126.2. There were 3 groups of aadA2 genes as follows: the first group (aadA2b4 = 6), 96 to 100% sequence identity to GenBank accession no. CAG342231; the second group (aadA2b6 = 2), one 91% and the other 99% sequence identity to GenBank accession no. CAG342231; and the third group (aadA2b7 = 2), one 99% and the other 94% sequence identity to GenBank accession no. ACJ47203.1. All dfrA genes showed 99% similarity to the cassettes in GenBank shown in Table 3 except for 3 dfrA1 genes that had 93% sequence identity to a gene cassette from an uncultured bacteria (GenBank accession no. AAM77080.1). Moreover, sat2 genes with 85 and 93% sequence identity to GenBank accession no. ABQ52455.1 were also detected.
Resistance pattern2
TE-NA-RL-K-N-AM-C-CIP-SXT TE-NA-RL-GM-K-N-AM-CIP-SXT TE-NA-RL-K-N-AM-CIP-SXT TE-NA-RL-K-N-AM-CIP-SXT TE-NA-RL-K-N-AM-C-SXT TE-NA-RL-K-N-C-CIP- SXT TE-NA-RL-K-N-C-CIP-SXT TE-NA-RL-GM-C-CIP-SXT TE-NA-RL-GM-K-AM-CIP TE-NA-RL-K-N-AM-SXT TE-NA-RL-K-N-AM-SXT TE-NA-RL-N-AM-CIP-SXT TE-NA-RL-N-AM-CIP-SXT TE-NA-RL-K-N-AM TE-NA-GM-AM-C-CIP TE-NA-RL-AM-C-CIP TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-C-SXT TE-NA-RL-C-CIP-SXT TE-NA-RL-GM-AM-SXT TE-NA-RL-K-AM-C TE-NA-RL-K-N-CIP TE-NA-K-N-CIP TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-C TE-NA-RL-AM-C TE-NA-RL-AM-CIP TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-C-CIP TE-NA-RL-C-SXT TE-NA-RL-C-SXT TE-NA-RL-K-N TE-RL-GM-AM SXT TE-NA-AM-CIP TE-NA-AM-CIP TE-NA-GM-AM TE-NA-RL-SXT TE-NA-RL-AM TE-NA-RL-AM TE-NA-RL-AM
Name1
E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 E12 E13 E14 E15 E16 E17 E18 E19 E20 E21 E22 E23 E24 E25 E26 E27 E28 E29 E30 E31 E32 E33 E34 E35 E36 E37 E38 E39 E40 E41 E42 E43 E44 E45 E46 E47 E48 E49 E50
sul1, tetA sul1, tetA sul1, tetA, tetB sul1, tetA, tetB tetA, tetB tetA sul1, sul2, tetA, tetB tetA tetB — tetA, tetB sul1 sul1, tetB sul1, tetA tetA tetA sul1, tetA, tetB tetA tetA tetA sul1, tetA sul1, sul2, tetB tetA tetA, tetB sull, sul2, tetB — tetB — tetA sul1, sul2 sul1, tetA sul1, sul2, tetA sul1, tetA — — tetA tetA tetA tetA sul1, sul2, tetA sul1, tetA tetB tetA, tetB sul1, tetA sul1, tetA sul1, sul2, tetA sul1, sul2, tetB sul1, tetA sul1, tetA tetA
Other genes I I I I I I I, II I II II I I I I I I I I I I I I I I I, II I II I I I I II I I I I I I I, II I I I I I I I I, II I I I
Integron3 qacEΔ1-sul1 — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 — qacEΔ1-sul1 qacEΔ1 qacEΔ1 — — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 — qacEΔ1 qacEΔ1-sul1 qacEΔ1 qacEΔ1 — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 qacEΔ1 qacEΔ1-sul1 qacEΔ1 qacEΔ1 — qacEΔ1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 qacEΔ1 qacEΔ1 qacEΔ1 qacEΔ1 — — qacEΔ1-sul1 — — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 — qacEΔ1-sul1 qacEΔ1-sul1 —
3′CS4
aadA1b1+dfrA7a2 aadA1b aadA1b1+dfrA1a aadA1b2+dfrA1a aadA5b5+aadA1b aadA5b5+aadA1b1 aadA1b+dfrA1a aadA5b5+dfrA7a1 dfrA1a+sat2+aadA1b dfrA1a+sat2+aadA1b aadA1b+dfrA1a aadA1b1+dfrA1a aadA1b+ dfrA1a aadA2b4+aadA1b1+dfrA12a3 aadA1b aadA5b5+dfrA17a3 aadA1b+dfrA1a aadA1b+dfrA1a aadA1b+dfrA1a aadA1b2+ dfrA1a aadA2b4+dfrA12a2 aadA1b2+dfrA1a aadA1b+aadA1b dfrA1a+sat2+aadA1b aadA2b6 dfrA1a+sat2+aadA1b aadA1b aadA1b1+dfrA1a aadA1b+dfrA1a dfrA1a+aadA1b dfrA1a1+aadA1b1 aadA1b+dfrA1a aadA1b3+dfrA1a aadA1b+dfrA1a aadA1b+dfrA1a aadA1b1, sat1+aadA1b dfrA7a2+aadA5b5 aadA1b+dfrA1a aadA2b7+aadA2b7 aadA1b2+dfrA1a aadA1b+dfrA1a aadA1b+dfrA1a aadA1b+dfrA1a, sat1+aadA1b2 aadA1b+dfrA1a dfrA12a2+aadA2b4 dfrA1a+aadA1b 1,600 1,000 1,600 1,600 1,000 1,000 I/1,600, II/NC 1,600 2,000 2,000 1,600 1,600 1,600 2,000 NC 1,000 2,000 1,600 1,600, 600 1,600 1,600 1,000, 900 1,600 2,000 I/NC, II/2,300 1,000 2,300 1,000 1,000 1,600 1,600 NC 2,000 1,600 1,600 NC 1,600, 600 1,600 I/1,000, II/2,300 2,000 1,600 1,600 NC 1,600 1,600 1,600, 1,000 I/2,000, II/2,300 1,600 2,000 1,600
Continued
Cassette arrays6
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Cassette amplicon5 (bp)
Table 3. Description of integrons harboring Escherichia coli and Salmonella isolates and characterization of the associated gene cassettes
3040 Dessie et al.
TE-NA-RL-AM TE-NA-RL-K-AM TE-RL-AM-CIP TE-RL-CIP-SXT TE-RL-GM-AM RL-AM-SXT TE-NA-RL TE-NA-RL TE-NA-RL TE-NA-RL TE-RL-AM TE-AM TE-RL TE NA TE-NA-RL-AM-AMC-SXT-CRO-C-CTX TE-NA-RL
E51 E52 E53 E54 E55 E56 E57 E58 E59 E60 E61 E62 E63 E64 E65 SM SE
sul1, sul2, tetA sul1, sul2, tetA tet A sul1, sul2, tetB sul1, tetB sul1, sul2, tetA sul1, tetA sul1, tetB sul1 sul1, tetB sul1, tetA sul1, sul2 tetB sul1, tetA — sul2, tetA, tetD sul2, tetA
Other genes I I I I I I I II I I I I I, II I II I, II I
Integron3 — qacEΔ1-sul1 — qacEΔ1-sul1 — qacEΔ1-sul1 — — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 — qacEΔ1 qacEΔ1 qacEΔ1
3′CS4
Cassette arrays6 aadA1b+dfrA1a dfrA17a3 aadA1b2+aadA2b6 aadA2b4+dfrA12a2 dfrA7a1+aadA1b2 dfrA1a+aadA1b estX+aadA1b dfrA12a2+aadA2b4 dfrA12a2+aadA2b4 dfrA1a+aadA1b dfrA1a+aadA1b dfrA1a+sat2+aadA1b dfrA1a+sat2+aadA1b aadA1+dfrA1, dfrA12+sat2+aadA1
1,600, 500 1,600 NC 1,600 2,000 2,000, 1,600 1,600 2,300 2,000 2,000 1,600 1,600, 1,000 I/NC, II/2,300 NC 2,300 I/1,600, II/2,000 NC
2TE,
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
E. coli; SM, Salmonella malmoe; SE, Salmonella enteritidis. tetracycline; NA, nalidixic acid; RL, sulfamethoxazole; K, kanamycin; N, neomycin; AM, ampicillin; C, chloroamphenicol; CIP, ciprofloxacin; SXT, sulfamethoxazole-trimethoprim; GM, gentamicin; AMC, amoxicilline-clavulanic acid. 3I, class 1 integron; II, class 2 integron. 43′CS, 3′ conserved segment. 5NC, no cassette. 6Gene cassettes obtained by sequencing: a, 99% similarity with GenBank accession number AAM77080.1, except for E47, E29, E48, E44, and E13; a1, 99% similarity with GenBank accession number YP003108349; a2, 99% similarity with GenBank accession number CCC_201015.1; a3, 99% similarity with GenBank accession number AFK79052; b, 99% similarity with GenBank accession number ACI43574.1; b1, 99% similarity with GenBank accession number ABP35560.1; b2, 99% similarity with GenBank accession number ABX75126.2; b4, 96 to 100% similarity with GenBank accession number CCC201015.1; b5, 99% similarity with GenBank accession number CAP69687.1, b6, >91% similarity with GenBank accession number CAG342231; b7, >94% similarity with GenBank accession number ACJ47203.1.
1E,
Resistance pattern2
Name1
Cassette amplicon5 (bp)
Table 3 (Continued). Description of integrons harboring Escherichia coli and Salmonella isolates and characterization of the associated gene cassettes
INTEGRONS AND THEIR CASSETTES
3041
3042
Dessie et al.
ACI43574.1) and in E. coli isolated from turkey in the United States (GenBank accession no. ABP35560.1), respectively, had mutations at different positions showing substitutions of around 20 amino acids. Similarly, the aadA2, dfrA1, and sat2 genes with sequence identity below 95% to a cassette in GenBank also showed mutations at different codons. This suggests that gene cassettes are becoming more diverse and evolutionarily diverging from their previous ancestors. Of all the E. coli isolates that had integrons, 9 isolates (13.8%) did not carry gene cassettes, the so-called empty integrons. This situation also has been described previously by Fonseca et al. (2005) pointing out that these bacteria can have the potential in the future to convert themselves rapidly into multidrug-resistant strains. However, on the contrary, the integrons might have previously removed the acquired resistance gene cassettes through excision for unknown reasons. The high incidence of multidrug-resistance in E. coli and Salmonella isolates in poultry feces and carcasses is of special interest, especially in terms of human health. Most of these resistant isolates carry integrons containing resistant gene cassettes. Thus, it is crucial to track the evolution of multidrug-resistant isolates in poultry and to analyze the implications for humans. Surveillance of integron content in E. coli and Salmonella populations can provide useful information concerning the evolutionary changes of gene cassettes, which may be fundamental in estimating the health risk and preventing the spread of particular antibiotic resistance determinants from animals to humans.
REFERENCES Antunes, P., J. Machado, J. C. Sousa, and L. Peixe. 2005. Dissemination of sulfonamide resistance genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica strains and relation with integrons. Antimicrob. Agents Chemother. 49:836–839. Antunes, P., C. Réu, J. C. Sousa, L. Peixe, and N. Pestana. 2003. Incidence of Salmonella from poultry products and their susceptibility to antimicrobial agents. Int. J. Food Microbiol. 82:97–103. Bauer, A. W., W. M. Kirby, J. C. Sherris, and M. Turck. 1966. Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 45:493–496. Carattoli, A. 2003. Plasmid-mediated antimicrobial resistance in Salmonella enterica. Curr. Issues Mol. Biol. 5:113–122. Clinical and Laboratory Standards Institute (CLSI). 2011. Performance standard for antimicrobial susceptibility test. Twenty first information supplement CLSI Document M100–S21: vol. 31, no. 1. Clinical and Laboratory Standards Institute, Wayne, PA. De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L. Toti. 2003. Evaluation of DNA extraction methods for use in combination with SYBR green I real-time PCR to detect Salmonella enterica serotype enteritidis in poultry. Appl. Environ. Microbiol. 69:3456–3461. Enne, V. I., D. M. Livermore, P. Stephens, and L. M. Hall. 2001. Persistence of sulphonamide resistance in Escherichia coli in the UK despite national prescribing restriction. Lancet 357:1325– 1328. Fluit, A. C. 2005. Towards more virulent and antibiotic-resistant Salmonella? FEMS Immunol. Med. Microbiol. 43:1–11. Fonseca, E. L., V. V. Vieira, R. Cipriano, and A. C. Vicente. 2005. Class 1 integrons in Pseudomonas aeruginosa isolates from clinical settings in Amazon region, Brazil. FEMS Immunol. Med. Microbiol. 44:303–309.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
well as 63.6% in Salmonella isolates, is exceptionally prominent and should be considered as a serious health threat in view of the fact that multidrug-resistant isolates may have a chance to contaminate food products and consequently transfer to humans. The highest tetracycline resistance phenotypes observed in the E. coli isolates were linked to the presence of the tetA gene (63.2%) and considered to be the gene commonly identified followed by tetB (34.5%) in the E. coli isolates. They are among the most widespread tet genes found in Enterobacteriaceae and their occurrence was within the range reported by other investigators (Lanz et al., 2003). Because sul1 is usually associated with transposons and integrons as part of the 3′ conserved structure, it was commonly identified in our E. coli isolates in agreement with earlier studies that reported sul1 and sul2 to be common among bacteria from the Enterobacteriaceae family (Antunes et al., 2003). However, the sul2 gene was exclusively the mechanism of resistance to sulfonamides in the Salmonella isolates, corresponding to the lower detection of integrons in the Salmonella isolates, which disagrees with the findings of Antunes et al. (2005) reporting that sul1 was the mechanism of resistance in Salmonella isolates. The total incidence of integrons at 70.7% was higher than the integrons detected in clinical E. coli isolates in previous reports at 54.6% in Korea (Yu et al., 2004), but lower when compared with a report on E. coli isolated from clinical patients in China (Hsu et al., 2006) and E. coli isolated from animals in Ireland (Karczmarczyk et al., 2011). Similar to previous reports (van Essen-Zandbergen et al., 2007; Soufi et al., 2009; Vinué et al., 2010), class 1 integrons (59.6%) were the most frequent type of integrons detected in this study followed by the detection of class 2 integrons (11.1%) in E. coli, and the lower detection of integrons in Salmonella isolates is in accordance with the finding of van Essen-Zandbergen et al. (2007). We confirmed the predominance of gene cassettes conferring resistance to streptomycin and to spectinomycin (aadA), trimethoprim (dfrA), and streptothricin (sat1, sat2, and estX) carried by class 1 and class 2 integron harboring E. coli isolates. The persistence of these genes, which have been reported worldwide in isolates from different origins, might be associated with the extensive use of streptomycin/spectinomycin, trimethoprimes, sulfonamides, and other antibiotics in food-producing animals. There is no definitive link between the dfrA genes and the use of SMT/sulfamethoxazole-trimethprim in farms. Each of the intgrons with dfrA genes also had an aadA1 and most had a sul1 gene; thus, coselection of integrons with either streptomycin or sulfonamides may have contributed to SMT/ sulfamethoxazole-trimethoprim resistances as well. The aadA1 gene cassettes from the first and second groups that had 90 and 62% homologous sequence identities to a gene cassette found in E. coli isolated from bovine mastitis in China (GenBank accession no.
INTEGRONS AND THEIR CASSETTES
ria from Chilean salmon farms. Antimicrob. Agents Chemother. 47:883–888. Phillips, I., M. Casewell, T. Cox, B. De Groot, C. Friis, R. Jones, C. Nightingale, R. Preston, and J. Waddell. 2004. Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J. Antimicrob. Chemother. 53:28–52. Sandvang, D., F. M. Aarestrup, and L. B. Jensen. 1998. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104. FEMS Microbiol. Lett. 160:37–41. Sengeløv, G., Y. Agersø, B. Halling-Sørensen, S. B. Baloda, J. S. Andersen, and L. B. Jensen. 2003. Bacterial antibiotic resistance levels in Danish farmland as a result of treatment with pig manure slurry. Environ. Int. 28:587–595. Soufi, L., M. S. Abbassi, Y. Sáenz, L. Vinué, S. Somalo, M. Zarazaga, A. Abbas, R. Dbaya, L. Khanfir, A. Ben Hassen, S. Hammami, and C. Torres. 2009. Prevalence and diversity of integrons and associated resistance genes in Escherichia coli isolates from poultry meat in Tunisia. Foodborne Pathog. Dis. 6:1067–1073. van Essen-Zandbergen, A., H. Smith, K. Veldman, and D. Mevius. 2007. Occurrence and characteristics of class 1, 2 and 3 integrons in Escherichia coli, Salmonella and Campylobacter spp. in the Netherlands. J. Antimicrob. Chemother. 59:746–750. Vinué, L., Y. Sáenz, B. Rojo-Bezares, I. Olarte, E. Undabeitia, S. Somalo, M. Zarazaga, and C. Torres. 2010. Genetic environment of sul genes and characterisation of integrons in Escherichia coli isolates of blood origin in a Spanish hospital. Int. J. Antimicrob. Agents 35:492–496. White, D. G., S. Zhao, R. Sudler, S. Ayers, S. Friedman, S. Chen, P. F. McDermott, S. McDermott, D. D. Wagner, and J. Meng. 2001. The isolation of antibiotic-resistant Salmonella from retail ground meats. N. Engl. J. Med. 345:1147–1154. Wright, G. D. 2010. Antibiotic resistance in the environment: A link to the clinic? Curr. Opin. Microbiol. 13:589–594. Yu, H. S., J. C. Lee, H. Y. Kang, Y. S. Jeong, E. Y. Lee, C. H. Choi, S. H. Tae, Y. C. Lee, S. Y. Seol, and D. T. Cho. 2004. Prevalence of dfr genes associated with integrons and dissemination of dfrA17 among urinary isolates of Escherichia coli in Korea. J. Antimicrob. Chemother. 53:445–450. Zhao, J., and T. Aoki. 1992. Nucleotide sequence analysis of the class G tetracycline resistance determinant from Vibrio anguillarum. Microbiol. Immunol. 36:1051–1060.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Hall, R. M., and C. M. Collis. 1995. Mobile gene cassettes and integrons: Capture and spread of genes by site-specific recombination. Mol. Microbiol. 15:593–600. Hsu, S. C., T. H. Chiu, J. C. Pang, C. H. Hsuan-Yuan, G. N. Chang, and H. Y. Tsen. 2006. Characterisation of antimicrobial resistance patterns and class 1 integrons among Escherichia coli and Salmonella enterica serovar Choleraesuis strains isolated from humans and swine in Taiwan. Int. J. Antimicrob. Agents 27:383– 391. Karczmarczyk, M., Y. Abbott, C. Walsh, N. Leonard, and S. Fanning. 2011. Characterization of multidrug-resistant Escherichia coli isolates from animals presenting at a university veterinary hospital. Appl. Environ. Microbiol. 77:7104–7112. Kerrn, M. B., T. Klemmensen, N. Frimodt-Møller, and F. Espersen. 2002. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 50:513–516. Kim, A., Y. J. Lee, M. S. Kang, S. I. Kwag, and J. K. Cho. 2007. Dissemination and tracking of Salmonella spp. in integrated broiler operation. J. Vet. Sci. 8:155–161. Korea Food and Drug Administration (KFDA). 2006. Annual Report of National Antimicrobial Resistance Management 3:297– 313. (NARMP). Korea Food and Drug Administration, Seoul, Korea. Lanz, R., P. Kuhnert, and P. Boerlin. 2003. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. Microbiol. 91:73–84. Lévesque, C., L. Piché, C. Larose, and P. H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185–191. Levy, S. B., L. M. McMurry, T. M. Barbosa, V. Burdett, P. Courvalin, W. Hillen, M. C. Roberts, J. I. Rood, and D. E. Taylor. 1999. Nomenclature for new tetracycline resistance determinants. Antimicrob. Agents Chemother. 43:1523–1524. Lupo, A., S. Coyne, and T. U. Berendonk. 2012. Origin and evolution of antibiotic resistance: The common mechanisms of emergence and spread in water bodies. Front. Microbiol. 3:18. http://dx.doi.org/10.3389/fmicb.2012.00018. Michalova, E., P. Novotna, and J. Schelegelova. 2004. Tetracycline in veterinary medicine and bacterial resistance to them. Vet. Med. Czech. 49:79–100. Miranda, C. D., C. Kehrenberg, C. Ulep, S. Schwarz, and M. C. Roberts. 2003. Diversity of tetracycline resistance genes in bacte-
3043
Key words: integron, Escherichia coli, Salmonella, poultry 2013 Poultry Science 92:3036–3043 http://dx.doi.org/10.3382/ps.2013-03312
INTRODUCTION Recently, a dramatic increase in antimicrobial resistance in different species of bacteria, particularly multidrug-resistance in Salmonella and Escherichia coli, continue to emerge throughout the world because antimicrobials are extensively used for therapeutic and prophylactic purposes in animals and humans (Hsu et al., 2006). Several mechanisms for the development of antimicrobial resistance exist and are readily spread to a variety of bacterial genera. Bacteria may acquire efflux pumps that extrude the antibacterial agent from the cell before it can reach its target site and exert its effect; efflux pump coding plasmids include tetA, tetB,
©2013 Poultry Science Association Inc. Received May 13, 2013. Accepted July 20, 2013. 1 Corresponding author: [email protected] or youngju@knu. ac.kr
tetC, tetD, and tetG genes for tetracycline resistance (Michalova et al., 2004). Additionally, bacteria may acquire several genes for a metabolic pathway which ultimately produces a metabolite that no longer contains the binding site of an antimicrobial agent. Commonly, sulfonamide resistance in gram-negative bacteria generally arises from the acquisition of 2 genes, sul1 or sul2, encoding forms of dihydropteroate synthase that are not inhibited by the drug (Enne et al., 2001). Recently, a major public health challenge has been the spread of antimicrobial resistance determinants in bacterial populations and consequently the transfer of these genes from animals to humans (Lupo et al., 2012). In addition to plasmids, other genetic elements that participate in resistance gene transfer and the consequent development of antimicrobial resistance in bacteria are transposons and integrons (Wright, 2010). Of these, integrons are capable of capturing and excising gene cassettes according to Hall and Collis (1995), are natural genetic engineering platforms that encode resistance to several antimicrobial agents, and are fre-
3036
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
ABSTRACT Ninety-nine Escherichia coli and 33 Salmonella isolates were assessed for antimicrobial susceptibility (disc diffusion test). Sulfonamide and tetracycline resistance genes were identified through PCR, and class 1 and class 2 integrons with resistance gene cassettes were identified with PCR followed by sequencing. Salmonella (63.6%) and E. coli (85.8%) isolates were multidrug resistant (resistance to 3 or more antimicrobials), and the highest incidences of resistance were observed for tetracycline, nalidixic acid, and sulfamethoxazole. The sul1, sul2, tetA, and tetB resistance determinant genes were predominant in E. coli, whereas only sul2 and tetA were identified in Salmonella isolates. In the E. coli isolates, 54 (54.5%) class 1 integrons, 6 (6.1%) class 2 integrons, and 5 (5.1%) class 1 and class 2 integrons together were detected, whereas only 3 (9.1%) integrons were found in the Salmonella serovars. Around 87% of the integrons in E. coli harbored resistance gene cassettes conferring re-
3037
INTEGRONS AND THEIR CASSETTES
MATERIALS AND METHODS Bacterial Isolates A total of 132 bacterial isolates consisting of 99 E. coli isolated from apparently healthy chicken feces and 33 Salmonella (Salmonella Enteritidis, n = 16 and other serovars, n = 17) isolated from the same chicken after slaughter in 2011 in Korea were investigated in this study. All E. coli and Salmonella isolates were isolated and identified following conventional methods described elsewhere (Kim et al., 2007). Salmonella isolates were previously serotyped according to the Kauffman White scheme by the slide agglutination test using Salmonella-specific O and H antisera (Difco, Detroit, MI).
Antimicrobial Susceptibility Test All E. coli and Salmonella isolates were subjected to a susceptibility test against 14 antimicrobials on Müller-Hinton agar (Difco) with the Kirby-Bauer disc diffusion methodology (Bauer et al., 1966). The following antimicrobial discs (Difco) were used: gentamicin (10 μg), kanamycin (30 μg), ampicillin (10 μg), cefotaxime (30 μg), nalidixic acid (30 μg), ciprofloxacin (5 μg), tetracycline (30 μg), sulfamethoxazole-trimethoprim (1.25/23.75 μg), chloramphenicol (30 μg), ceftazidime (30 μg), amoxicillin-clavulanic acid (30 μg), neomycin (30 μg), ceftriaxone (30 μg), and sulfamethoxazole (100 μg). According to the CLSI (2011) M100-S21 guidelines, inhibition zones were measured and evaluated as susceptible or resistant. An isolate was considered multidrug resistant if it was resistant to 3 or more antimicrobials. Escherichia coli strain ATCC 25922 was used as a reference strain.
Analysis of Antimicrobial Resistance Genes The DNA for all experiments was extracted by the boiling method (De Medici et al., 2003), and aliquots of DNA templates were stored at −20°C until used. Plasmid replicons were examined by PCR for the sulfamethoxazole and tetracycline resistance phenotypes of E. coli and Salmonella isolates with the primers presented in Table 1. Sulfonamide resistance genes sul1 and sul2 (Kerrn et al., 2002) and tetracycline resistance genes tetA, tetB, tetC, tetD, tetE, and tetG were tested as previously described (Zhao and Aoki, 1992; Levy et al., 1999; Miranda et al., 2003).
Characterization of Integrons and Their Cassettes All E. coli and Salmonella isolates were screened for the presence of class 1 and class 2 integrons. The presence of gene cassettes in the integron positive isolates were assessed through PCR assay with primers presented in Table 1. The PCR conditions were as follows: initial denaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 30 s, 58°C for 30 s, and 72°C for 2 min with a final extension at 72°C for 5 min. Furthermore, integron positive isolates were assessed for the entire 3′CS (qacEΔ1-sul1). The PCR products of the gene cassettes were purified using GFX PCR DNA and the Gel band purification kit (Amersham Bioscience, Freiburg, Germany) and sequenced using the Sanger method by the Macrogen company (Daejeon, Korea). Gene cassette homology searches were performed by Basic Local Alignment Search Tool (BLAST) analysis (www.ncbi.nlm.nih.gov/BLAST).
RESULTS Antimicrobial Susceptibilities The results of the antimicrobial susceptibility tests for Salmonella and E. coli are presented in Table 2. The highest incidence of resistance observed were for tetracycline (n = 87; 87.9%), nalidixic acid (n = 77; 77.8%), sulfamethoxazole (n = 73; 73.7%), ampicillin (n = 61; 61.6%), ciprofloxacin (n = 37; 37.4%), and sulfamethoxazole-trimethoprim (n = 36; 36.4%). Among the E. coli isolates, 85.8% were multidrug resistant. Similarly, Salmonella isolates (63.6%) were also multidrug resistant and commonly resistant to tetracycline (n = 23; 69.7%), sulfamethoxazole (n = 31; 93.9%), and nalidixic acid (n = 22; 66.7%) as shown in Table 2. A variety of resistance patterns was found in the E. coli isolates and in isolates that harbored integrons shown in Table 3.
Antimicrobial Resistance Genes From the 99 E. coli isolates tested, 36 isolates harboring integrons and 11 isolates without integrons (n
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
quently associated with the development of multidrug resistance in gram-negative bacteria. Class 1 integrons, the most common type, mostly found as part of the Tn21 or Tn402 transposon family, have been detected in bacteria in many regions (Fluit, 2005). They contain a 5′ conserved segment (5′CS) and a 3′ conserved segment (3′CS). The 5′CS includes the gene for class 1 integrase (intI1) and a recombination site (attI1). The 3′CS includes qacEΔ1 (quaternary ammonium compound) that confers resistance to quaternary ammonium compounds and sul1 that confers resistance to sulfamethoxazole (Carattoli, 2003). Class 2 integrons are similar to class 1 integron in having an integrase gene and a recombination site but not the sul1 gene in the 3′CS. These 2 classes of integrons are usually identified in Enterobacteriaceae. Evolution of bacterial antimicrobial resistance and its spread and emergence represent one of the most threatening health care problems. In this study, antimicrobial susceptibility, resistance genes, integrons, and their cassettes were characterized in E. coli and Salmonella isolates from poultry feces and chicken carcasses, respectively.
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
Class 1 integrase
tetG
tetE
tetD
tetC
tetB
tetA
qacEΔ1
Sul
Class 2 integron cassette
Class 2 integrase
Class 1 integron cassette
Primer GCCTTGCTGTTCTTCTACGG GATGCCTGCTTGTTCTACGG GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA CACGGATATGCGACAAAAAGGT GTAGCAAACGAGTGACGAAATG CGGGATCCCGGACGGCATGCACGATTTGTA GATGCCATCGCAAGTACGAG CTTCGATGAGAGCCGGCGGC GCAAGGCGGAAACCCGCGCC CGGCATCGTCAACATAACC GTGTGCGGATGAAGTCAG ATCGCAATAGTTGGCGAAGT CAAGCTTTTGCCCATGAAGC GTAATTCTGAGCACTGTCGC CTGCCTGGACAACATTGCTT CTCAGTATTCCAAGCCTTTG ACTCCCCTGAGCTTGAGGGG CCTCTTGCGGGATATCGTCC GGTTGAAGGCTCTCAAGGGC GGATATCTCACCGCATCTGC CATCCATCCGGAAGTGATAGC AAACCACATCCTCCATACGC AAATAGGCCACAACCGTCAG GCTCGGTGGTATCTCTGCTC AGCAACAGAATCGGGAACAC
Oligoneucleotide sequence (5′-3′)
468
278
436
505
414
956
400
720
Zhao and Aoki, 1992
Levy et al., 1999
Miranda et al., 2003
Sengeløv et al., 2003
Sengeløv et al., 2003
Sengeløv et al., 2003
Sandvang et al., 1998
Sandvang et al., 1998
Kerrn et al., 2002
White et al., 2001
Variable 433
White et al., 2001
Lévesque et al., 1995
Variable 565
Lévesque et al., 1995
Reference
565
Size (bp)
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Target gene
Table 1. Primers used in the identification of resistance genes
3038 Dessie et al.
3039
INTEGRONS AND THEIR CASSETTES Table 2. Antibiotic resistance of 99 Escherichia coli and 33 Salmonella isolates by the disc diffusion method No. (%) of resistant isolates Antibiotic
87 77 73 61 37 36 24 24 17 11 0 0 0 0
(87.9) (77.8) (73.7) (61.1) (37.4) (36.4) (24.3) (24.3) (17.2) (11.1) (0.0) (0.0) (0.0) (0.0)
Salmonella 23 22 31 4 0 2 0 0 4 0 0 6 2 2
(69.7) (66.7) (93.9) (15.2) (0.0) (6.1) (0.0) (0.0) (12.1) (0.0) (0.0) (18.2) (6.1) (6.1)
= 47; 47.5) had sul1. Among these, 10 isolates did not exhibit resistance to sulfamethoxazole. The sul2 (n = 15; 20.5%), tetA (n = 55; 63.2%), and tetB (n = 30; 34.5%) resistance genes were identified among the sulfamethoxazole- and tetracycline-resistant isolates. However, 3 isolates that did not show resistance to sulfamethoxazole also carried the sul2 gene. In contrast, isolates (n = 13, 14.9%) without the tet genes also showed resistance to tetracycline. Similarly, the sul2 (n = 26; 78.8%) and tetA (n = 8; 24.2%) genes were also found among the Salmonella isolates. However, the sul1 and tetB genes were absent.
Characterization of Integrons and Their Cassettes A total of 70 (70.7%) and 3 (9.1%) integrons were detected in E. coli and Salmonella isolates, respectively. All integrons harboring E. coli isolates were multidrug resistant (Table 3) except for 4 isolates that were resistant to 1 or 2 antibiotics. In the E. coli isolates, class 1 integrons (n = 54; 54.5%), class 2 integrons (n = 6; 6.1%), and class 1 and class 2 integrons mutually (n = 5; 5.1%) were detected. Except for 3 isolates, all E. coli isolates that lacked integrons were also multidrug resistant, ranging from 4 to 8 antibiotics (n = 13) to 3 antibiotics (n = 11). Part of the integral structure of integron qacEΔ1, which confers resistance to compounds derived from quaternary ammonium, was identified in 46 integron harboring E. coli isolates. Among these, 27 isolates had the entire 3′CS (sul1-qacEΔ1) of the integron shown in Table 3, whereas 11 integron harboring E. coli isolates completely lost the 3′CS and the others contained either sul1 or qacEΔ1. Almost 87% (61/70) of the integrons in E. coli harbored resistance gene cassettes, and to identify the type of genes, all cassettes were fully sequenced. The most common cassette amplicon in the class 1 integons was 1,600 bp (n = 32), which had aadA1+dfrA1 in 27 isolates and the dfrA7+aadA1/aadA5, dfrA17,
DISCUSSION Enterobacteriaceae are significant causes of serious infections in humans and animals, and many of the most important members of this genus, particularly E. coli and Salmonella, are becoming increasingly resistant to commercially available antibiotics. The present study showed the highest incidences of resistance to tetracycline, nalidixic acid, sulfamethoxazole, ampicillin, ciprofloxacin, and sulfamethoxazole-trimethoprim, which are the most commonly used antibiotics in humans and in farm animal production. Resistance development is possibly associated with the long-term and widespread use of antimicrobials. More than 600 tonnes of antimicrobial agents are consumed every year as feed additives in Korea (KFDA, 2006), and the relationship between antimicrobial usage and the development of resistance is also well documented despite resistance development being multifactorial (Phillips et al., 2004). The high incidence of multidrug resistance, 85.8% observed in E. coli as
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Tetracycline Nalidixic Sulfamethoxazole Ampicillin Ciprofloxacin Sulfamethoxazole-trimethoprim Kanamycin Neomycin Chloroamphenicol Gentamicin Ceftazidime Amoxicilline-clavulanic acid Cefotaxime Ceftriaxone
E. coli
aadA2+aadA2, and aadA1+aadA2 genes separately in single isolates. In addition, gene cassettes 2,000 bp (n = 11) and 1,000 bp (n = 9) in size were also amplified in the class 1 integrons. Among the 2,000bp cassettes, 4 isolates harbored dfrA12+aadA2, 2 isolates harbored aadA1+dfrA1, and the remaining harbored aadA2+aadA1+dfrA12, aadA5+dfrA17, dfrA7+aadA5/aadA1, and aadA1+aadA1 gene combinations separately in single isolates. The prevalent cassettes amplified for the class 2 integrons with a size of 2,300 bp were dfrA1+sat2+aadA1 (n = 4), followed by sat1+aadA1 (n = 2) and estX+aadA1 (n = 1; Table 3). The gene cassettes detected from the Salmonella serovars are also included in Table 3. It is very important to point out that there was variation between similar genes identified. There were 3 different groups of aadA1 genes as follows: the first group (aadA1b = 35), thirty-four 99% and one 90% sequence identity to GenBank accession no. ACI43574.1; the second group (aadA1b1 = 7), six 99% and one 62% sequence identity to GenBank accession no. ABP35560.1; and the third group (aadA1b2 = 7), 99% sequence identity to GenBank accession no. ABX75126.2. There were 3 groups of aadA2 genes as follows: the first group (aadA2b4 = 6), 96 to 100% sequence identity to GenBank accession no. CAG342231; the second group (aadA2b6 = 2), one 91% and the other 99% sequence identity to GenBank accession no. CAG342231; and the third group (aadA2b7 = 2), one 99% and the other 94% sequence identity to GenBank accession no. ACJ47203.1. All dfrA genes showed 99% similarity to the cassettes in GenBank shown in Table 3 except for 3 dfrA1 genes that had 93% sequence identity to a gene cassette from an uncultured bacteria (GenBank accession no. AAM77080.1). Moreover, sat2 genes with 85 and 93% sequence identity to GenBank accession no. ABQ52455.1 were also detected.
Resistance pattern2
TE-NA-RL-K-N-AM-C-CIP-SXT TE-NA-RL-GM-K-N-AM-CIP-SXT TE-NA-RL-K-N-AM-CIP-SXT TE-NA-RL-K-N-AM-CIP-SXT TE-NA-RL-K-N-AM-C-SXT TE-NA-RL-K-N-C-CIP- SXT TE-NA-RL-K-N-C-CIP-SXT TE-NA-RL-GM-C-CIP-SXT TE-NA-RL-GM-K-AM-CIP TE-NA-RL-K-N-AM-SXT TE-NA-RL-K-N-AM-SXT TE-NA-RL-N-AM-CIP-SXT TE-NA-RL-N-AM-CIP-SXT TE-NA-RL-K-N-AM TE-NA-GM-AM-C-CIP TE-NA-RL-AM-C-CIP TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-CIP-SXT TE-NA-RL-AM-C-SXT TE-NA-RL-C-CIP-SXT TE-NA-RL-GM-AM-SXT TE-NA-RL-K-AM-C TE-NA-RL-K-N-CIP TE-NA-K-N-CIP TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-C TE-NA-RL-AM-C TE-NA-RL-AM-CIP TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-AM-SXT TE-NA-RL-C-CIP TE-NA-RL-C-SXT TE-NA-RL-C-SXT TE-NA-RL-K-N TE-RL-GM-AM SXT TE-NA-AM-CIP TE-NA-AM-CIP TE-NA-GM-AM TE-NA-RL-SXT TE-NA-RL-AM TE-NA-RL-AM TE-NA-RL-AM
Name1
E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 E12 E13 E14 E15 E16 E17 E18 E19 E20 E21 E22 E23 E24 E25 E26 E27 E28 E29 E30 E31 E32 E33 E34 E35 E36 E37 E38 E39 E40 E41 E42 E43 E44 E45 E46 E47 E48 E49 E50
sul1, tetA sul1, tetA sul1, tetA, tetB sul1, tetA, tetB tetA, tetB tetA sul1, sul2, tetA, tetB tetA tetB — tetA, tetB sul1 sul1, tetB sul1, tetA tetA tetA sul1, tetA, tetB tetA tetA tetA sul1, tetA sul1, sul2, tetB tetA tetA, tetB sull, sul2, tetB — tetB — tetA sul1, sul2 sul1, tetA sul1, sul2, tetA sul1, tetA — — tetA tetA tetA tetA sul1, sul2, tetA sul1, tetA tetB tetA, tetB sul1, tetA sul1, tetA sul1, sul2, tetA sul1, sul2, tetB sul1, tetA sul1, tetA tetA
Other genes I I I I I I I, II I II II I I I I I I I I I I I I I I I, II I II I I I I II I I I I I I I, II I I I I I I I I, II I I I
Integron3 qacEΔ1-sul1 — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 — qacEΔ1-sul1 qacEΔ1 qacEΔ1 — — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 — qacEΔ1 qacEΔ1-sul1 qacEΔ1 qacEΔ1 — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 qacEΔ1 qacEΔ1-sul1 qacEΔ1 qacEΔ1 — qacEΔ1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 qacEΔ1 qacEΔ1 qacEΔ1 qacEΔ1 — — qacEΔ1-sul1 — — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 — qacEΔ1-sul1 qacEΔ1-sul1 —
3′CS4
aadA1b1+dfrA7a2 aadA1b aadA1b1+dfrA1a aadA1b2+dfrA1a aadA5b5+aadA1b aadA5b5+aadA1b1 aadA1b+dfrA1a aadA5b5+dfrA7a1 dfrA1a+sat2+aadA1b dfrA1a+sat2+aadA1b aadA1b+dfrA1a aadA1b1+dfrA1a aadA1b+ dfrA1a aadA2b4+aadA1b1+dfrA12a3 aadA1b aadA5b5+dfrA17a3 aadA1b+dfrA1a aadA1b+dfrA1a aadA1b+dfrA1a aadA1b2+ dfrA1a aadA2b4+dfrA12a2 aadA1b2+dfrA1a aadA1b+aadA1b dfrA1a+sat2+aadA1b aadA2b6 dfrA1a+sat2+aadA1b aadA1b aadA1b1+dfrA1a aadA1b+dfrA1a dfrA1a+aadA1b dfrA1a1+aadA1b1 aadA1b+dfrA1a aadA1b3+dfrA1a aadA1b+dfrA1a aadA1b+dfrA1a aadA1b1, sat1+aadA1b dfrA7a2+aadA5b5 aadA1b+dfrA1a aadA2b7+aadA2b7 aadA1b2+dfrA1a aadA1b+dfrA1a aadA1b+dfrA1a aadA1b+dfrA1a, sat1+aadA1b2 aadA1b+dfrA1a dfrA12a2+aadA2b4 dfrA1a+aadA1b 1,600 1,000 1,600 1,600 1,000 1,000 I/1,600, II/NC 1,600 2,000 2,000 1,600 1,600 1,600 2,000 NC 1,000 2,000 1,600 1,600, 600 1,600 1,600 1,000, 900 1,600 2,000 I/NC, II/2,300 1,000 2,300 1,000 1,000 1,600 1,600 NC 2,000 1,600 1,600 NC 1,600, 600 1,600 I/1,000, II/2,300 2,000 1,600 1,600 NC 1,600 1,600 1,600, 1,000 I/2,000, II/2,300 1,600 2,000 1,600
Continued
Cassette arrays6
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Cassette amplicon5 (bp)
Table 3. Description of integrons harboring Escherichia coli and Salmonella isolates and characterization of the associated gene cassettes
3040 Dessie et al.
TE-NA-RL-AM TE-NA-RL-K-AM TE-RL-AM-CIP TE-RL-CIP-SXT TE-RL-GM-AM RL-AM-SXT TE-NA-RL TE-NA-RL TE-NA-RL TE-NA-RL TE-RL-AM TE-AM TE-RL TE NA TE-NA-RL-AM-AMC-SXT-CRO-C-CTX TE-NA-RL
E51 E52 E53 E54 E55 E56 E57 E58 E59 E60 E61 E62 E63 E64 E65 SM SE
sul1, sul2, tetA sul1, sul2, tetA tet A sul1, sul2, tetB sul1, tetB sul1, sul2, tetA sul1, tetA sul1, tetB sul1 sul1, tetB sul1, tetA sul1, sul2 tetB sul1, tetA — sul2, tetA, tetD sul2, tetA
Other genes I I I I I I I II I I I I I, II I II I, II I
Integron3 — qacEΔ1-sul1 — qacEΔ1-sul1 — qacEΔ1-sul1 — — qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1-sul1 qacEΔ1 — qacEΔ1 qacEΔ1 qacEΔ1
3′CS4
Cassette arrays6 aadA1b+dfrA1a dfrA17a3 aadA1b2+aadA2b6 aadA2b4+dfrA12a2 dfrA7a1+aadA1b2 dfrA1a+aadA1b estX+aadA1b dfrA12a2+aadA2b4 dfrA12a2+aadA2b4 dfrA1a+aadA1b dfrA1a+aadA1b dfrA1a+sat2+aadA1b dfrA1a+sat2+aadA1b aadA1+dfrA1, dfrA12+sat2+aadA1
1,600, 500 1,600 NC 1,600 2,000 2,000, 1,600 1,600 2,300 2,000 2,000 1,600 1,600, 1,000 I/NC, II/2,300 NC 2,300 I/1,600, II/2,000 NC
2TE,
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
E. coli; SM, Salmonella malmoe; SE, Salmonella enteritidis. tetracycline; NA, nalidixic acid; RL, sulfamethoxazole; K, kanamycin; N, neomycin; AM, ampicillin; C, chloroamphenicol; CIP, ciprofloxacin; SXT, sulfamethoxazole-trimethoprim; GM, gentamicin; AMC, amoxicilline-clavulanic acid. 3I, class 1 integron; II, class 2 integron. 43′CS, 3′ conserved segment. 5NC, no cassette. 6Gene cassettes obtained by sequencing: a, 99% similarity with GenBank accession number AAM77080.1, except for E47, E29, E48, E44, and E13; a1, 99% similarity with GenBank accession number YP003108349; a2, 99% similarity with GenBank accession number CCC_201015.1; a3, 99% similarity with GenBank accession number AFK79052; b, 99% similarity with GenBank accession number ACI43574.1; b1, 99% similarity with GenBank accession number ABP35560.1; b2, 99% similarity with GenBank accession number ABX75126.2; b4, 96 to 100% similarity with GenBank accession number CCC201015.1; b5, 99% similarity with GenBank accession number CAP69687.1, b6, >91% similarity with GenBank accession number CAG342231; b7, >94% similarity with GenBank accession number ACJ47203.1.
1E,
Resistance pattern2
Name1
Cassette amplicon5 (bp)
Table 3 (Continued). Description of integrons harboring Escherichia coli and Salmonella isolates and characterization of the associated gene cassettes
INTEGRONS AND THEIR CASSETTES
3041
3042
Dessie et al.
ACI43574.1) and in E. coli isolated from turkey in the United States (GenBank accession no. ABP35560.1), respectively, had mutations at different positions showing substitutions of around 20 amino acids. Similarly, the aadA2, dfrA1, and sat2 genes with sequence identity below 95% to a cassette in GenBank also showed mutations at different codons. This suggests that gene cassettes are becoming more diverse and evolutionarily diverging from their previous ancestors. Of all the E. coli isolates that had integrons, 9 isolates (13.8%) did not carry gene cassettes, the so-called empty integrons. This situation also has been described previously by Fonseca et al. (2005) pointing out that these bacteria can have the potential in the future to convert themselves rapidly into multidrug-resistant strains. However, on the contrary, the integrons might have previously removed the acquired resistance gene cassettes through excision for unknown reasons. The high incidence of multidrug-resistance in E. coli and Salmonella isolates in poultry feces and carcasses is of special interest, especially in terms of human health. Most of these resistant isolates carry integrons containing resistant gene cassettes. Thus, it is crucial to track the evolution of multidrug-resistant isolates in poultry and to analyze the implications for humans. Surveillance of integron content in E. coli and Salmonella populations can provide useful information concerning the evolutionary changes of gene cassettes, which may be fundamental in estimating the health risk and preventing the spread of particular antibiotic resistance determinants from animals to humans.
REFERENCES Antunes, P., J. Machado, J. C. Sousa, and L. Peixe. 2005. Dissemination of sulfonamide resistance genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica strains and relation with integrons. Antimicrob. Agents Chemother. 49:836–839. Antunes, P., C. Réu, J. C. Sousa, L. Peixe, and N. Pestana. 2003. Incidence of Salmonella from poultry products and their susceptibility to antimicrobial agents. Int. J. Food Microbiol. 82:97–103. Bauer, A. W., W. M. Kirby, J. C. Sherris, and M. Turck. 1966. Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 45:493–496. Carattoli, A. 2003. Plasmid-mediated antimicrobial resistance in Salmonella enterica. Curr. Issues Mol. Biol. 5:113–122. Clinical and Laboratory Standards Institute (CLSI). 2011. Performance standard for antimicrobial susceptibility test. Twenty first information supplement CLSI Document M100–S21: vol. 31, no. 1. Clinical and Laboratory Standards Institute, Wayne, PA. De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L. Toti. 2003. Evaluation of DNA extraction methods for use in combination with SYBR green I real-time PCR to detect Salmonella enterica serotype enteritidis in poultry. Appl. Environ. Microbiol. 69:3456–3461. Enne, V. I., D. M. Livermore, P. Stephens, and L. M. Hall. 2001. Persistence of sulphonamide resistance in Escherichia coli in the UK despite national prescribing restriction. Lancet 357:1325– 1328. Fluit, A. C. 2005. Towards more virulent and antibiotic-resistant Salmonella? FEMS Immunol. Med. Microbiol. 43:1–11. Fonseca, E. L., V. V. Vieira, R. Cipriano, and A. C. Vicente. 2005. Class 1 integrons in Pseudomonas aeruginosa isolates from clinical settings in Amazon region, Brazil. FEMS Immunol. Med. Microbiol. 44:303–309.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
well as 63.6% in Salmonella isolates, is exceptionally prominent and should be considered as a serious health threat in view of the fact that multidrug-resistant isolates may have a chance to contaminate food products and consequently transfer to humans. The highest tetracycline resistance phenotypes observed in the E. coli isolates were linked to the presence of the tetA gene (63.2%) and considered to be the gene commonly identified followed by tetB (34.5%) in the E. coli isolates. They are among the most widespread tet genes found in Enterobacteriaceae and their occurrence was within the range reported by other investigators (Lanz et al., 2003). Because sul1 is usually associated with transposons and integrons as part of the 3′ conserved structure, it was commonly identified in our E. coli isolates in agreement with earlier studies that reported sul1 and sul2 to be common among bacteria from the Enterobacteriaceae family (Antunes et al., 2003). However, the sul2 gene was exclusively the mechanism of resistance to sulfonamides in the Salmonella isolates, corresponding to the lower detection of integrons in the Salmonella isolates, which disagrees with the findings of Antunes et al. (2005) reporting that sul1 was the mechanism of resistance in Salmonella isolates. The total incidence of integrons at 70.7% was higher than the integrons detected in clinical E. coli isolates in previous reports at 54.6% in Korea (Yu et al., 2004), but lower when compared with a report on E. coli isolated from clinical patients in China (Hsu et al., 2006) and E. coli isolated from animals in Ireland (Karczmarczyk et al., 2011). Similar to previous reports (van Essen-Zandbergen et al., 2007; Soufi et al., 2009; Vinué et al., 2010), class 1 integrons (59.6%) were the most frequent type of integrons detected in this study followed by the detection of class 2 integrons (11.1%) in E. coli, and the lower detection of integrons in Salmonella isolates is in accordance with the finding of van Essen-Zandbergen et al. (2007). We confirmed the predominance of gene cassettes conferring resistance to streptomycin and to spectinomycin (aadA), trimethoprim (dfrA), and streptothricin (sat1, sat2, and estX) carried by class 1 and class 2 integron harboring E. coli isolates. The persistence of these genes, which have been reported worldwide in isolates from different origins, might be associated with the extensive use of streptomycin/spectinomycin, trimethoprimes, sulfonamides, and other antibiotics in food-producing animals. There is no definitive link between the dfrA genes and the use of SMT/sulfamethoxazole-trimethprim in farms. Each of the intgrons with dfrA genes also had an aadA1 and most had a sul1 gene; thus, coselection of integrons with either streptomycin or sulfonamides may have contributed to SMT/ sulfamethoxazole-trimethoprim resistances as well. The aadA1 gene cassettes from the first and second groups that had 90 and 62% homologous sequence identities to a gene cassette found in E. coli isolated from bovine mastitis in China (GenBank accession no.
INTEGRONS AND THEIR CASSETTES
ria from Chilean salmon farms. Antimicrob. Agents Chemother. 47:883–888. Phillips, I., M. Casewell, T. Cox, B. De Groot, C. Friis, R. Jones, C. Nightingale, R. Preston, and J. Waddell. 2004. Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J. Antimicrob. Chemother. 53:28–52. Sandvang, D., F. M. Aarestrup, and L. B. Jensen. 1998. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104. FEMS Microbiol. Lett. 160:37–41. Sengeløv, G., Y. Agersø, B. Halling-Sørensen, S. B. Baloda, J. S. Andersen, and L. B. Jensen. 2003. Bacterial antibiotic resistance levels in Danish farmland as a result of treatment with pig manure slurry. Environ. Int. 28:587–595. Soufi, L., M. S. Abbassi, Y. Sáenz, L. Vinué, S. Somalo, M. Zarazaga, A. Abbas, R. Dbaya, L. Khanfir, A. Ben Hassen, S. Hammami, and C. Torres. 2009. Prevalence and diversity of integrons and associated resistance genes in Escherichia coli isolates from poultry meat in Tunisia. Foodborne Pathog. Dis. 6:1067–1073. van Essen-Zandbergen, A., H. Smith, K. Veldman, and D. Mevius. 2007. Occurrence and characteristics of class 1, 2 and 3 integrons in Escherichia coli, Salmonella and Campylobacter spp. in the Netherlands. J. Antimicrob. Chemother. 59:746–750. Vinué, L., Y. Sáenz, B. Rojo-Bezares, I. Olarte, E. Undabeitia, S. Somalo, M. Zarazaga, and C. Torres. 2010. Genetic environment of sul genes and characterisation of integrons in Escherichia coli isolates of blood origin in a Spanish hospital. Int. J. Antimicrob. Agents 35:492–496. White, D. G., S. Zhao, R. Sudler, S. Ayers, S. Friedman, S. Chen, P. F. McDermott, S. McDermott, D. D. Wagner, and J. Meng. 2001. The isolation of antibiotic-resistant Salmonella from retail ground meats. N. Engl. J. Med. 345:1147–1154. Wright, G. D. 2010. Antibiotic resistance in the environment: A link to the clinic? Curr. Opin. Microbiol. 13:589–594. Yu, H. S., J. C. Lee, H. Y. Kang, Y. S. Jeong, E. Y. Lee, C. H. Choi, S. H. Tae, Y. C. Lee, S. Y. Seol, and D. T. Cho. 2004. Prevalence of dfr genes associated with integrons and dissemination of dfrA17 among urinary isolates of Escherichia coli in Korea. J. Antimicrob. Chemother. 53:445–450. Zhao, J., and T. Aoki. 1992. Nucleotide sequence analysis of the class G tetracycline resistance determinant from Vibrio anguillarum. Microbiol. Immunol. 36:1051–1060.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Hall, R. M., and C. M. Collis. 1995. Mobile gene cassettes and integrons: Capture and spread of genes by site-specific recombination. Mol. Microbiol. 15:593–600. Hsu, S. C., T. H. Chiu, J. C. Pang, C. H. Hsuan-Yuan, G. N. Chang, and H. Y. Tsen. 2006. Characterisation of antimicrobial resistance patterns and class 1 integrons among Escherichia coli and Salmonella enterica serovar Choleraesuis strains isolated from humans and swine in Taiwan. Int. J. Antimicrob. Agents 27:383– 391. Karczmarczyk, M., Y. Abbott, C. Walsh, N. Leonard, and S. Fanning. 2011. Characterization of multidrug-resistant Escherichia coli isolates from animals presenting at a university veterinary hospital. Appl. Environ. Microbiol. 77:7104–7112. Kerrn, M. B., T. Klemmensen, N. Frimodt-Møller, and F. Espersen. 2002. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 50:513–516. Kim, A., Y. J. Lee, M. S. Kang, S. I. Kwag, and J. K. Cho. 2007. Dissemination and tracking of Salmonella spp. in integrated broiler operation. J. Vet. Sci. 8:155–161. Korea Food and Drug Administration (KFDA). 2006. Annual Report of National Antimicrobial Resistance Management 3:297– 313. (NARMP). Korea Food and Drug Administration, Seoul, Korea. Lanz, R., P. Kuhnert, and P. Boerlin. 2003. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. Microbiol. 91:73–84. Lévesque, C., L. Piché, C. Larose, and P. H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185–191. Levy, S. B., L. M. McMurry, T. M. Barbosa, V. Burdett, P. Courvalin, W. Hillen, M. C. Roberts, J. I. Rood, and D. E. Taylor. 1999. Nomenclature for new tetracycline resistance determinants. Antimicrob. Agents Chemother. 43:1523–1524. Lupo, A., S. Coyne, and T. U. Berendonk. 2012. Origin and evolution of antibiotic resistance: The common mechanisms of emergence and spread in water bodies. Front. Microbiol. 3:18. http://dx.doi.org/10.3389/fmicb.2012.00018. Michalova, E., P. Novotna, and J. Schelegelova. 2004. Tetracycline in veterinary medicine and bacterial resistance to them. Vet. Med. Czech. 49:79–100. Miranda, C. D., C. Kehrenberg, C. Ulep, S. Schwarz, and M. C. Roberts. 2003. Diversity of tetracycline resistance genes in bacte-
3043