- Email: [email protected]
Characterization of late gene expression factor LEF-10 from Bombyx mori nucleopolyhedrovirus
Virus Research 175 (2013) 45–51
Contents lists available at SciVerse ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Characterization of late gene expression factor LEF-10 from Bombyx mori nucleopolyhedrovirus Wei Yu a,b,∗ , Chao-Yi Du a,b , Yan-Ping Quan a,b , Zuo-Ming Nie a,b , Jian Chen a,b , Zheng-Bing Lv a,b , Yao-Zhou Zhang a,b a b
Institute of Biochemistry, College of Life Sciences, Zhejiang Sci-Tech University, Zhejiang Province, Hangzhou 310018, China Zhejiang Provincial Key Laboratory of Silkworm Bioreactor and Biomedicine, Zhejiang Province, Hangzhou 310018, China
a r t i c l e
i n f o
Article history: Received 1 February 2013 Received in revised form 26 March 2013 Accepted 26 March 2013 Available online 17 April 2013 Keywords: BmNPV lef-10 Gene knockout Replication Transcription Expression
a b s t r a c t The LEF-10 expression factor from the Bombyx mori nuclear polyhedrosis virus (BmNPV) does not have significant homology with other late expression factors and is thought to be a transcriptional cofactor. To investigate the function of LEF-10, a Red recombination system was used to knock out the lef-10 gene from the BmNPV genome and a lef-10 gene knockout virus (ko-Bacmid) was constructed. The lef-10 gene was repaired back to the viral genome using a Bac-to-Bac system to create the repaired virus (re-Bacmid). When ko-Bacmid was transfected into BmN cells, the detected titer of progeny virus in the medium was zero, whereas the titer of the progeny re-Bacmid remained at a level similar to that of the wild type virus (wt-Bacmid). The viral DNA replication, transcription and expression of viral early, late and very late genes after ko-Bacmid transfection into BmN cells were evaluated. The quantitative polymerase chain reaction showed that the ko-Bacmid viral genome replication level remained low and that the ko-Bacmid viral gene transcription level was significantly lower than those of wt-Bacmid and re-Bacmid. No expression of the early gene lef-3 was detected. These results suggest that the lef-10 gene has significant effects on DNA replication of the viral genome and BmNPV gene transcription at each phase and deletion of the lef-10 gene affects the level of expression of the viral early gene directly. © 2013 Elsevier B.V. All rights reserved.
1. Introduction The Bombyx mori nuclear polyhedrosis virus (BmNPV), which belongs to the Baculoviridae branch and was the first virus found in insects, causes diseases that severely impair sericulture efforts (Ponnuvel et al., 2003). Highly ordered DNA replication and transcription of the viral genome occurs after the virus infects insect cells. Early gene expression products can regulate the transcription and expression of late and very late genes directly or indirectly (Glocker et al., 1993; Berretta et al., 2013). The lefs gene encodes late expression factors but it is actually an early expression gene. Owing to the important regulatory function of the lefs gene in the expression of many late genes and very late genes, it is termed a late expression factor (LEF) (Todd et al., 1995; Rapp et al., 1998). Study of the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) research has identified 19 LEFs, at least 10 of which (lef-1, -2, -3, -7 and -11, ie-1 and -2, p143, DNApol and p35) are associated with viral DNA replication (Kool et al., 1994; Lin and
∗ Corresponding author at: Institute of Biochemistry, College of Life Sciences, Zhejiang Sci-Tech University, Xiasha High-Tech Zone, No. 2 Road, Hangzhou 310018, China. Tel.: +86 571 86843190; fax: +86 571 86843190. E-mail addresses: [email protected], [email protected] (W. Yu). 0168-1702/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.virusres.2013.03.022
Blissard, 2002a). It has been determined that lef-2, -3, and -11, ie-1, DNApol and p143 are essential during DNA replication of the viral genome (Bideshi and Federici, 2000; Knebel-Mörsdorf et al., 2006; Stewart et al., 2005; Vanarsdall et al., 2005; Wu et al., 2010; Yu and Carstens, 2010). Deletion of lef-7, p35 and ie-2 reduces the level of genome DNA, indicating that the products of these three genes might activate DNA replication. However, nine genes (lef-4, -5, -6, -8, -9, -10 and -12, p47 and pp31) are suggested to be associated with the transcription of late genes (Lu and Miller, 1995; Blissard and Rohrmann, 1990). It has been suggested that the protein complex encoded by lef-4, -8 and -9 and p47 can activate transcription of the polyhedrosis gene promoter in vitro (Guarino et al., 1998); LEF-6 and PP31 do not affect virus replication but can promote late gene transcription (Lin and Blissard, 2002b; Yamagishi et al., 2007); and LEF-5 has no significant effect on viral genome replication but is essential for virus replication and affects late gene transcription significantly (Su et al., 2011). The locations of the 18 lef genes within the BmNPV genome were determined by Gomi et al. (1997, 1999), who suggested that they are similar to those of AcMNPV. The amino acid sequences of the encoded LEF proteins have 73–98% homology. The lef-10 gene, which is located at positions 40,206–40,442 of the BmNPV genome, has a length of 237 bp and encodes 78 amino acids. lef-10 does not have significant homology with other LEFs and is thought to be
46
W. Yu et al. / Virus Research 175 (2013) 45–51
a cofactor during transcription (Hefferon, 2004). To further investigate the function of LEF-10 in viral genome replication as well as gene transcription and expression within BmNPV, lef-10 was deleted from the BmNPV genome using the Red recombination system to create a lef-10 knockout virus. A repair virus was constructed using a Bac-to-Bac system and transfected BmN cells using both viruses to study the function of lef-10 in regulating viral replication as well as transcription and expression in different phases.
2. Materials and methods 2.1. Materials Escherichia coli strains TG1, BW25113 (contains plasmid pKD46 and can express Red recombinase) and DH10Bac, and plasmid pKD3 (contains the anti-chloromycetin gene cat) and pFastBac1 are maintained in our laboratory. Liquid SOC medium was obtained from Biocolor BioScience & Technology Company (Shanghai, China); Sf900 medium and fetal bovine serum were purchased from Gibco (Grand Island, NY, USA). A DNA ladder marker, T4 ligation and restriction endonucleases BamHI and EcoRI were obtained from Takara. l-Arabinose, a gel Recovery Kit and a RevertAid First-Strand cDNA Synthesis Kit were purchased from Promega (Madison, WI, USA). The Taq enzyme and related polymerase chain reaction (PCR) agents were obtained from TransGen Biotech (Beijing, China). KOD plus high-fidelity enzyme and related PCR reagents were purchased from TOYOBO Co., Ltd. (Ohtsu, Japan). An enhanced chemiluminescence detection system was obtained from Amersham Pharmacia Biotech (Piscataway, NY, USA). The specific primers were synthesized by Shanghai Sunny Biotechnology Co., Ltd. (Shanghai, China). LEF-10 and LEF-3 monoclonal antibodies were purchased from Abmart Inc. (Shanghai, China). All reagents were of analytically pure grade.
2.2. DH10bac harvest using plasmid pKD46 Plasmid pKD46 was extracted from E. coli strain BW25113. Competent DH10Bac cells were prepared using CaCl2 and then transformed with 1 L of plasmid pKD46 DNA and spread onto LB medium containing ampicillin (80 g/mL) and kanamycin (50 g/mL) and incubated at 37 ◦ C for 12 h.
2.3. lef-10 gene targeting linear fragment preparation On the basis of the BmNPV lef-10 gene sequence (GenBank accession no. 1488674), the PCR primers were designed to amplify the lef-10 gene targeting linear fragment. The pair of primers: lef10-C1: 5 -GCCCTGGACATTGAACTCGATTTTAGGAATTTTTTTAAAATGCAATCATGTAAGTGTAGGCTGGAGCTGCTTC-3 , lef10-C2: 5 AAATAAATTATCTTTCAGTACACAATTGATGAGGTTGACGTCCGTCGCGGATGGGAATTAGCCATGGTCC-3 , comprise the 50 bp homologous arm of lef-10 (underlined) and the 20 bp cat homologous domain, respectively, and the box marks the artificially introduced termination codon. The PCR reaction amplified the targeting linear fragment using pKD3 as the template and the reaction volume was 50 L. The amplification program was: pre-denaturation at 94 ◦ C for 3 min then 30 cycles of denaturation at 94 ◦ C for 30 s, annealing at 60 ◦ C for 30 s, elongation at 72 ◦ C for 90 s and, finally, an elongation step at 72 ◦ C for 10 min. The PCR products were separated by electrophoresis through 1% (w/v) agar gel. The linear DNA fragments were purified with the Gel Recovery Kit then dissolved in 30 L of ultrapure water and stored frozen at −20 ◦ C.
Fig. 1. Strategy for building the lef-10 knockout virus lef10-ko-Bacmid. (A) pKD3 chosen as the template and lef10-C1 and lef10-C2 as primers; amplify the cat genetargeting fragment using the polymerase chain reaction (PCR). (B) Location of the lef10 gene in the wild type BmNPV genome. (C) Homologous recombination between the linear fragment and the lef-10 gene, which can be replaced by the cat gene.
2.4. lef10-ko-Bacmid construction and confirmation 2.4.1. Strategy The prepared linear fragment was transformed into DH10Baccompetent cells using pKD46; after the induction by l-arabinose, Red recombinase induces homologous recombination between lef10 and the linear fragments. lef10-ko-Bacmid was then harvested by selecting the recombined bacteria on a plate with ampicillin and kanamycin. Fig. 1 shows the construction map. 2.4.2. Construction of lef-10-ko-Bacmid Randomly picked pKD46 plasmids containing DH10Bac colonies were cultured at 30 ◦ C with shaking overnight and then inoculated at the ratio of 1:100 (v/v) into liquid LB medium containing ampicillin (80 g/mL) and kanamycin (50 g/mL). The bacteria were cultured at 37 ◦ C until the absorbance at 600 nm (A600 ) was 0.15–0.2 and 200 L of l-arabinose (2 mmol/mL) was added. Bacteria were harvested by low-speed centrifugation after culture for 1–1.5 h at 37 ◦ C. Competent cells (200 L) were prepared using CaCl2 (0.05 mol/L), to which 15 L of the linear fragment prepared above was added. The mixture was incubated on ice for 30 min, heat-shocked at 42 ◦ C for 90 s, mixed with 1 mL of SOC medium immediately afterward, incubated with shaking at 30 ◦ C for 3 h, and spread onto solid LB medium containing ampicillin (80 g/mL), and kanamycin (50 g/mL). After induction by l-arabinose in the presence of Red recombinase, homologous recombination occurred between the linear fragment and lef-10, after which the recombined bacteria were selected on a plate containing chloromycetin (34 g/mL) and kanamycin (50 g/mL). 2.4.3. PCR confirmation of lef10-ko-Bacmid Randomly chosen anti-chloromycetin and anti-kanamycin colonies were cultured at 37 ◦ C and recombined. Bacmid DNA was extracted by the alkaline lysis method. Different PCR primer pairs were used to confirm lef-10 gene knockout. The upstream and downstream primers of lef-10 were: lef-10F, 5 -AAAGATTATTGGCCAACGTG-3 , lef-10R, 5 AACATGTCGTTTTCGTTATCGG-3 . The primer pair inside the cat gene was: 5 -CACGTTTAAATCAAAACTGGTG-3 , catR, 5 catF, CAATATGGACAACTTCTTCG-3 . Different combinations of primers included lef-10F – catR, lef-10F – lef-10R and lef-10R – catF. All of the PCR reactions introduced control PCR which used wt-Bacmid DNA as a template. Finally, ko-Bacmid DNA of the confirmed knockout virus was used as a template and PCR amplified with
W. Yu et al. / Virus Research 175 (2013) 45–51
47
growth phase were inoculated into 96-well plates (103 cells/well) and incubated at 27 ◦ C overnight. The collected viral supernatants were 10-fold serial diluted from 10−1 to 10−9 . A total of 10 L of viral supernatant was inoculated in each well of the plate, and each serial dilution was inoculated into six wells. Non-infected BmN cells were used as a negative control. After incubation at 27 ◦ C for 5 days, cell infections of both the negative control and the serial dilutions at each level were recorded, and each experiment was done in triplicate. Protection endpoints of 50% (TCID50 ) were calculated as described (Krah, 1991). 2.7. Quantitative PCR (qPCR) analysis of the viral genome replication
Fig. 2. Construction map of the wtBacmid, lef10-ko-Bacmid and lef10-re-Bacmid viruses.
lef-10F and lef-10R as primers. The PCR products were cloned to plasmid pMD18-T Simple Vector and then sequenced for verification. Successfully recombined Bacmid viruses were named lef10-ko-Bacmid. 2.5. lef-10 repair virus construction and confirmation 2.5.1. Strategy The intention was to use the constructed recombinant transfer vector plasmid pFastbac1-lef10 (with lef10 upstream promoter 134 bp + lef10 237 bp) to transform the E. coli competent cells with lef-10-ko Bacmid. Using the Bac-to-Bac system, knockout lef-10 can be repaired into the viral genome to create the repair virus lef10-re-Bacmid (Fig. 2). 2.5.2. PCR confirmation of lef-10 repaired virus lef10-re-Bacmid On the basis of the lef-10 sequence, we designed the upstream primer P1 forward: 5 -CGGGATCCTGCTTCGAGAAACCAAAG-3 where the BamHI restriction site is underlined and the downstream primer P2 reverse: 5 -CGGAATTCTTACGTGGACGCGTTACT-3 where the EcoRI restriction site is underlined. PCR amplification used the wt-Bacmid genome as a template. The reaction program was: pre-denaturation at 94 ◦ C for 3 min then 30 cycles of denaturation at 94 ◦ C for 30 s, annealing at 60 ◦ C for 30 s, elongation at 72 ◦ C for 30 s and a final elongation step at 72 ◦ C for 10 min. The PCR products and pFastbac1 plasmid were recovered and digested by BamHI and EcoRI, and the digestion products were recovered and ligated by T4 ligation overnight. Recombinant transfer vector pFastbac1-lef10 was constructed to transform the E. coli TG1 competent cells and positive clones were chosen. E. coli with lef10-ko-Bacmid was transformed with successfully confirmed transfer plasmids pFastbac1-lef10 and spread onto solid LB medium with X-gal (100 g/mL), IPTG (40 g/mL), tetracycline (10 g/mL), kanamycin (50 g/mL), gentamicin (7 g/mL) and chloromycetin (34 g/mL). M13 primers and lef-10 gene-specific primers were used for the PCR confirmation. 2.6. Virus titer detection BmN cells were transfected with 1 g of wtBacmid DNA, 1 g of lef10-ko-Bacmid DNA and 1 g of lef10-re-Bacmid DNA, and the supernatant of the virus-infected cells was collected after 5 days for virus titer detection. First, BmN cells in the logarithmic
BmN cells (1 × 106 mL−1 ) were transfected with 1 g of lef10ko-Bacmid, 1 g of lef10-re-Bacmid and 1 g of wtBacmid genome DNA. The viral genome was extracted at 12, 24, 48, 72 and 96 h. DpnI was chosen because it is a methylation-dependent restriction endonuclease that can specifically recognize methylated sites to remove exogenous Bacmid DNA introduced during transfection, whereas the progeny virus DNA replicating within the BmN cells would not be enzymolyzed (Lu et al., 2002). Thus, after the entire DNA at each phase had been extracted and digested by DpnI, qPCR was done using specific primers for the Bmgp41 gene from the BmNPV genome, which encodes the envelope protein (Olszewski and Miller, 1997), and Bm-actin was used as an internal reference to correct sample volume errors. Each experiment was done in triplicate. Primer Premier 5.0 software was used to design fluorescent qPCR primers for Bmgp41and Bm-actin. The upstream primer for Bmgp41 amplification was: gp41F 5 CGTAGTGGTAGTAATCGCCGC-3 and the downstream primer was: gp41R 5 -AGTCGAGTCGCGTCGCTTT-3 The upstream primer for Bm-actin amplification was: -actinF 5 -GCGCGGCTACTCGTTCACTACC-3 and the downstream primer was: -actinR 5 -TGCCGCAAGCTTCCATACCC-3 . The PCR program was: pre-denaturation at 95 ◦ C for 10 min, then 40 cycles of denaturation at 95 ◦ C for 10 s, annealing at 50 ◦ C for 10 s, and a final elongation step at 72 ◦ C for 12 s. The melting curve program was: 95 ◦ C for 5 s, 65 ◦ C for 1 min, 95 ◦ C for 15 s. 2.8. qPCR analysis of the viral gene transcription at different phases BmN cells (1 × 106 mL−1 ) were transfected with 1 g of lef10ko-Bacmid, 1 g of lef10-re-Bacmid and 1 g of wtBacmid and then harvested at 12, 24, 48 and 72 h. DNaseI was used to remove genomic DNA during the extraction of whole RNA. A RevertAid First-Strand cDNA Synthesis Kit was used to reverse transcribe the entire RNA to cDNA for fluorescence qPCR; the primers were specific sequences of early gene Bmlef-3, late gene Bmvp39 and very late gene Bmp10 from the BmNPV genome. Bm-actin was used as the internal reference to correct the sample volume errors and each experiment was done in triplicate. The upstream primer for Bmlef-3 amplification was: lef3F 5 -TCGGATGACCGTTCTACCTCTT-3 and the downstream primer was: lef3R 5 -CTTCCAGCAGCATTGAGATTTG-3 . The upstream primer for Bmvp39 amplification was: vp39F 5 -AGACACCACAAACCCGAACAC-3 and the downstream primer was: vp39R 5 -TTGATCGCCAACACCACCT-3 . The upstream primer for Bmp10 amplification was: p10F 5 -GACACGAATTTTAGACGCCATT-3 and the downstream primer was: p10R 5 -CGATTCTTCCAGCCCGTTT3 . The primers for Bm-actin amplification were the same as those described in Section 1.7, above. The PCR program was:
48
W. Yu et al. / Virus Research 175 (2013) 45–51
Fig. 3. Polymerase chain reaction (PCR) confirmation of knockout virus lef10-koBacmid. Lane M, DNA mass marker; 1–4, PCR products after use of lef10F and catR as primers; 5–8, PCR products after use of lef10R and catF as primers; 9–12, PCR products after use of lef10F and lef10R as primers. Lanes 1–3, 5–7 and 9–11 used lef10-ko-Bacmid DNA as the template. Lanes 4, 8 and 12 used wtBacmid DNA as the template.
pre-denaturation at 95 ◦ C for 10 min then 40 cycles of denaturation at 95 ◦ C for 10 s, annealing at 50 ◦ C for 10 s and a final elongation step at 72 ◦ C for 12 s. The melting curve program was: 95 ◦ C for 5 s, 65 ◦ C for 1 min, 95 ◦ C for 15 s.
2.9. Immunoblotting BmN cells (1 × 106 ) were transfected with 1 g of lef10-koBacmid or 1 g of lef10-re-Bacmid and collected 24, 48, 72 and 96 h post transfection. The cells were lysed by sonication followed by sodium dodecyl sulfate/polyacrylamide gel electrophoresis. The proteins were transferred from the gel onto a polyvinylidene fluoride membrane. A mixture of anti-mouse monoclonal antibodies LEF-10 or LEF-3 was used as the primary antibody. Goat-antimouse immunoglobulin G-horseradish peroxidase was used as a secondary antibody for western blot analysis.
2.10. Data analysis Data were analyzed using one-way analysis of variance (ANOVA) and the results are expressed as mean ± SEM. If a statistically significant effect was found, Newman–Keuls test was used to isolate the difference between the groups. The level of statistically significant difference was set at P ≤0.05.
Fig. 4. Polymerase chain reaction (PCR) confirmation of the repair virus lef10-reBacmid. Lane M, DNA marker; 1, PCR products after the use of M13F and M13R as primers; 2, PCR products after the use of M13F and P2 as primers; 3, PCR products after the use of M13R and P1 as primers; 4, PCR products after the use of P1 and P2 as primers.
3.2. Repaired virus lef10-re-Bacmid confirmation E. coli competent cells with lef10-ko-Bacmid were transfected with recombinant transfer vector pFastBac1-lef10. Positive clones were selected and the plasmids were extracted from the picked white patches. The M13 primers were used for PCR to confirm the repair virus lef10-re-Bacmid. M13 F–M13 R, M13 F–P2, M13R–P1 and P1–P2 were used as PCR primer pairs to confirm the construction of the repair virus lef10-re-Bacmid. When PCR used M13F and M13R primers, the products should be 2801 bp long (2430 bp + exogenously inserted fragment 371 bp); for M13F and P2 primers, the products should be 2021 bp long (1650 bp + 371 bp); for M13R and P1 primers, the products should be 974 bp long (603 bp + 371 bp); and for P1 and P2 primers, the length of products should be the same as the exogenously inserted fragment (371 bp). Fig. 4 shows that the PCR product lengths were consistent with these theoretical values. 3.3. Effect of knockout lef-10 on viral genome replication The TCID50 method was used to detect virus titers of three different viruses (lef10-ko-Bacmid, lef10-re-Bacmid and wtBacmid) that were harvested from the supernatant of the cell culture after they transfected BmN cells at 24, 48, 72 and 96 h (Fig. 5). The TCID50 value
3. Results 3.1. Confirmation of knockout virus lef10-ko-Bacmid Three single colonies were chosen at random and cultured overnight in liquid LB medium containing chloromycetin and kanamycin. Bacmid DNA was extracted using the alkaline lysis method for PCR confirmation. If the PCR used knockout virus lef10ko-Bacmid DNA as template and primers lef-10F and catR, the products should be 625 bp long; when the primers were lef-10R and catF, the products should be 1028 bp long and when the PCR used wild type virus wtBacmid DNA as a template, there should be no specific band. When the PCR used lef-10F and lef-10R as primers and knockout virus lef10-ko-Bacmid DNA as a template, the products should be 1658 bp long; when wild type virus wtBacmid DNA was used as the template, the products should be 638 bp long. Fig. 3 shows that the lengths of the PCR products in each group were consistent with these theoretical values, indicating that lef-10 knockout virus lef10-ko-Bacmid was constructed successfully.
Fig. 5. Growth curve of lef10-ko-Bacmid, wtBacmid and lef10-re-Bacmid after BmN cell transfection.
W. Yu et al. / Virus Research 175 (2013) 45–51
of lef10-ko-Bacmid remained at zero, indicating that a virus with deleted lef-10 cannot generate an infectious budded virus (BV); i.e. lef10-ko-Bacmid lost the ability to generate BV. The amounts of BV generated by wtBacmid and lef10-re-Bacmid after transfection increased with time, suggesting that primarily transfected BV causes secondary infections. Fluorescence qPCR was used to further investigate the replication of these three viruses that transfect the BmN cells. A total of 1 g of purified wtBacmid DNA was diluted to 103 –109 copies and used as a template for fluorescence qPCR. A standard curve was constructed using the index of copy number as the abscissa and the Ct value as the ordinate. The lef10-ko-Bacmid, lef10-re-Bacmid and wtBacmid transfected BmN cells were collected at specific times and whole DNA was extracted and digested by DpnI for fluorescence qPCR analysis. The results showed Ct could be calculated in terms of absolute copies using the standard curve. Fig. 6 was drawn with the infection phases on the abscissa and the copy index of gp41 on the ordinate. The DNA copies of three viruses did not differ significantly at 12 h post transfection but, as time increased, the number of DNA copies of the wtBacmid and lef10-re-Bacmid viruses were significantly (P < 0.05) greater compared to lef-10 knockout lef10ko-Bacmid after 24 h post transfection. The amount of lef-10 repair virus and wild type virus DNA differed only slightly and the number of copies of lef10-ko-Bacmid was little changed. 3.4. Effects of knockout lef-10 on BmNPV gene transcription at different phases Fluorescence qPCR was used to analyze the transcription of early gene lef-3, late gene vp39 and very late gene p10 after the three viruses were transfected into BmN cells. Intracellular and extracellular RNA of these three viruses were collected at different time points and then reverse transcribed into cDNA for fluorescence
49
Fig. 6. Quantitative polymerase chain reaction (qPCR) analysis of virus copies after lef10-ko-Bacmid, lef10-re-Bacmid and wtBacmid transfected BmN cells. * P < 0.05 vs wtBacmid or lef10-re-Bacmid at 24, 48, and 72 h. Values are expressed as mean ± SEM. Similar results were obtained in three independent experiments.
qPCR using Bm-actin as an internal reference. Fig. 7 was drawn with transfection time on the abscissa and–Ct on the ordinate. The transcription levels of early, late and very late genes of lef10ko-Bacmid did not differ significantly at 24 h post transfection but the transcription levels of lef10-ko-Bacmid were significantly lower (P < 0.05) after 48 h compared to the other two viruses. The wild type and repair viruses had similar transcription levels at each phase, whereas the lef10-re-Bacmid had a slightly higher transcription level, except that the transcription level of early gene lef-3 of lef10-re-Bacmid was lower than that of wtBacmid after 72 h.
Fig. 7. Quantitative reverse transcription polymerase chain reaction (RT qPCR) analysis of viral gene transcription level after lef10-ko-Bacmid, lef10-re-Bacmid and wtBacmid transfection into BmN cells. (A) The variation of early gene lef-3 transcription level in BmNPV over time. (B) The variation of late gene vp39 transcription level in BmNPV over time. C, The variation of very late gene p10 transcription level in BmNPV over time. * P < 0.05 vs wtBacmid or lef10-re-Bacmid at 48 and 72 h. Values are expressed as mean ± SEM. Similar results were obtained in three independent experiments.
50
W. Yu et al. / Virus Research 175 (2013) 45–51
Fig. 8. Western blot analysis of lef-10 (A) and lef-3 (B) expression levels in the knockout virus lef10-ko-Bacmid and repair virus lef10-re-Bacmid. A, Expression analysis of lef-10. B, Expression analysis of lef-3. Lanes M, protein markers; 1, cell lysate of BmN transfected with lef10-ko-Bacmid DNA; 2, cell lysate of BmN transfected with lef10-reBacmid DNA; 3, cell lysate of non-infected BmN; 4–7, cell lysate of BmN transfected with lef10-ko-Bacmid DNA at 24, 48, 72 and 96 h; 8–11, cell lysate of BmN transfected with lef10-re-Bacmid DNA at 24, 48, 72 and 96 h; 12, cell lysis of non-infected BmN at 48 h.
3.5. Effects of knockout lef-10 on BmNPV gene expression BmN cells were transfected with the DNA of knockout virus lef10-ko-Bacmid and repair virus lef10-re-Bacmid and the cell lysates were collected for sodium dodecyl sulfate/polyacrylamide gel electrophoresis. Non-infected BmN cells were used as the negative controls and LEF-10 and LEF-3 monoclonal antibodies were used for western blotting (Fig. 8). Cells transfected with lef10-koBacmid and non-infected cells had no obvious hybridization band, whereas cells transfected with lef10-re-Bacmid had an obvious hybridization band at 10 kDa. This is consistent with the molecular mass of LEF-10, indicating no expression of the lef-10 gene in lef10-ko-Bacmid but it can be expressed after repair (Fig. 8A). Fig. 8B suggests that in the cell lysate of BmN transfected with knockout virus lef10-ko-Bacmid and non-infected BmN cells, there is no obvious expression of early gene lef-3, whereas the cell lysate of BmN transfected with repair virus lef10-re-Bacmid had an obvious hybridization band at 40 kDa. This is consistent with a molecular mass of LEF-3 and an expression level that increased with time. 4. Discussion Knocking out the lef gene from the Baculovirus genome is widely recognized as the most accurate and effective method for studying the function of lef (Poteete, 2001). In this study, the lef-10 gene in BmNPV was knocked out using the Red recombination system and the lef-10 gene-deleted virus lef10-ko-Bacmid was constructed. Because the ORF box of the lef-10 gene partially overlaps the upstream gene orf53 and the downstream gene vp1054, it was necessary to delete only 10 bp within the lef-10 gene to protect the complete gene sequence on both sides. The lef-10 gene was repaired back to the virus genome using the Bac-to-Bac system to construct the repair virus lef10-re-Bacmid. Because the Bac-to-Bac expression system uses the very late gene promoter of polyhedrosis to activate exogenous gene expression and lef-10 is an early gene, the lef-10 gene containing its own promoter was inserted into the viral genome to guarantee normal expression of the lef-10 gene during viral replication as well as viral infection vitality. Using the titer detection of the repair virus lef10-re-Bacmid, it was found that the infection ability of lef10-re-Bacmid recovered to the same level as the wild type virus, whereas the titer of the lef-10 knocked out virus remained at zero, indicating the deletion of lef-10 might have led to the loss of genome DNA replication or the secondary infection capability in the lef-10 knockout virus. To further investigate the effect of lef-10 deletion on viral genome DNA replication, BmN cells were transfected with two recombined viruses (lef10-ko-Bacmid and lef10-re-Bacmid) as well as wild type virus wtBacmid, whole DNA was collected at different time points, and fluorescence qPCR was used to analyze viral genome replication. The DNA replication level in the lef-10 knockout virus lef10-ko-Bacmid was significantly lower compared to the other two viruses, with the amount of DNA at 24 h posttranscription being half that of the other two viruses. Thus, we
suggest that the lef-10 gene has significant effects on viral genome replication. RT-qPCR was used to investigate the effects of lef-10 deletion on the transcription of viral early, late and very late genes. The viral early gene lef-3, late gene vp39 and very late gene p10 were chosen as research objects in this study and the results show that lef-10 deletion has significant effects on the transcription levels of the lef3, vp39 and p10 genes, particularly at 24 h post transfection, when the transfection level of the lef-10 knockout virus lef10-ko-Bacmid remained at a lower level. These results are consistent with the findings of earlier studies (Lu and Miller, 1994, 1995). Western blotting was used to analyze the effects of lef-10 deletion on the expression level of the viral early gene lef-3. It was found that lef-10 deletion significantly affected the expression of early gene lef-3 because LEF-3 protein was not be detected in BmN cells transfected with lef10-ko-Bacmid, whereas LEF-3 expression could be detected in BmN cells transfected with repair virus lef10re-Bacmid. LEF-3 is a single-chain DNA binding protein that is necessary for viral DNA replication (Li et al., 1993). The results of this study are consistent with early research on viral genome DNA replication, indicating LEF-10 might affect the DNA replication of viral genome directly or indirectly by regulating lef-3 transcription and expression. However, exactly how lef-10 regulates DNA replication of the viral genome remains to be explained. Acknowledgments This work was supported by the National High-tech R&D program (863 Program) (No. 2011AA100603), Major National Science and Technology project (No. 2012ZX09102301-009), Natural Science Foundation of Zhejiang Province (No. Y3090339) and National Natural Science Foundation of China (No. 31101831). References Berretta, M.F., López, M.G., Taboga, O., Sciocco-Cap, A., Romanowski, V., 2013. Functional analysis of Spodoptera frugiperda nucleopolyhedrovirus late expression factors in Sf9 cells. Virus Genes 46, 152–161. Bideshi, D.K., Federici, B.A., 2000. The Trichoplusia ni granulovirus helicase is unable to support replication of Autographa californica multicapsid nucleopolyhedrovirus in cells and larvae of T. ni. Journal of General Virology 81, 1593–1599. Blissard, G.W., Rohrmann, G.F., 1990. Baculovirus diversity and molecular biology. Annual Review of Entomology 35, 127–155. Guarino, L.A., Xu, B., Jin, J., Dong, W., 1998. A virus-encoded RNA polymerase purified from baculovirus-infected cells. Journal of Virology 72, 7985–7991. Glocker, B., Hoopes Jr., R.R., Hodges, L., Rohrmann, G.F., 1993. In vitro transcription from baculovirus late gene promoters: accurate mRNA initiation by nuclear extracts prepared from infected Spodoptera frugiperda cells. Journal of Virology 67, 3771–3776. Gomi, S., Zhou, C.E., Yih, W., Majima, K., Maeda, S., 1997. Deletion analysis of four of eighteen late gene expression factor gene homologues of the baculovirus, BmNPV. Virology 230, 35–47. Gomi, S., Majima, K., Maeda, S., 1999. Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. Journal of General Virology 80, 1323–1337. Hefferon, K.L., 2004. Baculovirus late expression factors. Journal of Molecular Microbiology and Biotechnology 7, 89–101. Krah, D.L., 1991. A simplified multiwell plate assay for the measurement of hepatitis A virus infectivity. Biologicals 19, 223–227. Knebel-Mörsdorf, D., Quadt, I., Li, Y., Montier, L., Guarino, L.A., 2006. Expression of baculovirus late and very late genes depends on LEF-4, a component of the
W. Yu et al. / Virus Research 175 (2013) 45–51 viral RNA polymerase whose guanyltransferase function is essential. Virology 80, 4168–4173. Kool, M., Ahrens, C.H., Goldbach, R.W., Rohrmann, G.F., Vlak, J.M., 1994. Identification of genes involved in DNA replication of the Autographa californica baculovirus. Proceedings of the National Academy of Sciences of the United States of America 91, 11212–11216. Li, Y., Passarelli, A.L., Miller, L.K., 1993. Identification, sequence, and transcriptional mapping of lef-3, a baculovirus gene involved in late and very late gene expression. Journal of Virology 67, 5260–5268. Lin, G., Blissard, G.W., 2002a. Analysis of an Autographa californica nucleopolyhedrovirus lef-11 knockout: LEF-11 is essential for viral DNA replication. Journal of Virology 76, 2770–2779. Lin, G., Blissard, G.W., 2002b. Analysis of an Autographa californica multicapsid nucleopolyhedrovirus lef-6-null virus: LEF-6 is not essential for viral replication but appears to accelerate late gene transcription. Journal of Virology 76, 5503–5514. Lu, A., Miller, L.K., 1995. The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. Journal of Virology 69, 975–982. Lu, A., Miller, L.K., 1994. Identification of three late expression factor genes within the 33.8- to 43.4-map-unit region of Autographa californica nuclear polyhedrosis virus. Journal of Virology 68, 6710–6718. Lu, L., Patel, H., Bissler, J.J., 2002. Optimizing DpnI digestion conditions to detect replicated DNA. Biotechniques 33, 316–318. Olszewski, J., Miller, L.K., 1997. A role for baculovirus GP41 in budded virus production. Virology 233, 292–301. Ponnuvel, K.M., Nakazawa, H., Furukawa, S., Asaoka, A., Ishibashi, J., Tanaka, H., Yamakawa, M., 2003. A lipase isolated from the silkworm Bombyx mori shows antiviral activity against nucleopolyhedrovirus. Journal of Virology 77, 10725–10729.
51
Poteete, A.R., 2001. What makes the bacteriophage lambda Red system useful for genetic engineering: molecular mechanism and biological function. FEMS Microbiology Letters 201, 9–14. Rapp, J.C., Wilson, J.A., Miller, L.K., 1998. Nineteen baculovirus open reading frames, including LEF-12, support late gene expression. Journal of Virology 72, 10197–10206. Stewart, T.M., Huijskens, I., Willis, L.G., Theilmann, D.A., 2005. The Autographa californica multiple nucleopolyhedrovirus ie0–ie1 gene complex is essential for wild-type virus replication, but either IE0 or IE1 can support virus growth. Journal of Virology 79, 4619–4629. Su, J., Lung, O., Blissard, G.W., 2011. The Autographa californica multiple nucleopolyhedrovirus lef-5 gene is required for productive infection. Virology 416, 54–64. Todd, J.W., Passarelli, A.L., Miller, L.K., 1995. Eighteen baculovirus genes, including lef-11, p35, 39 K, and p47, support late gene expression. Journal of Virology 69, 968–974. Vanarsdall, A.L., Okano, K., Rohrmann, G.F., 2005. Characterization of the replication of a baculovirus mutant lacking the DNA polymerase gene. Virology 331, 175–180. Wu, C.P., Huang, Y.J., Wang, J.Y., Wu, Y.L., Lo, H.R., Wang, J.C., Chao, Y.C., 2010. Autographa californica multiple nucleopolyhedrovirus LEF-2 is a capsid protein required for amplification but not initiation of viral DNA replication. Journal of Virology 84, 5015–5024. Yamagishi, J., Burnett, E.D., Harwood, S.H., Blissard, G.W., 2007. The AcMNPV pp31 gene is not essential for productive AcMNPV replication or late gene transcription but appears to increase levels of most viral transcripts. Virology 365, 34–47. Yu, M., Carstens, E.B., 2010. Identification of a domain of the baculovirus Autographa californica multiple nucleopolyhedrovirus single-strand DNA-binding protein LEF-3 essential for viral DNA replication. Journal of Virology 84, 6153–6162.
Contents lists available at SciVerse ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Characterization of late gene expression factor LEF-10 from Bombyx mori nucleopolyhedrovirus Wei Yu a,b,∗ , Chao-Yi Du a,b , Yan-Ping Quan a,b , Zuo-Ming Nie a,b , Jian Chen a,b , Zheng-Bing Lv a,b , Yao-Zhou Zhang a,b a b
Institute of Biochemistry, College of Life Sciences, Zhejiang Sci-Tech University, Zhejiang Province, Hangzhou 310018, China Zhejiang Provincial Key Laboratory of Silkworm Bioreactor and Biomedicine, Zhejiang Province, Hangzhou 310018, China
a r t i c l e
i n f o
Article history: Received 1 February 2013 Received in revised form 26 March 2013 Accepted 26 March 2013 Available online 17 April 2013 Keywords: BmNPV lef-10 Gene knockout Replication Transcription Expression
a b s t r a c t The LEF-10 expression factor from the Bombyx mori nuclear polyhedrosis virus (BmNPV) does not have significant homology with other late expression factors and is thought to be a transcriptional cofactor. To investigate the function of LEF-10, a Red recombination system was used to knock out the lef-10 gene from the BmNPV genome and a lef-10 gene knockout virus (ko-Bacmid) was constructed. The lef-10 gene was repaired back to the viral genome using a Bac-to-Bac system to create the repaired virus (re-Bacmid). When ko-Bacmid was transfected into BmN cells, the detected titer of progeny virus in the medium was zero, whereas the titer of the progeny re-Bacmid remained at a level similar to that of the wild type virus (wt-Bacmid). The viral DNA replication, transcription and expression of viral early, late and very late genes after ko-Bacmid transfection into BmN cells were evaluated. The quantitative polymerase chain reaction showed that the ko-Bacmid viral genome replication level remained low and that the ko-Bacmid viral gene transcription level was significantly lower than those of wt-Bacmid and re-Bacmid. No expression of the early gene lef-3 was detected. These results suggest that the lef-10 gene has significant effects on DNA replication of the viral genome and BmNPV gene transcription at each phase and deletion of the lef-10 gene affects the level of expression of the viral early gene directly. © 2013 Elsevier B.V. All rights reserved.
1. Introduction The Bombyx mori nuclear polyhedrosis virus (BmNPV), which belongs to the Baculoviridae branch and was the first virus found in insects, causes diseases that severely impair sericulture efforts (Ponnuvel et al., 2003). Highly ordered DNA replication and transcription of the viral genome occurs after the virus infects insect cells. Early gene expression products can regulate the transcription and expression of late and very late genes directly or indirectly (Glocker et al., 1993; Berretta et al., 2013). The lefs gene encodes late expression factors but it is actually an early expression gene. Owing to the important regulatory function of the lefs gene in the expression of many late genes and very late genes, it is termed a late expression factor (LEF) (Todd et al., 1995; Rapp et al., 1998). Study of the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) research has identified 19 LEFs, at least 10 of which (lef-1, -2, -3, -7 and -11, ie-1 and -2, p143, DNApol and p35) are associated with viral DNA replication (Kool et al., 1994; Lin and
∗ Corresponding author at: Institute of Biochemistry, College of Life Sciences, Zhejiang Sci-Tech University, Xiasha High-Tech Zone, No. 2 Road, Hangzhou 310018, China. Tel.: +86 571 86843190; fax: +86 571 86843190. E-mail addresses: [email protected], [email protected] (W. Yu). 0168-1702/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.virusres.2013.03.022
Blissard, 2002a). It has been determined that lef-2, -3, and -11, ie-1, DNApol and p143 are essential during DNA replication of the viral genome (Bideshi and Federici, 2000; Knebel-Mörsdorf et al., 2006; Stewart et al., 2005; Vanarsdall et al., 2005; Wu et al., 2010; Yu and Carstens, 2010). Deletion of lef-7, p35 and ie-2 reduces the level of genome DNA, indicating that the products of these three genes might activate DNA replication. However, nine genes (lef-4, -5, -6, -8, -9, -10 and -12, p47 and pp31) are suggested to be associated with the transcription of late genes (Lu and Miller, 1995; Blissard and Rohrmann, 1990). It has been suggested that the protein complex encoded by lef-4, -8 and -9 and p47 can activate transcription of the polyhedrosis gene promoter in vitro (Guarino et al., 1998); LEF-6 and PP31 do not affect virus replication but can promote late gene transcription (Lin and Blissard, 2002b; Yamagishi et al., 2007); and LEF-5 has no significant effect on viral genome replication but is essential for virus replication and affects late gene transcription significantly (Su et al., 2011). The locations of the 18 lef genes within the BmNPV genome were determined by Gomi et al. (1997, 1999), who suggested that they are similar to those of AcMNPV. The amino acid sequences of the encoded LEF proteins have 73–98% homology. The lef-10 gene, which is located at positions 40,206–40,442 of the BmNPV genome, has a length of 237 bp and encodes 78 amino acids. lef-10 does not have significant homology with other LEFs and is thought to be
46
W. Yu et al. / Virus Research 175 (2013) 45–51
a cofactor during transcription (Hefferon, 2004). To further investigate the function of LEF-10 in viral genome replication as well as gene transcription and expression within BmNPV, lef-10 was deleted from the BmNPV genome using the Red recombination system to create a lef-10 knockout virus. A repair virus was constructed using a Bac-to-Bac system and transfected BmN cells using both viruses to study the function of lef-10 in regulating viral replication as well as transcription and expression in different phases.
2. Materials and methods 2.1. Materials Escherichia coli strains TG1, BW25113 (contains plasmid pKD46 and can express Red recombinase) and DH10Bac, and plasmid pKD3 (contains the anti-chloromycetin gene cat) and pFastBac1 are maintained in our laboratory. Liquid SOC medium was obtained from Biocolor BioScience & Technology Company (Shanghai, China); Sf900 medium and fetal bovine serum were purchased from Gibco (Grand Island, NY, USA). A DNA ladder marker, T4 ligation and restriction endonucleases BamHI and EcoRI were obtained from Takara. l-Arabinose, a gel Recovery Kit and a RevertAid First-Strand cDNA Synthesis Kit were purchased from Promega (Madison, WI, USA). The Taq enzyme and related polymerase chain reaction (PCR) agents were obtained from TransGen Biotech (Beijing, China). KOD plus high-fidelity enzyme and related PCR reagents were purchased from TOYOBO Co., Ltd. (Ohtsu, Japan). An enhanced chemiluminescence detection system was obtained from Amersham Pharmacia Biotech (Piscataway, NY, USA). The specific primers were synthesized by Shanghai Sunny Biotechnology Co., Ltd. (Shanghai, China). LEF-10 and LEF-3 monoclonal antibodies were purchased from Abmart Inc. (Shanghai, China). All reagents were of analytically pure grade.
2.2. DH10bac harvest using plasmid pKD46 Plasmid pKD46 was extracted from E. coli strain BW25113. Competent DH10Bac cells were prepared using CaCl2 and then transformed with 1 L of plasmid pKD46 DNA and spread onto LB medium containing ampicillin (80 g/mL) and kanamycin (50 g/mL) and incubated at 37 ◦ C for 12 h.
2.3. lef-10 gene targeting linear fragment preparation On the basis of the BmNPV lef-10 gene sequence (GenBank accession no. 1488674), the PCR primers were designed to amplify the lef-10 gene targeting linear fragment. The pair of primers: lef10-C1: 5 -GCCCTGGACATTGAACTCGATTTTAGGAATTTTTTTAAAATGCAATCATGTAAGTGTAGGCTGGAGCTGCTTC-3 , lef10-C2: 5 AAATAAATTATCTTTCAGTACACAATTGATGAGGTTGACGTCCGTCGCGGATGGGAATTAGCCATGGTCC-3 , comprise the 50 bp homologous arm of lef-10 (underlined) and the 20 bp cat homologous domain, respectively, and the box marks the artificially introduced termination codon. The PCR reaction amplified the targeting linear fragment using pKD3 as the template and the reaction volume was 50 L. The amplification program was: pre-denaturation at 94 ◦ C for 3 min then 30 cycles of denaturation at 94 ◦ C for 30 s, annealing at 60 ◦ C for 30 s, elongation at 72 ◦ C for 90 s and, finally, an elongation step at 72 ◦ C for 10 min. The PCR products were separated by electrophoresis through 1% (w/v) agar gel. The linear DNA fragments were purified with the Gel Recovery Kit then dissolved in 30 L of ultrapure water and stored frozen at −20 ◦ C.
Fig. 1. Strategy for building the lef-10 knockout virus lef10-ko-Bacmid. (A) pKD3 chosen as the template and lef10-C1 and lef10-C2 as primers; amplify the cat genetargeting fragment using the polymerase chain reaction (PCR). (B) Location of the lef10 gene in the wild type BmNPV genome. (C) Homologous recombination between the linear fragment and the lef-10 gene, which can be replaced by the cat gene.
2.4. lef10-ko-Bacmid construction and confirmation 2.4.1. Strategy The prepared linear fragment was transformed into DH10Baccompetent cells using pKD46; after the induction by l-arabinose, Red recombinase induces homologous recombination between lef10 and the linear fragments. lef10-ko-Bacmid was then harvested by selecting the recombined bacteria on a plate with ampicillin and kanamycin. Fig. 1 shows the construction map. 2.4.2. Construction of lef-10-ko-Bacmid Randomly picked pKD46 plasmids containing DH10Bac colonies were cultured at 30 ◦ C with shaking overnight and then inoculated at the ratio of 1:100 (v/v) into liquid LB medium containing ampicillin (80 g/mL) and kanamycin (50 g/mL). The bacteria were cultured at 37 ◦ C until the absorbance at 600 nm (A600 ) was 0.15–0.2 and 200 L of l-arabinose (2 mmol/mL) was added. Bacteria were harvested by low-speed centrifugation after culture for 1–1.5 h at 37 ◦ C. Competent cells (200 L) were prepared using CaCl2 (0.05 mol/L), to which 15 L of the linear fragment prepared above was added. The mixture was incubated on ice for 30 min, heat-shocked at 42 ◦ C for 90 s, mixed with 1 mL of SOC medium immediately afterward, incubated with shaking at 30 ◦ C for 3 h, and spread onto solid LB medium containing ampicillin (80 g/mL), and kanamycin (50 g/mL). After induction by l-arabinose in the presence of Red recombinase, homologous recombination occurred between the linear fragment and lef-10, after which the recombined bacteria were selected on a plate containing chloromycetin (34 g/mL) and kanamycin (50 g/mL). 2.4.3. PCR confirmation of lef10-ko-Bacmid Randomly chosen anti-chloromycetin and anti-kanamycin colonies were cultured at 37 ◦ C and recombined. Bacmid DNA was extracted by the alkaline lysis method. Different PCR primer pairs were used to confirm lef-10 gene knockout. The upstream and downstream primers of lef-10 were: lef-10F, 5 -AAAGATTATTGGCCAACGTG-3 , lef-10R, 5 AACATGTCGTTTTCGTTATCGG-3 . The primer pair inside the cat gene was: 5 -CACGTTTAAATCAAAACTGGTG-3 , catR, 5 catF, CAATATGGACAACTTCTTCG-3 . Different combinations of primers included lef-10F – catR, lef-10F – lef-10R and lef-10R – catF. All of the PCR reactions introduced control PCR which used wt-Bacmid DNA as a template. Finally, ko-Bacmid DNA of the confirmed knockout virus was used as a template and PCR amplified with
W. Yu et al. / Virus Research 175 (2013) 45–51
47
growth phase were inoculated into 96-well plates (103 cells/well) and incubated at 27 ◦ C overnight. The collected viral supernatants were 10-fold serial diluted from 10−1 to 10−9 . A total of 10 L of viral supernatant was inoculated in each well of the plate, and each serial dilution was inoculated into six wells. Non-infected BmN cells were used as a negative control. After incubation at 27 ◦ C for 5 days, cell infections of both the negative control and the serial dilutions at each level were recorded, and each experiment was done in triplicate. Protection endpoints of 50% (TCID50 ) were calculated as described (Krah, 1991). 2.7. Quantitative PCR (qPCR) analysis of the viral genome replication
Fig. 2. Construction map of the wtBacmid, lef10-ko-Bacmid and lef10-re-Bacmid viruses.
lef-10F and lef-10R as primers. The PCR products were cloned to plasmid pMD18-T Simple Vector and then sequenced for verification. Successfully recombined Bacmid viruses were named lef10-ko-Bacmid. 2.5. lef-10 repair virus construction and confirmation 2.5.1. Strategy The intention was to use the constructed recombinant transfer vector plasmid pFastbac1-lef10 (with lef10 upstream promoter 134 bp + lef10 237 bp) to transform the E. coli competent cells with lef-10-ko Bacmid. Using the Bac-to-Bac system, knockout lef-10 can be repaired into the viral genome to create the repair virus lef10-re-Bacmid (Fig. 2). 2.5.2. PCR confirmation of lef-10 repaired virus lef10-re-Bacmid On the basis of the lef-10 sequence, we designed the upstream primer P1 forward: 5 -CGGGATCCTGCTTCGAGAAACCAAAG-3 where the BamHI restriction site is underlined and the downstream primer P2 reverse: 5 -CGGAATTCTTACGTGGACGCGTTACT-3 where the EcoRI restriction site is underlined. PCR amplification used the wt-Bacmid genome as a template. The reaction program was: pre-denaturation at 94 ◦ C for 3 min then 30 cycles of denaturation at 94 ◦ C for 30 s, annealing at 60 ◦ C for 30 s, elongation at 72 ◦ C for 30 s and a final elongation step at 72 ◦ C for 10 min. The PCR products and pFastbac1 plasmid were recovered and digested by BamHI and EcoRI, and the digestion products were recovered and ligated by T4 ligation overnight. Recombinant transfer vector pFastbac1-lef10 was constructed to transform the E. coli TG1 competent cells and positive clones were chosen. E. coli with lef10-ko-Bacmid was transformed with successfully confirmed transfer plasmids pFastbac1-lef10 and spread onto solid LB medium with X-gal (100 g/mL), IPTG (40 g/mL), tetracycline (10 g/mL), kanamycin (50 g/mL), gentamicin (7 g/mL) and chloromycetin (34 g/mL). M13 primers and lef-10 gene-specific primers were used for the PCR confirmation. 2.6. Virus titer detection BmN cells were transfected with 1 g of wtBacmid DNA, 1 g of lef10-ko-Bacmid DNA and 1 g of lef10-re-Bacmid DNA, and the supernatant of the virus-infected cells was collected after 5 days for virus titer detection. First, BmN cells in the logarithmic
BmN cells (1 × 106 mL−1 ) were transfected with 1 g of lef10ko-Bacmid, 1 g of lef10-re-Bacmid and 1 g of wtBacmid genome DNA. The viral genome was extracted at 12, 24, 48, 72 and 96 h. DpnI was chosen because it is a methylation-dependent restriction endonuclease that can specifically recognize methylated sites to remove exogenous Bacmid DNA introduced during transfection, whereas the progeny virus DNA replicating within the BmN cells would not be enzymolyzed (Lu et al., 2002). Thus, after the entire DNA at each phase had been extracted and digested by DpnI, qPCR was done using specific primers for the Bmgp41 gene from the BmNPV genome, which encodes the envelope protein (Olszewski and Miller, 1997), and Bm-actin was used as an internal reference to correct sample volume errors. Each experiment was done in triplicate. Primer Premier 5.0 software was used to design fluorescent qPCR primers for Bmgp41and Bm-actin. The upstream primer for Bmgp41 amplification was: gp41F 5 CGTAGTGGTAGTAATCGCCGC-3 and the downstream primer was: gp41R 5 -AGTCGAGTCGCGTCGCTTT-3 The upstream primer for Bm-actin amplification was: -actinF 5 -GCGCGGCTACTCGTTCACTACC-3 and the downstream primer was: -actinR 5 -TGCCGCAAGCTTCCATACCC-3 . The PCR program was: pre-denaturation at 95 ◦ C for 10 min, then 40 cycles of denaturation at 95 ◦ C for 10 s, annealing at 50 ◦ C for 10 s, and a final elongation step at 72 ◦ C for 12 s. The melting curve program was: 95 ◦ C for 5 s, 65 ◦ C for 1 min, 95 ◦ C for 15 s. 2.8. qPCR analysis of the viral gene transcription at different phases BmN cells (1 × 106 mL−1 ) were transfected with 1 g of lef10ko-Bacmid, 1 g of lef10-re-Bacmid and 1 g of wtBacmid and then harvested at 12, 24, 48 and 72 h. DNaseI was used to remove genomic DNA during the extraction of whole RNA. A RevertAid First-Strand cDNA Synthesis Kit was used to reverse transcribe the entire RNA to cDNA for fluorescence qPCR; the primers were specific sequences of early gene Bmlef-3, late gene Bmvp39 and very late gene Bmp10 from the BmNPV genome. Bm-actin was used as the internal reference to correct the sample volume errors and each experiment was done in triplicate. The upstream primer for Bmlef-3 amplification was: lef3F 5 -TCGGATGACCGTTCTACCTCTT-3 and the downstream primer was: lef3R 5 -CTTCCAGCAGCATTGAGATTTG-3 . The upstream primer for Bmvp39 amplification was: vp39F 5 -AGACACCACAAACCCGAACAC-3 and the downstream primer was: vp39R 5 -TTGATCGCCAACACCACCT-3 . The upstream primer for Bmp10 amplification was: p10F 5 -GACACGAATTTTAGACGCCATT-3 and the downstream primer was: p10R 5 -CGATTCTTCCAGCCCGTTT3 . The primers for Bm-actin amplification were the same as those described in Section 1.7, above. The PCR program was:
48
W. Yu et al. / Virus Research 175 (2013) 45–51
Fig. 3. Polymerase chain reaction (PCR) confirmation of knockout virus lef10-koBacmid. Lane M, DNA mass marker; 1–4, PCR products after use of lef10F and catR as primers; 5–8, PCR products after use of lef10R and catF as primers; 9–12, PCR products after use of lef10F and lef10R as primers. Lanes 1–3, 5–7 and 9–11 used lef10-ko-Bacmid DNA as the template. Lanes 4, 8 and 12 used wtBacmid DNA as the template.
pre-denaturation at 95 ◦ C for 10 min then 40 cycles of denaturation at 95 ◦ C for 10 s, annealing at 50 ◦ C for 10 s and a final elongation step at 72 ◦ C for 12 s. The melting curve program was: 95 ◦ C for 5 s, 65 ◦ C for 1 min, 95 ◦ C for 15 s.
2.9. Immunoblotting BmN cells (1 × 106 ) were transfected with 1 g of lef10-koBacmid or 1 g of lef10-re-Bacmid and collected 24, 48, 72 and 96 h post transfection. The cells were lysed by sonication followed by sodium dodecyl sulfate/polyacrylamide gel electrophoresis. The proteins were transferred from the gel onto a polyvinylidene fluoride membrane. A mixture of anti-mouse monoclonal antibodies LEF-10 or LEF-3 was used as the primary antibody. Goat-antimouse immunoglobulin G-horseradish peroxidase was used as a secondary antibody for western blot analysis.
2.10. Data analysis Data were analyzed using one-way analysis of variance (ANOVA) and the results are expressed as mean ± SEM. If a statistically significant effect was found, Newman–Keuls test was used to isolate the difference between the groups. The level of statistically significant difference was set at P ≤0.05.
Fig. 4. Polymerase chain reaction (PCR) confirmation of the repair virus lef10-reBacmid. Lane M, DNA marker; 1, PCR products after the use of M13F and M13R as primers; 2, PCR products after the use of M13F and P2 as primers; 3, PCR products after the use of M13R and P1 as primers; 4, PCR products after the use of P1 and P2 as primers.
3.2. Repaired virus lef10-re-Bacmid confirmation E. coli competent cells with lef10-ko-Bacmid were transfected with recombinant transfer vector pFastBac1-lef10. Positive clones were selected and the plasmids were extracted from the picked white patches. The M13 primers were used for PCR to confirm the repair virus lef10-re-Bacmid. M13 F–M13 R, M13 F–P2, M13R–P1 and P1–P2 were used as PCR primer pairs to confirm the construction of the repair virus lef10-re-Bacmid. When PCR used M13F and M13R primers, the products should be 2801 bp long (2430 bp + exogenously inserted fragment 371 bp); for M13F and P2 primers, the products should be 2021 bp long (1650 bp + 371 bp); for M13R and P1 primers, the products should be 974 bp long (603 bp + 371 bp); and for P1 and P2 primers, the length of products should be the same as the exogenously inserted fragment (371 bp). Fig. 4 shows that the PCR product lengths were consistent with these theoretical values. 3.3. Effect of knockout lef-10 on viral genome replication The TCID50 method was used to detect virus titers of three different viruses (lef10-ko-Bacmid, lef10-re-Bacmid and wtBacmid) that were harvested from the supernatant of the cell culture after they transfected BmN cells at 24, 48, 72 and 96 h (Fig. 5). The TCID50 value
3. Results 3.1. Confirmation of knockout virus lef10-ko-Bacmid Three single colonies were chosen at random and cultured overnight in liquid LB medium containing chloromycetin and kanamycin. Bacmid DNA was extracted using the alkaline lysis method for PCR confirmation. If the PCR used knockout virus lef10ko-Bacmid DNA as template and primers lef-10F and catR, the products should be 625 bp long; when the primers were lef-10R and catF, the products should be 1028 bp long and when the PCR used wild type virus wtBacmid DNA as a template, there should be no specific band. When the PCR used lef-10F and lef-10R as primers and knockout virus lef10-ko-Bacmid DNA as a template, the products should be 1658 bp long; when wild type virus wtBacmid DNA was used as the template, the products should be 638 bp long. Fig. 3 shows that the lengths of the PCR products in each group were consistent with these theoretical values, indicating that lef-10 knockout virus lef10-ko-Bacmid was constructed successfully.
Fig. 5. Growth curve of lef10-ko-Bacmid, wtBacmid and lef10-re-Bacmid after BmN cell transfection.
W. Yu et al. / Virus Research 175 (2013) 45–51
of lef10-ko-Bacmid remained at zero, indicating that a virus with deleted lef-10 cannot generate an infectious budded virus (BV); i.e. lef10-ko-Bacmid lost the ability to generate BV. The amounts of BV generated by wtBacmid and lef10-re-Bacmid after transfection increased with time, suggesting that primarily transfected BV causes secondary infections. Fluorescence qPCR was used to further investigate the replication of these three viruses that transfect the BmN cells. A total of 1 g of purified wtBacmid DNA was diluted to 103 –109 copies and used as a template for fluorescence qPCR. A standard curve was constructed using the index of copy number as the abscissa and the Ct value as the ordinate. The lef10-ko-Bacmid, lef10-re-Bacmid and wtBacmid transfected BmN cells were collected at specific times and whole DNA was extracted and digested by DpnI for fluorescence qPCR analysis. The results showed Ct could be calculated in terms of absolute copies using the standard curve. Fig. 6 was drawn with the infection phases on the abscissa and the copy index of gp41 on the ordinate. The DNA copies of three viruses did not differ significantly at 12 h post transfection but, as time increased, the number of DNA copies of the wtBacmid and lef10-re-Bacmid viruses were significantly (P < 0.05) greater compared to lef-10 knockout lef10ko-Bacmid after 24 h post transfection. The amount of lef-10 repair virus and wild type virus DNA differed only slightly and the number of copies of lef10-ko-Bacmid was little changed. 3.4. Effects of knockout lef-10 on BmNPV gene transcription at different phases Fluorescence qPCR was used to analyze the transcription of early gene lef-3, late gene vp39 and very late gene p10 after the three viruses were transfected into BmN cells. Intracellular and extracellular RNA of these three viruses were collected at different time points and then reverse transcribed into cDNA for fluorescence
49
Fig. 6. Quantitative polymerase chain reaction (qPCR) analysis of virus copies after lef10-ko-Bacmid, lef10-re-Bacmid and wtBacmid transfected BmN cells. * P < 0.05 vs wtBacmid or lef10-re-Bacmid at 24, 48, and 72 h. Values are expressed as mean ± SEM. Similar results were obtained in three independent experiments.
qPCR using Bm-actin as an internal reference. Fig. 7 was drawn with transfection time on the abscissa and–Ct on the ordinate. The transcription levels of early, late and very late genes of lef10ko-Bacmid did not differ significantly at 24 h post transfection but the transcription levels of lef10-ko-Bacmid were significantly lower (P < 0.05) after 48 h compared to the other two viruses. The wild type and repair viruses had similar transcription levels at each phase, whereas the lef10-re-Bacmid had a slightly higher transcription level, except that the transcription level of early gene lef-3 of lef10-re-Bacmid was lower than that of wtBacmid after 72 h.
Fig. 7. Quantitative reverse transcription polymerase chain reaction (RT qPCR) analysis of viral gene transcription level after lef10-ko-Bacmid, lef10-re-Bacmid and wtBacmid transfection into BmN cells. (A) The variation of early gene lef-3 transcription level in BmNPV over time. (B) The variation of late gene vp39 transcription level in BmNPV over time. C, The variation of very late gene p10 transcription level in BmNPV over time. * P < 0.05 vs wtBacmid or lef10-re-Bacmid at 48 and 72 h. Values are expressed as mean ± SEM. Similar results were obtained in three independent experiments.
50
W. Yu et al. / Virus Research 175 (2013) 45–51
Fig. 8. Western blot analysis of lef-10 (A) and lef-3 (B) expression levels in the knockout virus lef10-ko-Bacmid and repair virus lef10-re-Bacmid. A, Expression analysis of lef-10. B, Expression analysis of lef-3. Lanes M, protein markers; 1, cell lysate of BmN transfected with lef10-ko-Bacmid DNA; 2, cell lysate of BmN transfected with lef10-reBacmid DNA; 3, cell lysate of non-infected BmN; 4–7, cell lysate of BmN transfected with lef10-ko-Bacmid DNA at 24, 48, 72 and 96 h; 8–11, cell lysate of BmN transfected with lef10-re-Bacmid DNA at 24, 48, 72 and 96 h; 12, cell lysis of non-infected BmN at 48 h.
3.5. Effects of knockout lef-10 on BmNPV gene expression BmN cells were transfected with the DNA of knockout virus lef10-ko-Bacmid and repair virus lef10-re-Bacmid and the cell lysates were collected for sodium dodecyl sulfate/polyacrylamide gel electrophoresis. Non-infected BmN cells were used as the negative controls and LEF-10 and LEF-3 monoclonal antibodies were used for western blotting (Fig. 8). Cells transfected with lef10-koBacmid and non-infected cells had no obvious hybridization band, whereas cells transfected with lef10-re-Bacmid had an obvious hybridization band at 10 kDa. This is consistent with the molecular mass of LEF-10, indicating no expression of the lef-10 gene in lef10-ko-Bacmid but it can be expressed after repair (Fig. 8A). Fig. 8B suggests that in the cell lysate of BmN transfected with knockout virus lef10-ko-Bacmid and non-infected BmN cells, there is no obvious expression of early gene lef-3, whereas the cell lysate of BmN transfected with repair virus lef10-re-Bacmid had an obvious hybridization band at 40 kDa. This is consistent with a molecular mass of LEF-3 and an expression level that increased with time. 4. Discussion Knocking out the lef gene from the Baculovirus genome is widely recognized as the most accurate and effective method for studying the function of lef (Poteete, 2001). In this study, the lef-10 gene in BmNPV was knocked out using the Red recombination system and the lef-10 gene-deleted virus lef10-ko-Bacmid was constructed. Because the ORF box of the lef-10 gene partially overlaps the upstream gene orf53 and the downstream gene vp1054, it was necessary to delete only 10 bp within the lef-10 gene to protect the complete gene sequence on both sides. The lef-10 gene was repaired back to the virus genome using the Bac-to-Bac system to construct the repair virus lef10-re-Bacmid. Because the Bac-to-Bac expression system uses the very late gene promoter of polyhedrosis to activate exogenous gene expression and lef-10 is an early gene, the lef-10 gene containing its own promoter was inserted into the viral genome to guarantee normal expression of the lef-10 gene during viral replication as well as viral infection vitality. Using the titer detection of the repair virus lef10-re-Bacmid, it was found that the infection ability of lef10-re-Bacmid recovered to the same level as the wild type virus, whereas the titer of the lef-10 knocked out virus remained at zero, indicating the deletion of lef-10 might have led to the loss of genome DNA replication or the secondary infection capability in the lef-10 knockout virus. To further investigate the effect of lef-10 deletion on viral genome DNA replication, BmN cells were transfected with two recombined viruses (lef10-ko-Bacmid and lef10-re-Bacmid) as well as wild type virus wtBacmid, whole DNA was collected at different time points, and fluorescence qPCR was used to analyze viral genome replication. The DNA replication level in the lef-10 knockout virus lef10-ko-Bacmid was significantly lower compared to the other two viruses, with the amount of DNA at 24 h posttranscription being half that of the other two viruses. Thus, we
suggest that the lef-10 gene has significant effects on viral genome replication. RT-qPCR was used to investigate the effects of lef-10 deletion on the transcription of viral early, late and very late genes. The viral early gene lef-3, late gene vp39 and very late gene p10 were chosen as research objects in this study and the results show that lef-10 deletion has significant effects on the transcription levels of the lef3, vp39 and p10 genes, particularly at 24 h post transfection, when the transfection level of the lef-10 knockout virus lef10-ko-Bacmid remained at a lower level. These results are consistent with the findings of earlier studies (Lu and Miller, 1994, 1995). Western blotting was used to analyze the effects of lef-10 deletion on the expression level of the viral early gene lef-3. It was found that lef-10 deletion significantly affected the expression of early gene lef-3 because LEF-3 protein was not be detected in BmN cells transfected with lef10-ko-Bacmid, whereas LEF-3 expression could be detected in BmN cells transfected with repair virus lef10re-Bacmid. LEF-3 is a single-chain DNA binding protein that is necessary for viral DNA replication (Li et al., 1993). The results of this study are consistent with early research on viral genome DNA replication, indicating LEF-10 might affect the DNA replication of viral genome directly or indirectly by regulating lef-3 transcription and expression. However, exactly how lef-10 regulates DNA replication of the viral genome remains to be explained. Acknowledgments This work was supported by the National High-tech R&D program (863 Program) (No. 2011AA100603), Major National Science and Technology project (No. 2012ZX09102301-009), Natural Science Foundation of Zhejiang Province (No. Y3090339) and National Natural Science Foundation of China (No. 31101831). References Berretta, M.F., López, M.G., Taboga, O., Sciocco-Cap, A., Romanowski, V., 2013. Functional analysis of Spodoptera frugiperda nucleopolyhedrovirus late expression factors in Sf9 cells. Virus Genes 46, 152–161. Bideshi, D.K., Federici, B.A., 2000. The Trichoplusia ni granulovirus helicase is unable to support replication of Autographa californica multicapsid nucleopolyhedrovirus in cells and larvae of T. ni. Journal of General Virology 81, 1593–1599. Blissard, G.W., Rohrmann, G.F., 1990. Baculovirus diversity and molecular biology. Annual Review of Entomology 35, 127–155. Guarino, L.A., Xu, B., Jin, J., Dong, W., 1998. A virus-encoded RNA polymerase purified from baculovirus-infected cells. Journal of Virology 72, 7985–7991. Glocker, B., Hoopes Jr., R.R., Hodges, L., Rohrmann, G.F., 1993. In vitro transcription from baculovirus late gene promoters: accurate mRNA initiation by nuclear extracts prepared from infected Spodoptera frugiperda cells. Journal of Virology 67, 3771–3776. Gomi, S., Zhou, C.E., Yih, W., Majima, K., Maeda, S., 1997. Deletion analysis of four of eighteen late gene expression factor gene homologues of the baculovirus, BmNPV. Virology 230, 35–47. Gomi, S., Majima, K., Maeda, S., 1999. Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. Journal of General Virology 80, 1323–1337. Hefferon, K.L., 2004. Baculovirus late expression factors. Journal of Molecular Microbiology and Biotechnology 7, 89–101. Krah, D.L., 1991. A simplified multiwell plate assay for the measurement of hepatitis A virus infectivity. Biologicals 19, 223–227. Knebel-Mörsdorf, D., Quadt, I., Li, Y., Montier, L., Guarino, L.A., 2006. Expression of baculovirus late and very late genes depends on LEF-4, a component of the
W. Yu et al. / Virus Research 175 (2013) 45–51 viral RNA polymerase whose guanyltransferase function is essential. Virology 80, 4168–4173. Kool, M., Ahrens, C.H., Goldbach, R.W., Rohrmann, G.F., Vlak, J.M., 1994. Identification of genes involved in DNA replication of the Autographa californica baculovirus. Proceedings of the National Academy of Sciences of the United States of America 91, 11212–11216. Li, Y., Passarelli, A.L., Miller, L.K., 1993. Identification, sequence, and transcriptional mapping of lef-3, a baculovirus gene involved in late and very late gene expression. Journal of Virology 67, 5260–5268. Lin, G., Blissard, G.W., 2002a. Analysis of an Autographa californica nucleopolyhedrovirus lef-11 knockout: LEF-11 is essential for viral DNA replication. Journal of Virology 76, 2770–2779. Lin, G., Blissard, G.W., 2002b. Analysis of an Autographa californica multicapsid nucleopolyhedrovirus lef-6-null virus: LEF-6 is not essential for viral replication but appears to accelerate late gene transcription. Journal of Virology 76, 5503–5514. Lu, A., Miller, L.K., 1995. The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. Journal of Virology 69, 975–982. Lu, A., Miller, L.K., 1994. Identification of three late expression factor genes within the 33.8- to 43.4-map-unit region of Autographa californica nuclear polyhedrosis virus. Journal of Virology 68, 6710–6718. Lu, L., Patel, H., Bissler, J.J., 2002. Optimizing DpnI digestion conditions to detect replicated DNA. Biotechniques 33, 316–318. Olszewski, J., Miller, L.K., 1997. A role for baculovirus GP41 in budded virus production. Virology 233, 292–301. Ponnuvel, K.M., Nakazawa, H., Furukawa, S., Asaoka, A., Ishibashi, J., Tanaka, H., Yamakawa, M., 2003. A lipase isolated from the silkworm Bombyx mori shows antiviral activity against nucleopolyhedrovirus. Journal of Virology 77, 10725–10729.
51
Poteete, A.R., 2001. What makes the bacteriophage lambda Red system useful for genetic engineering: molecular mechanism and biological function. FEMS Microbiology Letters 201, 9–14. Rapp, J.C., Wilson, J.A., Miller, L.K., 1998. Nineteen baculovirus open reading frames, including LEF-12, support late gene expression. Journal of Virology 72, 10197–10206. Stewart, T.M., Huijskens, I., Willis, L.G., Theilmann, D.A., 2005. The Autographa californica multiple nucleopolyhedrovirus ie0–ie1 gene complex is essential for wild-type virus replication, but either IE0 or IE1 can support virus growth. Journal of Virology 79, 4619–4629. Su, J., Lung, O., Blissard, G.W., 2011. The Autographa californica multiple nucleopolyhedrovirus lef-5 gene is required for productive infection. Virology 416, 54–64. Todd, J.W., Passarelli, A.L., Miller, L.K., 1995. Eighteen baculovirus genes, including lef-11, p35, 39 K, and p47, support late gene expression. Journal of Virology 69, 968–974. Vanarsdall, A.L., Okano, K., Rohrmann, G.F., 2005. Characterization of the replication of a baculovirus mutant lacking the DNA polymerase gene. Virology 331, 175–180. Wu, C.P., Huang, Y.J., Wang, J.Y., Wu, Y.L., Lo, H.R., Wang, J.C., Chao, Y.C., 2010. Autographa californica multiple nucleopolyhedrovirus LEF-2 is a capsid protein required for amplification but not initiation of viral DNA replication. Journal of Virology 84, 5015–5024. Yamagishi, J., Burnett, E.D., Harwood, S.H., Blissard, G.W., 2007. The AcMNPV pp31 gene is not essential for productive AcMNPV replication or late gene transcription but appears to increase levels of most viral transcripts. Virology 365, 34–47. Yu, M., Carstens, E.B., 2010. Identification of a domain of the baculovirus Autographa californica multiple nucleopolyhedrovirus single-strand DNA-binding protein LEF-3 essential for viral DNA replication. Journal of Virology 84, 6153–6162.