Characterization of Lepidoptera-active cry and vip genes in Iranian Bacillus thuringiensis strain collection

Available online at www.sciencedirect.com

Biological Control 44 (2008) 216–226 www.elsevier.com/locate/ybcon

Characterization of Lepidoptera-active cry and vip genes in Iranian Bacillus thuringiensis strain collection A. Seifinejad a

b

a,b

, G.R. Salehi Jouzani

a,*

, A. Hosseinzadeh b, C. Abdmishani

b

Department of Microbial Biotechnology and Biosafety, Agricultural Biotechnology Research Institute of Iran (ABRII), Mahdasht Road, P.O. Box 21525-1897, Karaj, Iran Department of Agronomy and Plant Breeding, University College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran Received 6 June 2007; accepted 12 September 2007 Available online 29 September 2007

Abstract The characterization of 70 Bacillus thuringiensis (Bt) strains isolated from different agro-ecological regions of Iran is presented. Characterization was based on PCR analysis using 25 general and specific primers for cry1, cry2, cry9 and vip3Aa genes encoding proteins active against Lepidoptera, crystal morphology, plasmid profiles, and protein band patterns as well as their insecticidal activity on Heliotis armigera. Isolates containing vip3Aa gene were the most abundant (82.6%) followed by those containing cry2 (56.5%), cry1 (49%) and cry9 (30%). Twenty-two distinct cry1-type profiles were identified from only cry1-harboring isolates when these were analyzed with specific primers. Several of them were found to be different from all previously published profiles. Finally 7.24% of the isolates did not produce any PCR product. Some strains were positive by universal primers but negative by specific primers for all known genes of cry1, cry2 and cry9 or gave PCR products of different sizes when assayed with cry1C, cry1E, cry1J, cry9A, and vip3a specific primers. These strains may contain a new gene or genes that seem promising for biological control of insects and management of resistance. Based on morphological and molecular studies, 20 potentially Lepidopteran-specific active isolates were selected for bioassays. Four strains showed similar or higher activity against H. armigera larvae than Bt subsp. kurstaki (Btk) and displayed high similarities with the Btk used in this study with regard to protein and plasmid profiles and the presence of cry genes. These results are important for directing future exploration of microbial control strategies for control of crop pests in the region.  2007 Elsevier Inc. All rights reserved. Keywords: Bacillus thuringiensis; Cry genes; Heliotis armigera; Iran; Lepidoptera; Molecular characterization; PCR; vip genes

1. Introduction Bacillus thuringiensis (Bt) constitutes a large family of bacterial subspecies highly specialized as insect pathogens found in many different habitats. The main focus in studies of Bt strains is the production of insecticidal crystal inclusions during sporulation (Ceron et al., 1995). There are hundreds of Bt strains and most produce one or more parasporal inclusions, each comprised of either one or several related insecticidal protoxins, the so-called d-endotoxins (Aronson and Shai, 2001). The discovery of the

*

Corresponding author. Fax: +98 261 2704539. E-mail address: [email protected] (G.R. Salehi Jouzani).

1049-9644/$ - see front matter  2007 Elsevier Inc. All rights reserved. doi:10.1016/j.biocontrol.2007.09.010

insecticidal properties of Bt toxins in the early 20th century was of considerable significance for plant protection against pest insects (Salehi Jouzani et al., 2005). The use of Bt as a microbial insecticide has several advantages over the use of chemical control agents; Bt strains are highly specific for certain hosts and are not toxic to other insects, plants, and vertebrates (Ceron et al., 1995; Schnepf et al., 1998). Chemical insecticides may be toxic and cause environmental problems when used improperly. This problem is increasing due to the selection of insect resistance to some pesticides. Given the variability of insecticidal proteins described, the isolation and characterization of new Bt strains may result in the discovery of insecticidal proteins with greater insecticidal activities and broader host ranges (Franco-Rivera et al., 2004; Jua’rez-Pe’rez et al.,

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

1997). Therefore many researchers have focused their efforts on the isolation of native strains, leading to the establishment of Bt strain collections worldwide. More than 350 different genes encoding toxins have been identified in Bt and two other species (www.biols.susx. ac.uk/home.neil_crickmore/bt/). In surveys of several Bt collections for a number of crystal protein genes, 40–50% of the strains either have activity against one or more Lepidoptera species or contain cry1 genes (Schnepf et al., 2005). The Lepidopteran-specific active proteins belong to the cry1, cry9, and cry2 groups (Bravo et al., 1998). Notwithstanding the variability of cry proteins described thus far, it is still necessary to search for more toxins with higher toxicity since a significant number of pests are not controlled with the available cry proteins. Some studies, using more specific characterization techniques, have established relations between geographical regions and cry gene profiles present in the Bt isolates (Uribe et al., 2003). One of the best characterization techniques is PCR, which is a highly sensitive method of rapidly detecting and identifying target DNA sequences. It requires a minute amount of DNA and allows quick, simultaneous screening of many Bt samples for classification and prediction of their insecticidal activities (Ceron et al., 1995; Franco-Rivera et al., 2004; Ferrandis et al., 1999). In this study, the morphological and molecular characteristics of field-collected Bt strains from Iran, as well as the distribution of Lepidopteran-specific active cry and vip genes among them are presented. 2. Material and methods 2.1. Bacterial isolation Bt strains were isolated from different fields within 3 climate zones of Iran (Cold or Moderate Mountainous zone, Caspianic zone, and Dry and Semidry zone) according to the modified method of Anwar Hossain et al. (1997). The isolates were obtained from soils, dead insects and leaf samples collected from fields. Known strains (Table 1) that served as references were supplied by DSMZ Company (the German Resource Centre for Biological Material, Braunschweig, Germany). Cultures of Bt strains were Table 1 Description of known Bt strains used in this study No

Serovar

Subspecies

Genes

1

HD1

Bt kurstaki

2

H7

Bt aizawai

3 4 5 6 7 8

HD2 H6 H4a4c H8a8b H5a5b HD125

Bt Bt Bt Bt Bt Bt

cry1Aa, cry1Ab, cry1Ac, cry1I, cry9D, cry2Aa, cry2Ab cry1Ad, cry1D, cry1F, cry1C, Vip3Aa cry1B cry1C cry1E, cry2Aa cry1H, cry1K cry9A, cry9B cry9C, vip3Aa

thuringiensis entomocidus kenyae morrisoni galleriae tolworthi

217

grown at 28 C in nutrient broth (Difco) with vigorous shaking or on nutrient broth agar. 2.2. Oligonucleotide primers and PCR analysis For detection of 24 Lepidopteran-specific active cry and vip genes, including cry1, cry2, cry9 and vip3Aa, two types of primers (29 different primers) were synthesized, namely, universal primers (UN) from conserved regions of related genes and specific primers (SP) as previously described (Jua’rez-Pe’rez et al., 1997; Porcar and Jua’rez-Pe’rez, 2003; Ben-Dov et al., 1997, 2001; Franco-Rivera et al., 2004) (Table 2). Oligonucleotides were synthesized in a DNA synthesizer (Microsyn 1450A; Systec Inc.) as specified by the manufacturer. Total DNA was extracted and purified following the method described by Ferrandis et al., 1999). PCR mixtures and amplifications were carried out following conditions described by Jua’rez-Pe’rez et al. (1997). The distribution frequency of a cry gene in Bt strains from a certain region of Iran was defined as the percentage of the Bt isolates containing this gene among all the isolates from that region according to Wang et al. (2003). 2.3. Characterization of parasporal inclusions Sporulating cultures of Bt strains were produced in the standard Bt medium (UG) containing Bactopeptone (7 gl1), glucose and salts as reported by Lecadet and Dedonder (1971) at 28–30 C for 72 h, or until more than 90% of the cells had lysed, releasing spores and crystals. Spore crystal mixtures were washed (10,000g for 10 min at 41 C) once in 0.5 M NaCl and then twice in cold sterile water. Two-milliliter samples of lysed cultures were washed by centrifugation and resuspended once in 2 ml of 0.5 M NaCl, and then twice in cold sterilized water containing 1mM of the protease inhibitor phenyl-methane-sulfonylfluoride (PMSF). Parasporal inclusions of each isolate were classified through phase contrast and light microscopy as one of the following types: bipyramidal (Bp); rhomboidal (Rm); elliptical (El); cuboidal (Cb); spherical (Sp) and spindle (Sl). 2.4. Protein electrophoresis The protein content of spore–crystal mixtures was determined by SDS–PAGE analysis, as described by Laemmli (1970), using 10% or 12.5% acrylamide separating gels. Samples (5–15 lg) of washed spore–crystal mixtures, prepared as described by Thomas and Ellar (1983), were placed in 2· concentrated sample buffer and heated at 80 C for 10 min, as described by Lecadet et al. (1992) and loaded onto the gel immediately before electrophoresis. Gels were stained with a solution containing 50% (v/ v) ethanol, 10% (v/v) acetic acid and 0.1% (w/v) Coomasie brilliant blue R250 for 40 min, and then destained with a solution containing 6.75% (v/v) glacial acetic acid and 9.45% (v/v) ethanol.

218

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

Table 2 Characteristics of general and specific primers for cry1, cry2, cry9 and vip3Aa genes Primer

Sequence 0

0

UNcry1(+) UNcry1() Spcry1Aa(+) UNcry1() SPcry1Ab(+) UNcry1() SPcry1Ac(+) UNcry1() SPcry1Ad(+) UNcry1() SPcry1B(+) UNcry1() SPcry1C(+) UNcry1() SPcry1D(+) UNcry1() SPcry1E(+) UNcry1() SPcry1F(+) UNcry1() SPcry1G(+) UNcry1() SPcry1H(+) UNcry1() SPcry1I(+) SPcry1I() SPcry1J(+) UNcry1() SPcry1K(+) UNcry1() UNcry2(+) UNcry2()

5 -tracrhtddbdgtattagat-3 5 0 -mdatytctakrtcttgacta-3 0 5 0 -ttccctttatttgggaatgc-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 - cggatgctcatagaggagaa-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 - ggaaactttctttttaatgg-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 -acccgtactgatctcaacta-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 - ggctaccaatacttctatta-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 -atttaatttacgtggtgttg-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 -caggccttgacaattcaaat-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 -tagggataaatgtagtacag-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 - gatttcaggaagtgattcat-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 -ggttctcaaagatccgtgta-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 -actcttttcacaccaataac-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 -acaatttacagcttattaag-3 0 5 0 -ctacatgttacgctcaatat-3 0 5 0 -gcgcttaataatatttcacc-3 0 5 0 -mdatytctakrtcttgacta-3 0 5 0 - tgatatgatatttcgtaacc-3 0 5 0 mdatytctakrtcttgacta3 0 5 0 -gttattcttaatgcagatgaatggg-3 0 5 0 -cggataaaataatctgggaaatagt-3 0

UNcry2(+) SPcry2Aa() UNcry2(+) SPcry2Ab() UNcry2(+) SPcry2Ac() UNcry9(+) UNcry9()

5 0 -gttattcttaatgcagatgaatggg-3 0 5 0 - gagattagtcgcccctatgag-3 0 5 0 -gttattcttaatgcagatgaatggg-3 0 5 0 -tggcgttaacaatggggggagaaat-3 0 5 0 -gttattcttaatgcagatgaatggg-3 0 5-gcgttgctaatagtcccaacaaca-3 0 5 0 - cggtgttactatt agcgagggcgg-3 0 5 0 - gtttgagcc gcttcacagcaatcc-3 0

SPcry9A(+) UNcry9() SPcry9B(+) UNcry9() SPcry9C(+) UNcry9() SPcry9D(+) UNcry9() SPvip3A(+) SPvip3A()

5 0 - ggttcacttacattgccggttagc-3 0 5 0 - gtttgagcc gcttcacagcaatcc-3 0 5 0 - gcaaatgcatttagcgctggtcaa-3 0 5 0 - gtttgagcc gcttcacagcaatcc-3 0 5 0 - ccaccagatgaaagtaccggaag-3 0 5 0 - gtttgagcc gcttcacagcaatcc-3 0 5 0 - gcaataagggtgtcggtcactgg-3 0 5 0 - gtttgagcc gcttcacagcaatcc-3 0 5 0 - cctctatgttgagtgatgta -3 0 5 0 - ctatactccgcttcacttga -3 0

Positions

Gene(s)recognized

Product size (bp)

726 2268 1023 2268 940

cryI

1500–1600

cry1Aa

1286

M11250

cry1Ab

1371

M13898

1452

cry1Ac

844

M11068

1057

cry1Ad

1212

M73250

1063

cry1B

1323

X06711

1160

cry1C

1176

X07518

1126

cry1D

1138

X54160

1155

cry1E

1137

X53985

1302

cry1F

967

M63897

1300

cry1G

1128

Z22510

1696

cry1H

572

Z22513

1027 2141 1162

cry1I

1000

X62821

cry1J

1106

L32019

1245

cry1K

1043

U28801

726–750 , 1402–1426, 1444–1468, 2120–2144, 2695–2719, 3359–3383 726 1203 1444 1965 2695 3396 2774–2797, 3104–3127 2272–2295, 2602–2625 4354–4377, 4681–4704 2338–2361, 2668–2691 1581 3104 1925 2602 3473 46814 1754 2668 365 1394

All cry2 genes cry2Aa

701 701 689 498

M31738 X55416 X57252 M31738

cry2Ab

546

M23724

cry2Ac

725

X57252

All cry9 genes

351–354

cry9A

1547

X58120 X75019 Z37527 D85560 X58120

cry9B

701

X75019

cry9C

1232

Z37527

cry9D

938

D85560

vip3Aa

1000

AAC37036

2.5. Plasmid patterns Bt strains were grown to an optical density at 600 nm of 0.8 in Spizizen medium (0.2% NH4SO4, 1.4% K2HPO4, 0.6% KH2PO4, 0.1% sodium citrate, 0.02% MgSO4Æ7H2O) with 0.5% glucose, 0.1% Casamino acids (DIFCO) and 0.01% yeast extract. Cells were washed in TE (50 mM Tris, 10 mM EDTA [pH 7.8]) and incubated for 30 min at 37 C

GenBank Accession No.

in 10 mg of lysozyme/ml in 0.5 M sucrose, 25 mM Tris, and 10 mM EDTA (pH 8.0). After 10 min at 4 C, lysis buffer (0.2 M NaOH, 1% sodium dodecyl sulfate [SDS]) was added and the mixture was incubated for 5 min at 4 C. A solution of 3 M sodium acetate, pH 4.8, was added and stored for 20 min at 20 C. Particles were centrifuged at 12,000 rpm for 20 min in a centrifuge. Two volumes of ethanol were added, and the mixture was incubated for 20 min at 80C

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

to precipitate DNA. DNA was centrifuged as above, dissolved in distilled water, and visualized in 0.6% Agarose gels. 2.6. Bioassays Preliminary leaf bioassays with highly concentrated spore–crystal suspensions were performed with the cotton bollworm (H. armigera) using first instar larvae. The isolates with high toxicity were selected for more precise bioassays. To calculate LC50 values of the selected isolates against H. armigera larvae, leaflets of cotton plants were cut to the desired size and coated with serial dilutions of spore–crystal mixtures. The solubilization buffer and water were used as negative controls. After air drying of the leaves, they were transferred to Petri dishes (100 by 15 mm) lined with moistened (0.5 ml distilled water) filter paper that was replaced daily. Ten first instar larvae were placed on each leaf (four replicates per treatment). Bioassays were conducted at 25 C in 60–70% relative humidity with a 16:8 light/dark cycle. The percentage of mortality was scored after 4 days.in comparison with parallel control in which leaflets were dipped in sterile distilled water instead of bacterial suspension. Btk was used as a positive control. The 50% lethal concentrations and confidence limits were obtained by probit analysis. 3. Results The Bt strain collection assembled in this study came from soils, dead insects and leaf samples collected from cultivated fields of different regions of Iran. In total, 70 crystal-forming Bt strains were identified among 1550 Bacillus-like colonies examined. These strains were isolated from the Temperate and Humid zone that occupies about 10% of the country (24% of the isolates), the Moderate or Cold Mountainous zone that occupies about 40% of the country (59% of the isolates); and the Dry and Semidry zone that occupies about 50% of the country (17% of the isolates). More Bt samples were collected from Caspianic zone (7%) than from the Moderate or Cold Mountainous (5.7%), and the Dry and Semidry zones (4%). Crystal forming isolates were selected for detection of different Lepidopteran-specific active cry and vip genes. The strains were characterized by different methods: (I) PCR to identify cry1, cry2, cry9 and vip genes (Fig. 1), (II) Microscopic observation of crystals, (III) SDS–PAGE of spore–crystal suspensions to determine the protein profiles of the isolates, (IV) plasmid pattern of isolates and (V) bioassays against H. armigera. 3.1. Determination of the Lepidoptera-active cry gene content of Bt isolates PCR was done with three pairs of universal primers for cry1, cry2 and cry9 genes selected from highly conserved regions among each group of genes and one pair of specific primers for vip3Aa gene (Fig. 1). The cry and vip3Aa genes

219

content of the Bt strains is shown in Fig. 2. Strains containing vip gene were most abundant in our collection (57 strains, representing 82.6%) followed by cry2 (56.5%), cry1 (49%), cry9 (30%). Finally, 7.24% of the strains did not show any PCR product when assayed with the universal primers (Figs. 1 and 3). However, these strains produced crystal inclusions, suggesting that they may potentially contain other known or novel cry toxins. Strains with unique PCR product profiles obtained with the universal primers were further characterized by additional PCR with specific primers described in Table 2. The PCR positive strains with universal primers were analyzed for 10 subgroups of cry1 genes (cry1Aa, cry1Ab, cry1Ac, cry1Ad, cry1C, cry1D, cry1E, cry1F, cry1I, cry1J), 3 subgroups of cry2 genes (cry2Aa, cry2Ab, cry2Ac) and 3 subgroups of cry9 genes (cry9A, cry9B, cry9D) (Figs. 1 and 3). The strains harboring cry1 genes were analyzed with the cry1 specific primers. We found 22 different cry1 gene profiles (Table 5). The most common profile of cry1 genes contained ‘‘cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F and cry1I’’ genes (17.6%). All the different cry1 subfamilies were observed with different frequencies. Among them, cry1I (100%), cry1C (94.1%), cry1D (91.1%), cry1Ac (82.3%), cry1Aa and cry1F (73.5%) were the most abundant, while cry1Ad (1.4%) and cry1J (7.1%) genes were less prevalent (Fig. 3). One of the isolates contained only the cry1I gene. Surprisingly, cry1C and cry1D occurred together in 30 of 34 isolates suggesting that these two genes are probably linked. Among the isolates containing the cry2 gene, 37.5% harbored cry2Aa, 55% cry2Ab and 2.5% cry2Ac. None of the cry2-containing isolates showed more than one types of these genes (Table 3). About 2.5% of the cry2 positive isolates did not amplify any product with specific primers for these 3 genes, suggesting that they may contain potentially novel cry2 genes. Seven different cry9 gene profiles were detected in this collection (Table 4). The most common profile of cry9 positive strains contained cry9B and cry9D genes (42.8%). Among the cry9 gene containing isolates, 28.4% of strains harbored cry9A, 71.3 % cry9B, 0 % cry9C and 71.3 % cry9D. It is interesting to note that 63% of cry9-containing isolates contained more than one cry9-type gene and about 14.2% of them were positive by universal primers but negative by specific primers for cry9. It is important to note that some strains reacting with cry1C, cry1E, cry1J, cry9A, and vip3a genes produced PCR products different in size than expected . These strains may contain a new gene or genes that may be promising for biological control of insects and management of resistance. 3.2. Distribution of Lepidopteran-specific active cry genes in different ecological regions The distribution of Lepidopteran-specific active cry genes in different ecological regions of Iran was analyzed (Fig. 4). Iran, a large country with a unique and rich biodi-

220

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

Fig. 1. Agarose gel (1.2%) electrophoresis of PCR products amplified from the native Bt strains. (a) with vip3Aa specific primers: 1-Bt var tolworthi as positive control; 2–7, the native Bt strains (AGI1, GN4, KON4, BR4, S90, YD5, respectively); M, molecular weight marker (1kb); C, negative control. (b) With cry9B specific primers: 1-Bt galleriae as positive control; 2–7, the native Bt strains (KH7, S90, SN1, KH5, S7, S8, respectively); C, negative control; M, molecular weight marker (1kb). (c) With cry2Ab specific primers: 1-Bt kurstaki HD1 as positive control; 2–4, the native Bt strains (AL10, KH5, BR4, S46, respectively); C, negative control; M, molecular weight marker (1kb).

Fig. 2. Distribution of cry-type and vip genes obtained from 70 field-collected strains of Bt identified by PCR analysis with universal primers.

versity, can be divided into three main zones based on geography and climate: (1) the temperate and humid Caspianic zone, (2) the Moderate or Cold Mountainous zone, and (3) the Dry zone, which includes both dry and Semidry regions. Based on frequency in the regions, All observed

Lepidopteran-specific active cry genes can be divided into three groups. The first group consists of vip3Aa (70– 90%), cry1I (45–50%), cry1C (20–67%), cry1D (20–63%), and cry1Ac (15–60%) genes, which were the five most common genes found in all the three main zones. The

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

221

Fig. 3. Distribution of cry type genes in 70 field-collected strains of Bt identified by PCR analysis with specific primers. Table 3 Distribution of cry2 gene profiles present in the cry2- containing Bt strains No

cry genes profiles

No. of isolates

Frequency (%)

1 2 3 4

2Aa 2Ab 2Ac Did not react with any cry2 specific primers

15 22 1 1

38.46 56.4 2.5 2.5

Table 4 Distribution of cry9 gene profiles present in the cry9-containing Bt strains No

cry genes profiles

No. of isolates

Frequency (%)

1 2 3 4 5 6 7

9A 9B 9D 9A, 9B, 9D 9A, 9B 9B, 9D Did not react with any cry9 specific primer

1 1 2 4 1 9 3

4.7 4.7 9.5 19 4.7 42.8 14.2

cry1C, cry1D, and cry1Ac genes were present at almost the same frequencies in the Mountainous zone. We also found that the frequencies of cry9D, cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F, and cry2Aa were significantly higher in the Mountainous zone than in the Caspianic, and dry zones (Fig. 4). The cry9A, cry1Ab and cry1J genes were distributed in all regions but their frequencies were much less than 10%. The second group includes cry1Ad and cry2Ac genes, which were less abundant and distributed only in Mountainous zone. The last group consists of cry9C, cry1B, cry1G, cry1H, and cry1K genes which were not found in any of the regions (Fig. 4). It is interesting to note that the isolates which did not contain any of the studied gene families (cry1, cry2, cry9, and vip genes), were observed at a similar frequency (around 7% of the strains) in each region of Iran. Finally, the distribution of Lepidopteran-specific active cry and vip genes in Mountainous zone were more abundant (25.2%) than in the Caspianic (18.84%), and Dry (17.9 %) zones.

Table 5 Distribution of cry1 gene profiles present in the cry1-containing Bt strains No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

cry gene profiles

No of isolates

Frequency (%)

cry1Aa, cry1Ab, cry1Ac, cry1Ad, cry1C, cry1D, cry1E, cry1F, cry1I cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry1J cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1F, cry1I cry1Aa, cry1C, cry1D, cry1E, cry1F, cry1I, cry1J cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1I, cry1J cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1I cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I cry1Aa, cry1Ac, cry1C, cry1D, cry1F, cry1I cry1Aa, cry1Ab, cry1Ac, cry1C, cry1F, cry1I cry1Ac, cry1C, cry1D, cry1F, cry1I, cry1J cry1Aa, cry1C, cry1D, cry1E, cry1F, cry1I cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I cry1C, cry1D, cry1E, cry1F, cry1I cry1Aa, cry1Ac, cry1C, cry1D, cry1I cry1Ac, cry1C, cry1D, cry1E, cry1I cry1Ac, cry1C, cry1D, cry1F, cry1I cry1Aa, cry1C, cry1D, cry1E, cry1I cry1C, cry1D, cry1F, cry1I cry1Ac, cry1C, cry1I cry1Ac, cry1D, cry1I cry1 I

1 6 2 2 1 1 1 3 3 1 1 1 1 1 2 1 1 1 1 1 1 1

2.9 17.6 5.8 5.8 2.9 2.9 2.9 8.8 8.8 2.9 2.9 2.9 2.9 2.9 5.8 2.9 2.9 2.9 2.9 2.9 2.9 2.9

222

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

Fig. 4. The Lepidopteran-specific active cry genes distribution in different ecological regions.

3.3. Microscopic observation of the crystals Microscopic studies showed that about 40% of isolates contained more than one type of crystal. The results showed that 52.54% of isolates produce bipyramidal parasporal inclusions, 30% cuboidal, 28.57% elliptical, 10% spindly, 5.71% spherical, and 27.4% of isolates were rhomboidal. Based on previous studies (Hofte and Whiteley, 1989; Maduell et al., 2002; Herandeza et al., 2005; Meadows et al., 1992; Obeidat et al., 2004), strains containing Lepidopteran-specific active cry genes have bipyramidal crystal inclusions. Most cry1, cry2, cry9, and vip gene-containing isolates have one or more types of crystal inclusions, including bipyramidal (very similar to those found in Btk), rhomboidal or elliptical shapes with an average length from 0.8 to 1.8 lm, similar to previous published results (Hofte and Whiteley, 1989; Herandeza et al., 2005). 3.4. Crystal protein composition TheBt strains containing Lepidopteran-specific active genes were further characterized by SDS–PAGE. Some of the strains synthesized a protein or group of proteins with a molecular mass between 28 and 140 kDa, and some of them had another protein of 18–28 kDa (Fig. 5). We observed that 67% of isolates produced protein profiles around 130– 140 kDa in size. Based on previous reports, this size of crystal protein is very affective against Lepidoptera (Hofte and Whiteley, 1989; Herandeza et al., 2005; Uribe et al., 2003; Chak et al., 1994; Arango et al., 2002). The protein profiles of some isolates were related to their PCR profiles, but other isolates that had no PCR product with the primers tested in this study produced several protein bands, implying that these isolates may harbor other cry genes.

Fig. 5. SDS–PAGE of spore-crystal from some Iranian Bt strains. M, Molecular size marker; 1–7, the native Bt strains (AGI1, KH7, GON6, YD5, S19, S76, KON4, respectively).

mid components, as variations in the number and molecular masses of plasmid elements have been considered representative features of each Bt strain. The plasmid composition of the isolates was compared to Btk. The plasmid profile analysis detected a great complexity in the content of plasmids, providing 12 different plasmid profiles. The results showed that the isolates contained between 1 and 6 plasmids with estimated molecular masses of 4 to 130 MDa (Fig. 6). The band that corresponds to chromo-

3.5. Plasmid pattern Further characterization of the strains containing Lepidopteran-specific active cry genes was based on their plas-

Fig. 6. Plasmid pattern of some Iranian Bt isolates. 1–6, the native Bt strains (AGI1, KON4, S90, GON6, GN4, YD5, respectively); C, Bt subsp. kurstaki.

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

somal DNA was identified in all isolates, and megaplasmids, i.e., plasmids detected above the chromosomal band, were identified in several isolates. Eight isolates showed four plasmids with masses of 4.9, 9.6, 30 and 47 MDa resembling the Btk pattern. However, most of the isolates containing Lepidopteran-specific active cry genes showed some identical bands, indicating that they probably harbored plasmids of the same size. The presence of a given plasmid in several strains may have occurred as a result of successive events of conjugation between different strains in the environment (Vilas-Boˆas and Lemos, 2004). Also results showed that some isolates from the same zone have different plasmid profiles and some isolates from different zones have the same plasmid profile. 3.6. Bioassay Based on morphological and molecular studies, 20 isolates were selected for bioassays (Table 6). A preliminary bioassay with highly concentrated spore–crystal suspensions of selected isolates was performed on first instar

223

larvae of H. armigera. The selected strains showed different toxicity levels between 0 and 100%. Some strains harboring the same cry gene profiles showed different activity against cotton bollworm larvae. Also some strains containing different cry genes profiles but showing the same activity against cotton bollworm larvae were identified. However, ten isolates showed more than 50% mortality, and four exceeded 80% mortality. The four most toxic isolates (YD5, KON4, BR4 and 90) were further bioassayed with serial dilutions of spore–crystal mixtures for LC50 estimations (Table 7). According to the LC50 values and their fiducial limits, isolate YD5 was the most toxic, although it was not significantly different from KON4. Strains KON4 and YD5 showed higher activity against H. armigera larvae when compared with the Btk control, but strains BR4 and 90 were similar to Btk. 4. Discussion We have presented the characterization of a Bt strain collection built from soil samples of different agricultural

Table 6 Crystal protein and gene features of 20 selected Bt isolates Strainsa

Crystal morphologiesb

Protein sizec (kDa)

Genes detected by PCR

AGI1 GN4 QM1 BR4 KON4 AL11 AL10 YD5 KH7 S90 S19 S59 S30 S57 S76 KH5 S86 KON1 S8 S17 Btk

Bp, El Bp, Cb Bp, Sp Bp, El Bp, Cb Bp, Cb Bp,Cb, Sp Bp, Rm Bp, Rm Bp, El Bp, Sp Bp, Rm Bp Bp, El, Sp Bp, Rm Bp, Rm Bp, El, Sp Bp, Cb Bp, Cb Bp, El Bp,Rm

135, 95 120, 63, 135, 60 135, 95 135, 95 135, 64, 120, 70 135, 95, 135, 95 135, 60 135 120, 80, 135, 80, 120, 60 135 95, 502, 120, 40 120, 95, 135, 95, 120, 85, 135, 95,

cry1Aa, cry1Ab, cry1Ac, cry1Ad, cry1C, cry1D, cry1E, cry1F, cry1I, cry2Aa, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry2Ab, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry2Ab, cry9D, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I cry2A, cry9D, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry2Aa, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry2Ab, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1F, cry1I, cry2Aa, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1F, cry1I, cry2Aa, cry9B, cry9D, vip3Aa cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry9B, cry9D, vip3Aa cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry2Aa, vip3Aa cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, vip3Aa cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry1J, vip3Aa cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1F, cry1I, cry1J, cry2Aa, vip3Aa cry1Aa, cry1Ac, cry1C, cry1D, cry1E, cry1I, cry1J, cry9A, cry9B, cry9D cry1Aa, cry1Ac, cry1C, cry1D, cry1F, cry1I, cry2Ab, cry9B, cry9D, vip3Aa cry1Ac, cry1C, cry1D, cry1F, cry1I, cry1J, cry9A, cry9B, cry9D, vip3Aa cry1Aa, cry1C, cry1D, cry1E, cry1F, cry1I, cry9B, cry9D, vip3Aa cry1Ac, cry1C, cry1D, cry1E, cry1I, cry2Aa, cry9A, cry9B, cry9D, vip3Aa cry1Aa, cry1C, cry1D, cry1E, cry1I, vip3Aa cry1Aa, cry1Ab, cry1Ac, cry1F, cry1I, cry2Ab, cry9D, vip3Aa

a b c

60

43 70

43 18

35 35 60 40 70

Btk, Bt subsp. kurstaki. Sp, spherical; Rm, rhomboidal; Cb, cuboidal; El, elliptical; Sl, spindle; Bp, bipyramidal. Major protein bands on SDS–PAGE gels.

Table 7 Percent of mortality and cry and vip gene profile present in the selected Bt strains Strain

Mortality%

LC50a (ng/cm2)

FL (95%)b

Gene profile identified by PCR analysis

Kon4 YD5 BR4 S90 BtK

97 100 83 78 81

157 141 210 215 215

129–182 121–179 168–251 176–266 181–272

1Aa, 1Ab, 1B, 1C, 1D, 1E, 1H, 2Aa, 9C, 9D, vip3A 1Aa , 1Ab, 1Ac, 1C, 1D, 1F, 1I, 2Aa, vip3A 1Aa, 1Ab, 1Ac, 1C, 1D, 1E, 1F, 1I, 2A,b, 9D, vip3A 1Aa, 1Ac, 1C , 1D, 1E, 1F, 1I, 9B, 9D, vip3A 1Aa, 1Ab, 1Ac, 1I, 1J, 2Aa, 2Ab, 9D

a b

Results are expressed as nanograms of toxin per square centimeter of surface. See also Materials and Methods. Fl95 min–max, 95% confidence limit.

224

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

ecosystems in Iran. This characterization contributes to an understanding of Bt diversity in Iran where no collection has been characterized previously. The great size of Iran, its different climatic regions, and diversity of insects provide the opportunity of isolating novel entomopathogenic bacteria. The Bt strain collection analyzed in this report represents a sample of this diversity. The present study, using universal and specific primers, reported a high diversity of Bt strains on the basis of cry1, cry2, cry9 and vip3Aa genes. The vip3Aa genes were the most frequently found in the Iranian strain collection. Vip3Aa proteins have a different host range, which includes several major Lepidoptera pests. The frequency of vip3Aa genes in Iranian strains seems to be higher than that of Bt strain collections previously analyzed (Arrieta et al., 2004; Estruch et al., 1996; Franco-Rivera et al., 2004). The most abundant cry genes tested in the Iranian strain collection were the cry2 genes following by the cry1 and cry9 genes. This distribution of cry genes was different from that reported for other Bt strain collections (Ben-Dov et al., 1997; Wang et al., 2003). Ben-Dov et al. (1997) presented an interesting PCR analysis of 215 Bt strains collected from soil samples from Israel, Kazakhstan, and Uzbekistan. They found that strains containing cry1 genes were the most abundant. Also, Chak et al. (1994) presented a PCR characterization of 225 Bt strains isolated from soil samples from Taiwan that showed a different cry gene distribution. They reported five different profiles of cry genes, and the cry1A genes were the most abundant in their collection, followed by the cry1C and cry1D genes. In our collection, however, cry1I, cry 1C, cry1D, cry1Ac, and cry1Aa were most abundant. We observed a higher frequency of cry9 genes (30%) than that reported from other collections (Ben-Dov et al., 1997; Bravo et al., 1998; Wang et al., 2003). The cry1I and cry1C genes were the most frequent within the cry1 gene family which coincide with the finding of Wang et al. (2003). The cry1B, cry1G, cry1H, andcry1K genes were not observed in our collection. The frequency of cry1E in the present study deviates from other published studies. For example, Bravo et al. (1998) and Wang et al. (2003) found few cry1E genes in their collection. Bravo et al. (1998) and Ben-Dov et al. (1999) detected cry9 genes in 2.6% and 10.2% of their Bt strain collections, respectively, whereas we found them in 30% of our collection. This difference in frequencies may reflect a real difference in prevalence of cry9 genes between the Iranian and Latin American collections. Our screening procedure identified three field-collected Bt isolates positive to universal primers but not to any of our specific primers for four cry9 genes. This may indicate that these isolates contain new cry9 genes. It is important to mention that all strains harbored more than one cry gene, suggesting that Bt strains have a high frequency of genetic information exchange (Bravo et al., 1998). Twenty-two distinct cry1 gene profiles were identified which indicates the high diversity in cry gene contents of the isolates. Most of these profiles were not reported in

previous publications (Wang et al., 2003; Bravo et al., 1998). The identification of known cry genes in the Bt strains is important, since the specificity of action is known for many of the Cry toxins. This identification allows the selection of native strains with the highest activity for use in the control of some target pests. Cry proteins are selectively active against certain insect species, therefore, strains containing several types of cry genes encoding highly active insecticidal crystal proteins (ICPs) might have a wider pest spectrum or increased activity. Based on morphological and molecular identification results, 20 strains containing Lepidopteran-specific active genes were selected as potentially active against Lepidoptera pests. These strains are good candidates in the search for biocontrol agents with a wider spectrum of action. The selected strains showed a wide range of toxicity, causing from 0% to 100% mortality. Strains harboring the same cry gene profiles but showing different activity against cotton bollworm larvae were identified. The results confirm that the presence of specific genes is not an accurate indicator of toxicity, because the genes could be inactive, under the control of an inefficient promoter or be expressed in a concentration too low to effect toxicity (Ferrandis et al., 1999; Masson et al., 1998). The four most toxic isolates were further bioassayed for LC50 estimation. Results in Table 7 show that four of the isolates evaluated in terms of biopesticide activity against H. armigera showed a similar or higher percentage mortality than the Btk strain. Two of these strains (YD5 and KON4), in spite of their similarity to the control strain (i.e., similar protein and plasmid profiles and similar cry and vip genes), caused higher mortality. These results emphasize again the importance of Bt native strain collections in the development of control strategies for native insects of agricultural interest. Heliothine species are rather tolerant to Cry toxins compared to many other Lepidopteran pests, and despite the high number of Cry proteins discovered to date, just a few have proven to be effective for their control (Estela et al., 2004). Cry1Ab, Cry1Ac, Cry2Aa, and Cry2Ab are the most toxic Cry proteins against H. armigera and H. zea and, along with Cry1Fa, against H. virescens and H. punctigera (Liao et al., 2002). The most active strains, mentioned above, have cry1Aa, cry1Ab, cry1Ac, cry1C, cry1D, cry1F, cry1I, cry2Aa orcry2Ab, cry9, and vip3Aa genes present within their genome. Most of the genes were previously reported as Heliothine-specific (Liao et al., 2002). This fact confirms the importance of using techniques such as PCR in strain characterization, previous to selection of a target insect to test novel strains activity. Also, these data support the idea that although a great variability in cry genes codifying for different Lepidopteran-specific active toxins exists in nature, one of the most effective combinations of proteins is that present in the Btk strain, containing Cry1, Cry2, and Cry9 toxins. Finally, some strains gave PCR products of different sizes when assayed with cry1C, cry1E, cry1J, cry9A, and

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

vip3a specific primers. These strains are candidates for harboring novel cry genes. The identification of putative novel Bt strains could be the first step for finding novel toxicities, since novel toxins may be toxic for new targets. The isolation and sequencing of novel cry genes should be encouraged once the target insect is identified and more evidence on the potential of novel toxins as biological control agents is available. The bioassay of the selected isolates against other pests, characterization of the observed potentially novel cry genes and the search for additional novel genes will be continued. Acknowledgments We wish to thank Dr. Khayam Nekoui, Dr. M. A. Hejazi and Dr. M. Kermani for their support, technical assistance and critical review of the manuscript. This work was supported by a grant from the Agricultural Research and Education Organization of Iran (AREO). References Anwar Hossain, M., Ahmad, S., Hogue, S., 1997. Abundance and distribution of Bacillus thuringiensis in the agricultural soil of Bangladesh. Journal of Invertebrate Pathology 70, 221–225. Arango, J.A., Romero, M., Orduz, S., 2002. Diversity of Bacillus thuringiensis strains from Colombia with insecticidal activity against Spodoptera frugiperda (Lepidoptera:Noctuidae). Journal of Applied Microbiology 92 (3), 466–474. Aronson, A.I., Shai, Y., 2001. Why Bacillus thuringiensis insecticidal toxins are so effective: unique features of their mode of action. FEMS Microbiology Letters 195, 1–8. Arrieta, G., Hernandez, A., Espinoza, A.M., 2004. Diversity of Bacillus thuringiensis strains isolated from coffee plantations infested with the coffee berry borer Hypothenemus hampei. Revista De Biologia Tropical 52 (3), 757–764. Ben-Dov, E., Zaritsky, A., Dahan, E., Barak, Z., Sinai, R., Manasherob, R., Khameaev, A., Troitskaya, E., Dubitsky, A., Berezina, N., Margalith, Y., 1997. Extended screening by PCR for seven cry-group genes from field-collected strains of Bacillus thuringiensis. Applied and Environmental Microbiology 63, 4883–4890. Ben-Dov, E., Wang, Q., Zaritsky, A., Manasherob, R., Barak, Z., Schneider, B., Khamraev, A., Baizhanov, M., Glupov, V., Margalith, Y., 1999. Multiplex PCR screening to detect cry9 genes in Bacillus thuringiensis strains. Applied and Environmental Microbiology 65, 3714–3716. Ben-Dov, E., Manasherob, R., Zaritsky, A., Barak, Z., Margalith, Y., 2001. PCR analysis of cry7 genes in Bacillus thuringiensis by the five conserved blocks of toxins. Current Microbiology 42, 96–99. Bravo, A., Sarabia, S., Lopez, L., Ontiveros, H., Abarca, C., Ortiz, A., Ortiz, M., Lina, L., Villalobos, F.J., Pena, G., Valdez, M.E.N., Soberon, M., Quintero, R., 1998. Characterization of cry genes in a Mexican Bacillus thuringiensis strain collection. Applied and Environmental Microbiology 64, 4965–4972. Ceron, J., Ortiz, A., Quintero, R., Guereca, L., Bravo, A., 1995. Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection. Applied and Environmental Microbiology 61, 3826–3831. Chak, K.F., Chow, C.D., Tseng, M.Y., Kao, S.S., Tuan, S.J., Feng, T.Y., 1994. Determination and distribution of cry-type genes of Bacillus thuringiensis isolates from Taiwan. Applied and Environmental Microbiology 60, 2415–2420.

225

Estela, A., Escriche, B., Ferre´, J., 2004. Interaction of Bacillus thuringiensis toxins with larval midgut binding sites of Helicoverpa armigera (Lepidoptera: Noctuidae). Applied and Environmental Microbiology 70 (3), 1378–1384. Estruch, J.J., Warren, G.W., Mullins, M.A., Nye, G.J., Craig, J.A., Koziel, M.G., 1996. Vip3A, a novel Bacillus thuringiensis vegetative insecticidal protein with a wide spectrum of activities against lepidopteran insects. Proceedings of the National Academy of Sciences of the UNITED States of America 93, 5389– 5394. Ferrandis, M.D., Juarez-Pe´rez, V.M., Frutos, R., Bel, Y., Ferre´, J., 1999. Distribution of cryI, cryII and cryV genes within Bacillus thuringiensis isolates from Spain. Systematic and Applied Microbiology 22, 179– 185. Franco-Rivera, A., Benintende, G., Cozzi, J., Baizabal-Aguirre, V.M., Valdez-Alarcon, J.J., Lopez-Meza, J.E., 2004. Molecular characterization of Bacillus thuringiensis strains from Argentina. Antonie van leeu 86, 87–92. Herandeza, C.S., Andrewa, R., Bela, Y., Ferre´a, J., 2005. Isolation and toxicity of Bacillus thuringiensis from potato-growing areas in Bolivia. Journal of Invertebrate Pathology 88, 8–16. Hofte, H.H., Whiteley, R., 1989. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiological Reviews 53, 242–255. Jua’rez-Pe’rez, V.M., Ferrandis, M.D., Frutos, R., 1997. PCR-based approach for detection of novel Bacillus thuringiensis cry genes. Applied and Environmental Microbiology 63, 2997–3002. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of basterophage T4. Nature 227, 680–685. Lecadet, M.M., Dedonder, R., 1971. Biogenesis of the crystalline inclusion of Bacillus thuringiensis during sporulation. European Journal of Biochemistry 23, 282–294. Lecadet, M.M., Chaufaux, J., Ribier, J., Lereclus, D., 1992. Construction of novel Bacillus thuringiensis strains with different insecticidal activities by transduction and transformation. Applied and Environmental Microbiology 58, 840–849. Liao, C., Heckel, D.G., Akhurst, R., 2002. Toxicity of Bacillus thuringiensis insecticidal proteins for Helicoverpa armigera and Helicoverpa punctigera (Lepidoptera: Noctuidae), major pests of cotton. Journal of Invertebrate Pathology 80, 55–66. Maduell, P., Callejas, R., Cabrera, K.R., Armengol, G., Orduz, S., 2002. Distribution and characterization of Bacillus thuringiensis on the phylloplane of species of piper (Piperaceae) in three altitudinal levels. Microbial Ecology 44 (2), 144–153. Masson, L., Erlandson, M., Pulstai-Carey, M., Brosseau, R., JuarezPerez, V.M., Frutos, R., 1998. A holistic approach for determining the entomopathogenic potencial of Bacillus thuringiensis strains. Applied and Environmental Microbiology 64 (12), 4782–4788. Meadows, M.P., Ellis, D.J., Butt, J., Jarrett, P., Burges, H.D., 1992. Distribution, frequency, and diversity of Bacillus thuringiensis in an animal feed mill. Applied and Environmental Microbiology 58 (4), 1344–1350. Obeidat, M., Hassawi, D., Ghabeish, I., 2004. Characterization of Bacillus thuringiensis strains from Jordan and their toxicity to the Lepidoptera, Ephestia kuehniella Zeller. African Journal of Biotechnology 3 (11), 226–622. Porcar, M., Jua’rez-Pe’rez, V.M., 2003. PCR-based identification of Bacillus thuringiensis pesticidal crystal genes. FEMS Microbiology Reviews 26, 419–432. Salehi Jouzani, G.R., Komakhin, R.A., Piruzian, E.S., 2005. Comparative study of the expression of the native, modified, and hybrid cry3a genes of Bacillus thuringiensis in prokaryotic and eukaryotic cells. Russian Journal of Genetics 41, 171–177. Schnepf, E., Crickmore, N., Van Rie, J., Lereculus, D., Baum, J., Feitelson, J., Zeigler, R.D., Dean, H.D., 1998. Bacillus thuringiensis and Its pesticidal crystal proteins. Microbiology and Molecular Biology Reviews 62, 775–806. Schnepf, H.E., Lee, S., Dojillo, J., Burmeister, P., Fencil, K., Morera, L., Nygaard, L., Narva, K.E., Wolt, J.D., 2005. Characterization of

226

A. Seifinejad et al. / Biological Control 44 (2008) 216–226

Cry34/Cry35 binary insecticidal proteins from divers Bacillus thuringiensis strain collections. Applied and Environmental Microbiology 71, 1765–1774. Thomas, W.E., Ellar, D., 1983. Mechanism of action of Bacillus thuringiensis var. israelensis insecticidal dendotoxin. FEBS Letters 154, 362–368. Uribe, D., Martinez, W., Ceron, J., 2003. Distribution and diversity of cry genes in native strains of Bacillus thuringiensis obtained from different

ecosystems from Colombia. Journal of Invertebrate Pathology 82, 119–127. Vilas-Boˆas, G.T., Lemos, M.V.F., 2004. Diversity of cry genes and genetic characterization of Bacillus thuringiensis isolated from Brazil. Canadian Journal of Microbiology 50, 605–613. Wang, J.A., Boets, J., VanRie, G., 2003. Characterization of cry1, cry2, and cry9 genes in Bacillus thuringiensis isolates from China. Journal of Invertebrate Pathology 82, 63–71.