Characterization of lipid-modified immunogenic proteins of Treponema pallidum expressed in Escherichia coli

Microbial Pathogenesis 1989 ; 7 : 175-188

Characterization of lipid-modified immunogenic proteins of Treponema pallidum expressed in Escherichia coli Leo M . Schouls, Robert Mout, Jan Dekker and Jan D . A . van Embden* Laboratory for Bacteriology, National Institute of Public Health and Environmental Protection, P.O. Box 1, 3720 BA Bilthoven, The Netherlands (Received March 28, 1989; accepted in revised form June 5, 1989)

Schouls, L . M . (Laboratory for Bacteriology, National Institute of Public Health and Environmental Protection, P .O . Box 1, 3720 BA Bilthoven, The Netherlands), R . Mout, J . Dekker and J . D . A . van Embden . Characterization of lipid-modified immunogenic proteins of Treponema pallidum expressed in Escherichia coli. Microbial Pathogenesis 1989 ; 7 :175-188 . This study describes the sequence of the immunodominant Treponema pallidum surface protein TpD and its expression in Escherichia coli. The translated TpD DNA sequence revealed the presence of a putative site for lipid-modification downstream from the signal sequence of this membrane protein . Growth of TpD-expressing E. coli in the presence of radioactive palmitic acid revealed that TpD was lipid-modified . Three other, previously characterized cloned proteins of T. pallidum were also lipid-modified . The N-termini of two of three sequenced T. pallidum proteins contain a tetrapeptide sequence characteristic for lipoproteins in Gram-negative bacteria : Leu-X-Y-Cys . Only TpD differed from this consensus sequence in the substitution of the first residue by Phe . The apparent high incidence of lipoproteins among E. coil recombinants expressing T. pallidum antigens suggest an important role of lipoproteins in the induction of humoral immunity during syphilitic infection . Key words : Treponema pallidum ; antigens; DNA sequence ; lipoproteins .

Introduction Although infection with Treponema pallidum results in a strong humoral and cellular immune reaction, this pathogenic spirochete is able to partially evade this response, as untreated syphilitic infection can persist for many years . However, during the course of infections, syphilitic patients as well as infected rabbits and hamsters develop protective immunity to reinfection with T. pallidum .` Passive transfer of antibodies from hyperimmune animals can lead to partial or complete protection against challenge ." with T. pallidum There is evidence to suggest that humoral as well as cellular immunity plays a role in the resistance to reinfection .' The long persistence of the micro-organism during natural or experimental infection in spite of the presence of high concentrations of circulating antibodies against T. pallidum might be explained by the inaccessibility of T. pallidum to antibodies due to adherence of host proteins 6 .' or mucopolysaccharides$ to the bacteria and/or to intracellular survival of small numbers of bacteria .'

Author to whom correspondence should be addressed . 0882-4010/89/090175+14 $03 .00/0

° 1989 Academic Press Limited



1 76

L. M . Schouls et al.

A better understanding of the structure and the composition of the cell envelope is required to explain the mechanisms by which the T. pa//idum can evade the host defence system . Because T. pallidum is cultivable only to a very limited extent, in vitro, 10,11 relatively little is known about the structure of the cell envelope of T. pa//idum . Like typical Gram-negative bacteria, T. pallidum is surrounded by an inner and outer membrane." However, a major difference with common Gram-negative bacteria is the apparent lack of lipopolysaccharide in the cell envelope .' 3-1 5 By surface labelling with radioactive iodine, subcellular fractionation, selective detergent extraction and by molecular cloning, various surface-associated proteins of T. pa//idum have been identified . The role of these proteins in the pathogenesis and protective immunity is presently unclear . Three surface proteins, P1, P2 and P3, have been identified that bind the host cell surface glycoprotein fibronectin, 16 suggesting that these proteins might act as cytadhesins during infection . Recently, Thomas et al." showed that, in vitro, T. pa//idum penetrates monolayers of endothelial cells by interjunctional passage . The molecular mechanism and the specific treponemal surface components involved in this process are presently unknown . Treponemal surface proteins like fibronectin-binding proteins might play a role in this invasive ability . T. pallidum antigen-expressing E. coli recombinants have been selected by their property to bind polyclonal or monoclonal antibodies induced by infection or by immunization with treponemes . 18-27 Most recombinant proteins thus selected have been found to be either membrane associated or to be excreted into the culture medium, suggesting that these proteins are the major immunogens of T. pallidum . One of the major immunogenic proteins of T. pallidum identified by crossed immunoelectrophoresis in agarose is TpD .28 Immuno-electron microscopy of methanol fixed bacteria indicate that TpD is a surface protein of T . pallidum . 28 TpD displays a characteristic heterogeneous behaviour during gel electrophoresis in that it migrates as a smear on SDS-PAGE corresponding to an apparent molecular weight of 26-32 kDa . In contrast, by isoelectric focussing, TpD appeared to migrate as a discrete band at pH 5 . 29 In agarose gel electrophoresis, TpD is manifest as a fast and a slowly migrating component and both components have been shown to carry virtually identical antigenic determinants . The anomalous behaviour of TpD on gels is irrespective of the host expressing TpD being either T. pallidum or E. coli carrying the TpD gene . Therefore it is unlikely that the apparent heterogeneity of TpD is caused by its interaction with particular host-specific components . Alternatively, TpD might be partially post- or co-translationally modified both in T. pallidum and in E. coli K-12 . In this study we report the DNA sequence of the TpD gene and we show that TpD is lipid-modified by acylation with palmitic acid . Furthermore we demonstrate that also two other previously described T. pallidum recombinant proteins, TmpA 30 and TpE 27 are palmitated in E. coil. These are the first lipoproteins described for T. pallidum . Results Inducible expression of TpD As previously described, 28 TpD is constitutively expressed in E. coli from a treponemal promoter present on a 4 .8 kb HindlII fragment of T. pallidum . To establish the direction of transcription and to be able to investigate post-translational modifications of TpD, we attempted to bring the TpD gene under the control of the thermo-inducible leftward promoter of bacteriophage lambda, P L . The 4 .8 kb HindIIl fragment of pRIT3217 was inserted into the P L -containing expression vector pPLc245 . Two representative plasmids, pRIT3260 and pRIT3261, carrying the 4 .8 kb fragment in opposite orientations, were chosen for further study .



T. pallidum lipoproteins

(A)

1 77

245 a

(B) pRIT3261

PL

b

3260 a b

3261 b

28810 a b

28925 o b

b

422 ATG

329 ATG

S/D

+m-o-

2885 a

28920 a b

28°C 42°C

--q

203 pRIT28810 226 pRiT2885

Cyt

pRIT28925 may+ 370 pRIT28920

ommt

f

-

Fig . 1 . Expression of TpD by various plasmid derivatives in E. coli. A: Western blot of lysates of heatinduced (b) and non-induced (a) E. coli carrying the various plasmid derivatives . The blot was developed with anti-T. pal/idum hyperimmune rabbit serum . The numbers above the lanes refer to the plasmids, pPLc245, pRIT3260, pRIT3261, pRIT28810, pRIT2885, pRIT28925, pRIT28920, respectively . T denotes the total lysate of T. pal/idum . B : Physical map and antigen expression at 28 and 42°C of pRIT3261 and its derivatives . The heavy arrow represents the position and direction of transcription of the lambda promoter P L . The open box denotes the vector part . The closed box, S/D, represents the Shine/Dalgarno region of the vector. The thin line represents the treponemal DNA . The numbers correspond with residue numbers as indicated in the DNA sequence (Fig . 2) and refer to the end points of the deletion mutants .

Unidirectional deletions of various sizes were introduced in these plasmids, extending just downstream from P L and the deletion mutants were analysed for TpD production at 28°C and 42°C (Fig . 1) . In contrast to derivatives of pRIT3260, a number of pRIT3261 deletion mutants showed a temperature dependent TpD expression indicating that the direction of transcription of the TpD gene in pRIT3261 is the same as that initiated by the P L -promoter of the vector . The exact size of the deletion of four deletion mutants was determined by sequencing (Fig . 1) . The level of TpD expression was difficult to quantitate as TpD could not be detected on polyacryl amide gels stained with Coomassie brilliant blue . Temperature induced TpD producing E. coil cells stopped growing soon after the temperature shift and their viability decreased about 100-fold within 2 h of induction, indicating that a high level of expression of TpD is lethal to E. coil (data not shown) .

Determination of the TpD sequence The nucleotide sequence of a 1049 by long fragment carrying the TpD gene was determined and is depicted in Fig . 2 . Analysis of the sequence revealed only one large open reading frame, containing two potential startcodons at base 329 and 422 . The pRIT3261-derived deletion mutants pRIT28925 and pRIT28920 were missing the bases 0-301 and 0-370, respectively . These deletions result in an out of frame fusion of the vector-derived start codon to the treponemal open reading frame . As the deletion mutant pRIT28925 did express TpD, whereas pRIT28920 did not, we concluded that



1 78

L. M . Schouls et al.

AGGTGTGGTCAGTCGAAGTACGGCACCGTGGATGCATGGGTGGAGTTTTGATTTTCTGGGCATCTACCCGAC 100 • CTATGAGGGTCTGGCCCCTCAAGCGTTTGTGGTGGCGTTGGTGGTGCTTTCGGCGGTATGGTGGTGTGGTGG 200 ;pRIT28810 TCTCTGCCGTGGCGCATCCAGCACGTAGGCTTGGGACGGCTGTGTCGCGTCCTACTGGGGCCGGGTGTGTGC ;pRIT2885 TGCGCCGTGGAGA TTTCCATTTGTTTTTC TATAAT GGTGAGGAAAAGAAGCGCTGGACGGGAGAAGGCGTTT -35 -10 300 pRIT28925 329 , TGAAAAGGAGGGGCGCGTGACGCCCCAGGGGAG TGAAGAATGAAGAGGGTGAGTTTGCTCGGGAGCGCAGCC S/D MetLysArgValSerLeuLeuGlySerAlaAla ;pRIT28920 . 400 ATTTTTGCGTTGGTTTTTTCCGCGTGCGGGGGCGGTGGAGAGCATCAGCACGGTGAGGAGATGATGGCCGCC I1ePheAlaLeuValPheSerAlaCysGlyGlyGlyGlyGluHisGlnHis61yGluGluMetMetAlaAla 500 GTTCCTGCTCCAGATGCAGAGGGGGCGGCCGGTTTTGATGAGTTTCCTATAGGCGAGGATCGGGATGTGGGG Va1ProAlaProAspAlaGluGlyAlaAlaGlyPheAspGluPheProIleGlyGluAspArgAspValGly CCCTTGCATGTGGGAGGGGTGTATTTTCAGCCGGTTGAGATGCATCCGGCTCCAGGAGCACAGCCGTCGAAG ProLeuHisValGlyGlyValTyrPheGlnProValGluMetHisProAlaProGlyAlaGlnProSerLys 600 • GAAGAGGCGGACTGTCACATAGAAGCGGATATCCACGCAAATGAGGCGGGTAAAGATTTAGGGTATGGAGTC GluGluAlaAspCysHisIleGluAlaAspIleHisAlaAsnGluAlaGlyLysAspLeuGlyTyrGlyVa1 700 GGGGATTTTGTGCCGTATCTCCGAGTTGTTGCTTTCCTCCAGAAGCATGGCTCTGAGAAGGTGCAAAAGGTG SlyAspPheValProTyrLeuArgValValAlaPheLeuGlnLysHisGlySerGluLysValGlnLysVa1 ATGTTTGCGCCCATGAACGCAGGGGACGGTCCGCATTATGGGGCGAACGTGAAGTTTGAAGAGGGGCTTGGT MetPheAlaProMetAsnAla6lyAspGlyProHisTyrGlyAlaAsnValLysPheGluGluGlyLeuGly 800 ACGTACAAGGTACGTTTCGAGATCGCTGCACCCTCGCATGATGAGTACTCGCTACATATTGATGAGCAAACT ThrTyrLysValArgPheGluIleAlaAlaProSerHisAspGluTyrSerLeuHisIleAspGluGlnThr 900 GGGGTTTCCGGAAGGTTCTGGAGCGAGCCATTAGTTGCAGAGTGGGATGATTTTGAATGGAAGGGGCCTCAG G1yValSerGlyArgPheTrpSerGluProLeuValAlaGluTrpAspAspPheGluTrpLysGlyProGln 1000 TGGTAGGGACGTTCAGAAGGTCCGAGGGTGCGCGCGCATAAGGGCGTTCTTTGTTCAGTAAGACAGGCGGGT Trp AGTGGCAGTGCGTGGCGCTGCTCGCCGGGTCCGTTTTGAG Fig . 2 . Nucleotide sequence of the treponemal DNA segment carrying the TpD gene and the amino acid sequence of TpD . Amino acids printed in italics represent the presumed signal peptide . The putative -35, -10 sequences and ribosome binding site (S/D) are shown along the sequence . The end points of the treponemal DNA in the deletion derivatives of pRIT3261 are given by plasmid designation .

the ATG at residue 329 is the start codon of the TpD-gene . pRIT28925 expressed TpD to a significantly lower level, compared to pRIT28810 and pRIT2885 . This might be due to steric hindrance of ribosomes initiating TpD translation by ribosomes that initiate translation from the vector derived Shine-Dalgarno sequence, which is only 25 by upstream from the TpD ribosomal binding site . The structural gene of TpD therefore contains 612 by and it encodes for a polypeptide of 204 amino acids with a calculated molecular weight of 22 .1 kDa and an isoelectric point of 4 .46 . As shown in Fig . 1, deletions in pRIT3261 downstream from base 203 affected expression of TpD



T. pallidum lipoproteins

1 79

at 28°C . This indicates that the T. pallidum sequences essential for transcription of the TpD gene in E. coil are located in an approximately 125 by long region upstream from the start codon . Localization of TpD in E . coli and in T. pallidum Using immuno-electron microscopy we previously demonstrated that purified antiTpD antibodies adhered to the surface of methanol-fixed T. pallidum bacteria ." In order to investigate further the cellular localization of TpD in T. pallidum as well as in E. coil, the presence of TpD in subcellular fractions was analysed . E. coli cells carrying plasmid pRIT2885 or the expression vector pPLc245 were disrupted by ultrasonic treatment and cell envelopes were isolated . The cytoplasmic and outer membranes of the cell envelopes were separated on sucrose gradients and the fractions of the gradients were analysed on Coomassie brilliant blue stained SDSPAGE gels and Western blots using hyperimmune rabbit antiserum against T. pallidum . TpD could not be detected by Coomassie brilliant blue staining [Fig . 3(b)] . However, the Western blot [Fig . 3(a)] revealed that TpD was present in the cytoplasmic fraction as well as in the cell envelope fraction of E. coil . After separation of the membranes of TpD producing E. coli the antigen was found to be predominantly present in the outer membrane fractions [Fig . 3(a)] . In T. pallidum TpD was found exclusively in the crude cell envelope fraction (Fig . 4) . Lipid-modification of TpD Translation of the TpD sequence reveals a strongly hydrophobic N-terminal amino acid sequence of 19 amino acids with two charged residues just behind the N-terminal methionine . Such a sequence is characteristic for a leader sequence of proteins to be transported across the cytoplasmic membrane . 31 Furthermore, residue 20 is a cysteine, an amino acid which is invariably found as an N-terminal amino acid in processed lipoproteins and which is the attachment site for fatty acids in prokaryotic lipoprotein S . 12 To investigate whether or not fatty acids are covalently coupled to TpD, E. coil carrying plasmid pRIT2885 was metabolically labelled with [ 14 C]-palmitic acid . The proteins of the labelled cells were separated by SDS-PAGE and electroblotted onto nitrocellulose and analysed by fluorography . The fluorogram revealed the presence of a labelled protein species, visible as a smear in the molecular weight range of 26-32 kDa, characteristic for TpD (Fig . 5) . No such labelled protein smear was observed when cells carrying the expression vector pPLc245 were labelled with palmitic acid . These data strongly suggest that TpD is post-translationally labelled with palmitic acid . Further support for lipid-modification was obtained from labelling experiments in the presence of globomycin . This antibiotic blocks the cleavage of the signal sequence from the acylated prolipoprotein by specific inhibition of the signal peptidase II . As a result of the presence of globomycin during palmitate labelling, TpD migrated as a more or less discrete band during SDS-PAGE with an apparent molecular weight of about 30 kDa (Fig . 5) . Such an increase in apparent molecular weight is to be expected from a precursor form of TpD, the signal peptide of which is not cleaved off . As mentioned above, TpD is separated by electrophoresis in agarose into a fast and a slowly migrating component . We investigated whether or not this heterogeneity might be related to the acylation of TpD . In order to identify the two components with the different mobilities, crossed immuno-electrophoresis was performed with a sonicate of TpD-producing E. coli cells, metabolically labelled with radioactive palmitic acid . As shown in Fig . 6 incorporation of radioactive label was found only in the slowly migrating TpD component, indicating that the fast migrating component is not acylated by palmitic acid .



180

L. M . Schouls et al.

2885 (A)

a

b

C

245 d

s

a

b

d

C

e

92 .5

68 .2 45 . 0

31 .0

21.5 14.4

2885

245

Fig . 3 . Distribution of TpD in the outer and cytoplasmic membrane fractions of E. coli. Temperatureinduced E. coli cells carrying either pRIT2885 or the vector pPLc245 were fractionated by differential and sucrose gradient centrifugation and analysed by Western blotting (A) using an anti-T . pallidum hyperimmune rabbit antiserum and by Coomassie brilliant blue-stained (B) polyacrylamide gels . (a), unfractionated E. coli cells; (b), soluble fraction after sonification ; (c), membrane fraction after sonification ; (d), outer membrane fraction ; (e), cytoplasmic membrane fraction . M, molecular weight markers (kilodaltons) . Each slot was loaded with protein extracts, derived from either 2.10 7 E. coli cells (A) or 108 cells (B) .

Pa/mitic acid acylation of other T . pallidum antigens Similar to TpD, one other previously described antigen, TpE, expressed either in T . pallidum or in E. coli displayed a heterogeneous behaviour on SDS-PAGE . 27 This similarity prompted us to investigate whether TpE might be lipid-modified like TpD . As shown in Fig . 5, TpE was metabolically labelled with radioactive palmitic acid and globomycin interfered with the processing of TpE . Based on the previously established DNA sequence, 30 we suspected that the T . pallidum membrane protein, TmpA, might be another lipoprotein candidate because the hydrophobic signal sequence of TmpA is followed directly by a cysteine residue . Addition of [ 14 C]-palmitic acid to the growth medium of E. coli cells carrying plasmid



T. pa//idum lipoproteins

1 81

n

I a

a

b

200 . 0

92 . 5 66 . 2

45 .0

31 . 0

21 . 5

14 . 4 Fig . 4 . Partitioning of TpD in the cell envelope and cytoplasmic fraction of disrupted T. pallidum after subcellular fractionation by differential ultracentrifugation . (a), cytoplasmic fraction; (b), crude cell envelope . The Western blots were immuno-stained with a nti-T. pa //idum rabbit antiserum(l) and with the anti-TpD monoclonal antibody HATR1 .3 (II) .

pRIT4661 resulted in labelling of TmpA expressed by this plasmid and the processing of TmpA was completely inhibited by globomycin (Fig . 5) . pRIT4661 expresses also a second T. pallidum membrane protein, TmpB and this protein was not palmitated . Discussion From the DNA sequence determined in this study we conclude that TpD is a protein consisting of 204 amino acids . As TpD is expressed in E. coli independent of host expression signals from an insert carrying only a 126 by long sequence upstream from the start codon, this region of treponemal DNA carries the transcriptional and translational signals . The sequences downstream from residue 225 and 236 strongly ." The location resemble the -35 and -10 consensus promoter sequences of E. coli of these putative promoter sequences is in accordance with the finding that plasmid pRIT28810 (starting at residue 203) does and pRIT2885 (starting at residue 226) does not give rise to TpD production at 28°C . In an attempt to find a possible function of the TpD protein, we compared the translated DNA sequence of the TpD gene with the amino acid sequences of the PIR and Swissprot protein banks . No significant homology with any of the proteins in the database was found . Furthermore we were unable to find any significant homology of the TpD DNA sequence with any DNA sequence in the NIH genbank database version v . 56 . Examination of the deduced TpD amino acid sequence shows the presence of a potential signal sequence and a cysteine at residue 20 . As lipid modification in bacterial lipoproteins generally occurs at a cysteine residue downstream from the signal sequence, we investigated whether or not TpD was post- translationaIly modified . We



182

L . M . Schouls eta[ A a

B b

a

D

C b

a

b 66 .2-

66 . 2-

45 .045 .031 . 0-

31 .0-

Fig . 5 . Incorporation of [ 14 C] -palmitic acid in E. coli expressing TpD, TpE or TmpA in the absence (a) or in the presence (b) of globomycin . Exponentially growing cells were incubated for 3 h in the presence of radioactive palmitic acid and analysed by SDS-PAG E and autoradiography . A : Tpd producing E. coli carrying pRIT2885 ; B : TpE producing E. coli carrying pRIT9110; C : E. coli carrying pPLc245 (control) ; D : TmpA and TmpB producing E. coli carrying pRIT4661 . The arrows indicate the positions of mature TmpA (42 kDa) and TmpB (34 kDa), respectively .

demonstrated that TpD was metabolically labelled with palmitic acid, indicating that TpD is indeed lipid-modified . Therefore the modification of TpD in E. coli appears to occur via a mechanism similar to that of the murein lipoprotein of E. co/i, 32 also called Braun's lipoprotein . If so, the cys-20 residue of TpD would be the acceptor for a thioether bond with glycerol resulting in a prolipoprotein, which would subsequently be modified by addition of fatty acids and cleaved by the signal peptidase II which specifically cleaves off the lipoprotein signal sequence . We showed that globomycin inhibited maturation of TpD, which is consistent with the idea that TpD is lipidmodified similar to E. coil murein lipoprotein . The presumed signal peptide of TpD

(a)

(b)

Fig . 6. Immunoprecipitation of [ 74C]palmitated TpD by hyper-immune anti-T . pallidum rabbit antiserum . Lysates of metabolically labelled E. coil cells expressing TpD were subjected to agarose gel electrophoresis (first dimension) and immunoprecipitated during electrophoresis in the presence of antiserum (second dimension) . The immunoprecipitates were visualized by Coomassie brilliant blue staining (a) and by autoradiography of the dried gel (b) .



1 83

T. pa//idum lipoproteins

Ipp TpD TmpA TmpC TmpB

M K M M N A V R M K T

A K H E

T K L V R V S L T L V Y K W V R R N F S L

L L S A P

G G G F S

A S V A A

V A A A L

I A L V Y

L I A F V

G F C C L

S A A A L

T L A M G

L L V F M L L L V P

A S G I L

G A S G V

C C C C S

S G A S A

Fig . 7 . N-terminal amino acid sequences of the T. pallidum recombinant proteins TpD, TmpA, TmpC and TmpB with that of the murein E. coli lipoprotein (Ipp) . The amino acids are presented in the one letter code . The boxed area represents the tetrapeptides homologous with the lipoprotein consensus tetrapeptide LeuX-Y-Cys .

carries the tetrapeptide, Phe-Ser-Ala-Cys at residues 17 to 20 . The consensus tetrapeptide sequence for lipoproteins in Gram-negative bacteria is Leu-X-Y-Cys, in which X and Y are small non-charged amino acids. The TpD tetrapeptide differs from this consensus sequence in the first residue, being Phe in stead of Leu . Although many amino acid substitutions in the tetrapeptide and the region flanking this tetrapeptide have been tested, 32 to our knowledge no replacement of Leu to Phe has been tested so far . As the cloned T. pallidum antigen TpE behaved similar to TpD, with respect to its heterogeneous mobility in polyacrylamide gels, we rightly suspected TpE to be lipid-modified as well . Surprisingly, the treponemal membrane protein TmpA was also metabolically labelled by palmitic acid . In contrast the membrane protein TmpB, the structural gene of which is part of the same operon as the tmpA gene, was not metabolically labelled . Preliminary sequence data on the previously described recombinant antigen TmpC revealed that TmpC carries a putative signal sequence and a consensus lipoprotein tetrapeptide (unpublished observations) . Consistently we found that TmpC is metabolically labelled by palmitic acid (unpublished observations) . The N-terminal amino acid sequences of the cloned T. pallidum membrane proteins TpD, TmpA, TmpB and TmpC are depicted in Fig . 7, together with that of murein lipoprotein of E. co/i. No such sequence is yet available of TpE . The N-terminal sequences TpD, TmpA, TmpB, TmpC and E. coil murein lipoprotein show the presence of characteristic signal sequences plus a consensus lipoprotein tetrapeptide, except for protein TmpB which lacks such a tetrapeptide in the leader sequence . The relatively high incidence of lipoproteins among E. coil recombinants, selected from a T. pa//idum cosmid gene library" using serum from syphilis patients, is striking and might reflect a major role of lipoproteins in inducing an immune response to a syphilitic infection . We previously described that the apparent heterogeneity of TpD in agarose gels is found in E. coil as well as in T. pallidum ." In this study we showed that in agarose only the slowly migrating component of TpD was labelled with palmitic acid, indicating that in E. coli TpD is only partially lipid-modified . We previously demonstrated that the apparent heterogeneity is irrespective of the host expressing TpD, being either E . coil or T. pallidum, Therefore, we infer that the partial modification of TpD is not likely due to an inadequate recognition by the E. coli machinery of protein synthesis, but probably reflects a property inherent in TpD . Although the partial lipid-modication of TpD explains its heterogeneous mobility in agarose gels, its heterogeneous behaviour during SDS-PAGE remains unexplained . Apparently the smear formation is not a characteristic property of T. pallidum lipoproteins as TmpA and TmpC migrate as discrete bands in SDS-PAGE . Because TpD and TpE are found as single discrete bands after iso-electric focussing, 29 both antigens are homogeneous with respect to their nett charge . The heterogeneous behaviour on SDS-PAGE might be due to different lipid-modifications, resulting in different binding capacities for SDS and/or different molecular mass . Another possible explanation for the apparent heterogeneity



1 84

L . M . Schouls eta[

on SDS-PAGE might be complexation of the antigen resulting in complexes of different sizes . Fractionation of the cell envelope of TpD producing E. coil revealed that this antigen was predominantly present in the outer membrane and not in the cytoplasmic membrane . It should be noted however, that fractionation of membranes can cause redistribution of proteins and therefore lead to misinterpretation of the location of certain proteins . Nevertheless the result obtained is consistent with our previous observation that methanol fixed T. pallidum cells are surface labelled with TpD specific antibodies28 and with the observations of Swancutt et al." on the cloned 34 kDa T. pallidum protein, which is identical to TpD, because the monoclonal antibodies 3B5, 10G2 and 9B12 react with both TpD and the 34 kDa protein (Norgard, personal communication) . Swancutt et al. 18 showed that after iodination of intact T. pallidum with 125 1 using lactoperoxidase, a procedure which preferentially labels surface exposed-proteins, the 34 kDa protein was radiolabelled . Further evidence for the membrane association of TpD stems from the phase-partitioning experiments with the non-ionic detergent Triton X-1 14 as described by Radolf et al ." who identified the 34 kDa T. pallidum protein in the detergent phase . Because TpD is lipid-modified, it seems likely that TpD is anchored in the outer membrane by its hydrophobic Nterminal lipid tail . Indirect fluorescence of intact E. coli cells producing TpD using antibodies against T. pallidum resulted in a strong fluorescence, indicating that TpD is surface exposed when expressed in E. coli (data not shown) . Despite the characterization of the lipoproteins TpD, TpE, TmpA and TmpC, their function in T. pallidum remains unclear . Given the overall similarities of the cell wall of T. pallidum and Gram-negative bacteria it would be conceivable that these lipoproteins have a similar function . As no N-terminal lysin is present in the sequenced T. pallidum lipoproteins it seems unlikely that these lipoproteins are anchored to the peptidoglycan layer in a similar fashion to the E. coli murein lipoprotein . However, experiments to substantiate this supposition have not yet been performed . Because of the surface labelling in the fluorescence experiments with TpD producing E. coil it seems more likely that the lipid terminus is anchored in the outer membrane and the hydrophilic protein part exposed to the surface of the spirochete . T. pallidum surface antigens like lipoproteins might play a role in protective immunity . Among the four lipoproteins identified in this study, TpD and TmpA have previously been shown to induce a strong humoral immune response during a syphilitic infection . Preliminary studies suggest that several T. pallidum lipoproteins induce proliferation of T-cells from experimentally infected rabbits (Lukehart and Schouls, unpublished) . Certain synthetic lipids like dimethyldioctadecylammoniumbromide (DDA) bound to proteins, strongly enhance the T-cell response to these proteins . 35 .35 It is conceivable that the lipid moiety of bacterial lipoproteins, like the ones described in this study, act as an immunoadjuvant during a natural or experimental infection . Therefore, lipoproteins might be interesting candidates in the development of a vaccine against syphilis . Materials and methods Bacterial strains and plasmids . The Nichols strain of T. pallidum was used as described before ." The E. coli K-12 strains and plasmids used in this study are listed in Table 1 . Media and reagents . NZYM medium and NZYM agar40 supplemented with ampicillin (100 pg/ml in solid medium ; 200 pg/ml in liquid medium) and/or kanamycin (30 pg/ml) were used for cultivating E. coli K-12 . All enzymes used were from Boehringer (GmbH, Mannheim) and were used according to the instructions of the manufacturer .



1 85

T . pa//idum lipoproteins Table 1 E. coil K-12 strains and plasmids used in this study Strain/plasmid E. coli strains SC181 M1034 J M 101 Plasmids pEMBL9 pPLc245 pCP3 pC1857 pRIT3217 pRIT3260 pRIT3261 pRIT28810 pRIT2885 pRIT28925 pRIT28920 pRIT3271 pRIT9103 pRIT9110

Relevant properties

Reference

/eu, thi, thr, hsdR, hsdM, supE SC 181, carrying plasmid pC1857 A(lac pro), sup E, thi, F, tra D36, proAB, /ac l0, ZAM15

30 30 37

cloning vector, amp, lacZ expression vector, amp, contains lambda promoter PL, ribosome binding site and ATG startcodon expression vector, amp, contains lambda promoter PL repressor plasmid, kan, contains thermosensitive C1857 repressor gene pBR327 carrying the Hindlll fragment of pRIT320027 pPLc245 carrying the Hindlll fragment of pRIT3217 pPLc245 carrying the Hindlll fragment of pRIT3217 Ba/31 deletion of pRIT3261 Ba/31 deletion of pRIT3261 Ba/31 deletion of pRIT3261 Ba/31 deletion of pRIT3261 pEMBL9 carrying the Hindlll fragment of pRIT3217 BstEll deletion of pRIT91 0027 pCP3 carrying the BamHI fragment of pRIT9103

37 38 39 39 28 This study This study This This This This This

study study study study study

This study This study

Sheep anti-rabbit immunoglobulins labelled with horseradish peroxidase was kindly provided by Dr J . Nagel (Bilthoven) . Rabbit anti-mouse immunoglobulins was from DAKO laboratories, Copenhagen . Polyclonal anti-T, pallidum antiserum K1339 was obtained from a rabbit intratesticularly innoculated with 108 T. pallidum . The monoclonal anti-TpD antibodies HATR1 .3 were kindly provided by P . Hinderson (Denmark) . [U-14C]palmitic acid 3 .7 MBq/ml was from Amersham International . The solvent in the palmitic acid solution was removed by evaporation and the fatty acid redissolved in 0 .4% Triton X-100 to a concentration of 1 .85 MBq/ml . Globomycin was kindly provided by Dr M . Arai, Sankyo, Tokyo . DNA technology. Plasmid isolation and DNA manipulations were performed essentially as described by Maniatis et al40 The dideoxy chain-termination technique for nucleotide sequencing of double-stranded DNA41,42 was used to determine the nucleotide sequence of both strands of the DNA . Construction of plasmids . The 4 .8 kb Hindlll fragment of pRIT321728 was inserted into the Hindlll site of the expression vector pPLc245 in two opposite orientations resulting in the plasmids pRIT3261 and pRIT3260, respectively . The deletion mutants pRIT28810, pRIT2885, pRIT28925 and pRIT28920 were made by digesting plasmid pRIT3261 successively with BstEll, Ba/31 nuclease and Sail followed by Klenow DNA polymerase I treatment to fill in the 3' protruding ends . The mixture was ligated and transformed to strain M1034 . Deletions of pRIT3260 were constructed by digestion of pRIT3260 with Xho l, treatment with Ba131, Klenow DNA polymerase I and BstEII, respectively . The resulting fragments were isolated and ligated into the vector containing fragment of pRIT3260 treated with Xbal, Aval, Klenow DNA polymerase I and Bst Ell . The ligation mixture was then transformed to strain M1034 . Plasmid pRIT3271 was constructed by inserting the 4 .8 kb fragment of pRIT321728 into the Hind Ill site of the vector pEMBL9 . Deletion mutants used for DNA sequencing were constructed



186

L . M . Schouls et al.

by digesting pRIT3271 with BstEII, Ba/31 and BamHl, respectively followed by Klenow DNA polymerase I treatment and ligation . The mixture was then transformed to E. coli JM101 . The plasmid expressing TpE, pRIT9103, was constructed by BstEll digestion of pRIT91 0027 followed by religation and transformation to strain SC181 . The TpE gene containing 4 kb BamHI fragment of pRIT9103 was isolated and inserted into the BamHl digested runaway expression vector pCP3 and transformed into strain M1034 . The plasmid resulting from this subcloning was designated pRIT91 10 . Detection of treponemal antigens . Treponemal antigens were separated by SDS-PAGE, electroblotted onto nitrocellulose (BA 83, Schleicher and Schuell, GmbH, Dassel) and detected by binding of antibodies as described previously ." SDS-PAGE was performed essentially according to Laemmli 43 using 13% polyacrylamide gels . Subcellular fractionation of T . pallidum and E . coli recombinants . About 5 .109 urografine purified T. pallidum cells were resuspended in 1 ml of 10 mm Tris-HC1 pH 7 .2 and disrupted by ultrasonic treatment . The disrupted cells were centrifuged for 10 min at 1500xg to remove intact cells and crude cell envelopes were prepared by centrifugation of the disrupted cells at 150000xg for 2 h . The cytoplasmic and outer membrane of the E . coli recombinants were separated according to the method of Osborn . 44 Briefly, cells were sonified and intact cells were removed by centrifugation at 1500xg . The supernatant was centrifuged at 150000xg for 2 h to spin down the cell envelope . The pellet was resuspended and fractionated by equilibrium centrifugation in a 30 to 60% sucrose gradient for 40 h at 80000 g in a SW 27 .1 Beckman swing out rotor . Protein labelling with radioactive palmitic acid. 50,ul of [U- 14 C] palmitic acid (1 .85 MBq/ml) in 0 .4% Triton X-1 00 was added to 500 µl of exponentially growing E. coli cells, carrying either recombinant plasmids or vector DNA, in NZYM medium at 28°C . The temperature was raised to 42°C and the culture was incubated at this temperature for 3 h . Cells were centrifuged and lysed in SDS-PAGE sample buffer. In some experiments globomycin was added to 100 µg/ml just prior to heat induction . Crossed immuno electrophoresis . Crossed immuno electrophoresis was performed as described by Axelsen, 45 except that 1 % of the detergent polyoxethylene alcohol (Cl 0E7, Nicco chemicals, Tokyo) was included in the gel and the sample as described ." The antigen used for these experiments consisted of a mixture of lysates of [ 14 C] palmitic acid labelled and non-labelled heat-induced TpD-expressing E. coil cells, carrying plasmid pRIT2885 . The non-labelled cells were used as carrier for the immunoprecipitation . The second dimension gel contained 10% of the hyperimmune anti-T . pallidum rabbit antiserum K1339 .

We thank Frits Mooi, Joen Luirink and Bert Verhey for stimulating discussions and advice . We thank Sheila Lukehart for permission to cite unpublished results.

References 1 . Magnusson HJ, Thomas EW, Olansky S, Kaplan BI, de Mello L, Cutler JC . Inoculation syphilis in human volunteers . Medicine (Baltimore) 1956 ; 35 : 33-82 . 2 . Turner TB, Hollander DH . Biology of the Treponematoses . World Health Organization Monograph Series No . 35 . Geneva : World Health Organization . 3 . Turner TB, Hardy PH, Newman B, Nel EE. Effects of passive immunization on experimental syphilis in the rabbit . Hopkins Med J 1973; 133 : 241-51 . 4 . Perine PL, Weisser RS, Klebanoff SJ . Immunity to syphilis . I . Passive transfer in rabbits with hyperimmune serum . Infect Immun 1973; 8 : 787-90 . 5 . Lukehart SA, Baker-Zander SA, Sell S . Characterization of lymphocyte responsiveness in early experimental syphilis . I . In vitro response to mitogens and Treponema pallidum antigens . J Immuno) 1980; 124 : 454-60 . 6 . Christiansen S . Hypothesis . Protective layer covering pathogenic treponemata . Lancet 1963 ; ii : 423-4 . 7 . Alderete JF, Baseman JB . Surface associated host proteins on virulent Treponema pallidum. Infect Immun 1979 ; 26 :1048-56 . 8 . Fitzgerald TJ, Johnson RC, Ritzi DM . Relationship of Treponema pallidum to acidic mucopolysaccharides . Infect Immun 1979 ; 24 : 252-60 .



T . pallidum lipoproteins

187

9 . Sykes JA, Miller JN, Kalan AJ . Treponema pallidum within cells of a primary chancre from a humal female . Br J Vener Dis 1974 ; 50 : 40-4 . 10 . Fieldsteel AH, Cox DL, Moeckli R . Cultivation of virulent Treponema pallidum in tissue culture. Infect Immun 1981 ; 32 : 908-15 . 11 . Norris SJ . In vitro cultivation of Treponema pallidum in tissue culture : independent confirmation . Infect Immun 1982 ; 36 : 437-9 . 12 . Hovind-Hougen K . 1983 . Morphology . In : Schell RF, Musher DM, eds . Pathogenesis and Immunology of Treponemal Infection . New York and Basel : Marcel Dekker ; 3-22 . 13 . Penn CW, Cockayne A, Bailey MJ . The outer membrane of Treponema pallidum : Biological significance and biochemical properties. J Gen Microb 1983 ; 131 : 2349-57 . 14 . Radolf JD, Norgard MV . Pathogen specificity of Treponema pallidum subsp . pallidum integral membrane proteins identified by phase partitioning with Triton X-114 . Infect Immun 1988 ; 56 : 1825-8 . 15 . Hardy PH, Levin J . 1983 . Lack of endotoxin in Borrelia hispanica and Treponema pallidum . Proc Soc Exp Biol Med 1983; 174 : 47-52 . 16 . Baseman JB, Hayes EC . Molecular characterization of receptor binding proteins and immunogens of virulent Treponema pallidum. J Exp Med 1980; 151 : 573-86 . 17 . Thomas DD, Navab M, Haake DA, Fogelman AM, Miller JN, Lovett MA . Treponema pallidum invades intercellular junctions of endothelial cell monolayers . Proc Natl Acad Sci USA 1988 ; 85 : 3608-12 . 18 . Swancutt MA, Twehous DA, Norgard MV . 1986 . Monoclonal antibody selection and analysis of a recombinant DNA-derived surface immunogen of Treponema pallidum expressed in Escherichia coli. Infect Immun 1986; 52 :110-19 . 19 . Stamm LV, Folds JD, Bassford PJ . Expression of Treponema pa//idum antigens in Escherichia coli K12 . Infect Immun 1982 ; 36 : 1238-41 . 20 . Norgard MV, Miller JN . Cloning and expression of Treponema pa//idum (Nichols) antigen genes in Escherichia coli. Infect Immun 1983 ; 42 : 435-45 . 21 . Peterson KM, Baseman JB, Alderete JF . Isolation of a Treponema pallidum gene encoding immunodominant outer envelope protein P6, which reacts with sera from patients at different stages of syphilis . J Exp Med 1986 ; 164 :1160-70 . 22 . Peterson KM, Baseman JB, Alderete J F . Cloning structural genes for Treponema pallidum immunogens and characterisation of recombinant treponemal surface protein, P2* (P2 star) . Genitourin Med 1987 ; 63 : 289-96 . 23 . Rodgers GC, Laird WJ, Coates SR, Mack DH, Sninsky JJ . Serological characterization and gene localization of an Escherichia coli expressed 37-kilodalton Treponema pallidum antigen . Infect Immun 1986;53 :16-25 . 24 . Hsu P, Qin M, Norris SJ, Sell S . Isolation and characterization of recombinant Escherichia coli clones secreting a 24-kilodalton antigen of Treponema pa//idum. Infect Immun 1988; 56 : 1135-43 . 25 . Noordhoek GT, Hermans PWM, Paul AN, Schouls LM, van der Sluis JJ, van Embden JDA . Treponema pallidum subspecies pallidum (Nichols) and Treponema pallidum subspecies pertenue (CDC 2575) differ in at least one nucleotide : comparison of two homologous antigens . Microbial Pathogenesis 1989;6 :29-42 . 26 . Walfield AM, Hanff PA, Lovett MA . Expression of Treponema pallidum antigens in Escherichia coli. Science 1982 ; 216 : 522-523 . 27 . Van Embden JDA, van der Donk HJ, van Eyk RVW, et al. 1983 . Molecular cloning and expression of Treponema pallidum DNA in Escherichia coli K-12 . Infect Immun 1983 ; 42 :187-96 . 28 . Hinderson P, Cockayne A, Schouls LM, van Embden JDA . Immunochemical characterization and purification of Treponema pallidum antigen TpD expressed by Escherichia coli K-12 . Sex Trans Dis 1986 ;13 :237-44 . 29 . Norris SJ, Alderete JF, Axelsen NH et al. Identity of Treponema pallidum subsp . pa//idum polypeptides : Correlation of sodium dodecyl sulfate polyacrylamide gel electrophoresis results from different laboratories . Electrophoresis 1987 ; 8 : 77-92 . 30 . Hansen EB, Pedersen PE, Schouls LM, Severin E, van Embden JDA . Genetic organization and partial sequence determination of a Treponema pallidum operon expressing two immunogenic membrane proteins in Escherichia coli. J Bacteriol 1985; 162 : 1227-37 . 31 . Von Heine G . Patterns of amino acids near signal sequence sites . Eur J Biochem 1983 ; 133 : 17--21 . 32 . Wu HC, Tai PC . Protein secretion and export in bacteria . Curr Top Microbiol Immunol 1986 ; 125 . 33 . Rosenberg M, Court D . Regulatory sequences involved in the promotion and termination of RNA transcription . Annu Rev Genet 1979 ; 13 : 319-53. 34 . Radolf JD, Chamberlain NR, Clausell A, Norgard MV . Identification and localization of integral membrane proteins of virulent Treponema pallidum subsp. pallidum by phase partitioning with the nonionic detergent Triton X-114 . Infect Immun 1988 ; 56 : 490-8. 35 . Snippe H, Willers JMN, Inman JK, Merchant B . The specificity of antibody formation in mice following immunization with hapten-carrier complexes mixed with the surfactant dimethyl dioctadecyl ammonium bromide . Immunology 1980 ; 39 : 361-66 . 36 . Smith RH, Ziola B . CY and DDN immunopotentate the DTH response to inactivated enveloped viruses . Immunology 1985 ; 58 :245-50 . 37 . Dente L, Sollazzo M, Baldari C, Cesareni G, Cortese R . 1985 . The pEMBL family of single stranded vectors . In : Glover DM, ed . DNA Cloning . Vol . 1 Oxford : IRL Press; 101-7 .



188

L. M . Schouls et al.

38 . Remaut E, Stanssens P, Fiers W . Inducible high level synthesis of mature fibroblast interferon in Escherichia co/i. Nucleic Acids Res 1983 ; 11 : 4677-88 . 39 . Remaut E, Tsao H, Fiers W . Improved plasmid vectors with a thermoinducible expression and temperature-regulated runaway replication . Gene 1983 ; 22 : 103-13 . 40 . Maniatis T, Frisch EF, Sambrook J . 1982 . Molecular Cloning, a Laboratory Manual . Cold Spring Harbor : Cold Spring Harbor Laboratory. 41 . Sanger F, Nickelen S, Coulson AR . DNA sequencing with chain-terminating inhibitors . Proc Natl Acad Sci USA 1977 ; 74 : 5463-7 . 42 . Hattori M, Sakaki Y . Dideoxy sequencing method using denatured plasmid templates . Anal Biochem 1981 ; 152 : 232-8 . 43 . Laemmli UK . Cleavage of structural proteins during assembly of the head of bacteriophage T4 . Nature 1970 ;227 :680-5 . 44 . Osborn MJ, Gander JE, Parisi E, Carson J . 1972 . Mechanism of assembly of the outer membrane of Salmonella typhimurium . J Biol Chem 1972; 247 : 3962-72 . 45 . Axelsen NH, ed . Handbook of Immunoprecipitation-in-gel Techniques . Scand J Immunol 1983 ; 17 [Suppl 10] .