Characterization of myeloid-specific peroxidase, keratin 8, and dual specificity phosphatase 1 as innate immune genes involved in the resistance of crucian carp (Carassius auratus gibelio) to Cyprinid herpesvirus 2 infection

Fish & Shellfish Immunology 41 (2014) 531e540

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Characterization of myeloid-specific peroxidase, keratin 8, and dual specificity phosphatase 1 as innate immune genes involved in the resistance of crucian carp (Carassius auratus gibelio) to Cyprinid herpesvirus 2 infection Patarida Podok, Hao Wang, Lijuan Xu, Dan Xu, Liqun Lu* Key Laboratory of Aquatic Genetic Resources of the Ministry of Agriculture, Shanghai Ocean University, 201306, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 July 2014 Received in revised form 28 September 2014 Accepted 1 October 2014 Available online 12 October 2014

Myeloid-specific peroxidase (MPO), keratin 8 (KRT-8), and dual specificity phosphatase 1 (DUSP-1) are believed to play essential roles in innate immunity. Through suppression subtractive hybridization (SSH) analysis, we previously identified MPO, KRT-8, and DUSP-1 as the three genes that were the most significantly upregulated in crucian carp (Carassius auratus gibelio) that survived Cyprinid herpesvirus 2 (CyHV-2) infection. Here, we have further characterized these three genes and their response to pathogen challenge. The open reading frames (ORF) of MPO, KRT-8, and DUSP-1 were cloned by RACE technique and sequenced. The full-length cDNAs of the three genes contained ORFs of 2289, 1575 and 1083 bp respectively. The polypeptides from each ORF were projected to contain 762 (MPO), 524 (KRT-8), and 360 (DUSP-1) amino acids. Phylogenetic analysis showed that the three genes were most closely related to zebrafish. We found that MPO, KRT-8, and DUSP-1 were expressed at low levels in all of the tissues examined in healthy crucian carp. Quantitative real-time RT-PCR analysis indicated that MPO, KRT-8, and DUSP-1 mRNA expression was significantly upregulated within 72 h of CyHV-2 infection compared to mock infected controls. Maximum expression of MPO was detected at 24 hpi (2.71-fold, P < 0.05). While, 12 hpi (3.80-fold, P < 0.01) and 6 hpi (8.70-fold, P < 0.01) were the highest expression time points for KRT-8 and DUSP-1, respectively. In contrast, after Aeromonas hydrophila challenge, the transcripts of these three genes remained unchanged or slightly down-regulated. For the fish survived from viral infection, expression levels of MPO and KRT-8 were 2.72 fold and 2.47 fold higher than those of fish died from acute infection, and similar level of DUSP-1 was observed in samples of survived fish. These data suggested MPO, KRT-8 and DUSP-1 might be involved in the antiviral, but not antibacterial innate immune response in crucian carp. These findings also support the use of MPO and KRT-8 as immunological markers for a response to viral infection in crucian carp. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Myeloid-specific peroxidase Keratin 8 Dual specificity phosphatase 1 Crucian carp Carassius auratus gibelio Cyprinid herpesvirus 2

1. Introduction The crucian carp (Carassius auratus gibelio) was discovered in northern China and it has since become the fourth most important farmed freshwater fish [1]. Viral and bacterial infections in crucian carp are serious problems that have significant economic costs. Cyprinid herpesvirus 2 (CyHV-2) is one of the most dangerous for crucian carp pathogens [1,2]. CyHV-2, also known as herpesviral hematopoietic necrosis (HVHNV), has been documented on most crucian carp farms in eastern China. Typical symptoms include

* Corresponding author. Tel.: þ86 2161900453; fax: þ86 2161900454. E-mail address: [email protected] (L. Lu). http://dx.doi.org/10.1016/j.fsi.2014.10.001 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

lethargy, lack of appetite, bleeding and pale gills, pink ascites in the abdominal cavity, and an enlarged spleen and kidneys. The disease develops rapidly and has mortality rates up to 90e100% [2]. One of the most important bacterial pathogens in freshwater fish worldwide is Aeromonas hydrophila (A. hydrophila), the causative agent of motile aeromonad septicemia [3]. Like CyHV-2, the mortality rate for infections caused by A. hydrophila exceeds 95% [4]. In the last decade, A. hydrophila has become the most important pathogenic bacteria for Cyprinoid fish [5]. We previously identified myeloid-specific peroxidase (MPO; GenBank accession no. KF417504.1), keratin 8 (KRT-8; GenBank accession no. KF417517.1) and dual specificity phosphatise (DUSP-1; GenBank accession no. KF417501.1) as immune response genes upregulated by CyHV-2 infection [6].

532

P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540

MPO is a peroxidase enzyme that is specifically expressed in the cytoplasmic granules of myeloid cells, especially in neutrophils. It is released from primary azurophilic neutrophil granules and plays a key role in the host response to microbial infections [7]. MPO can use halide (usually chloride ions) and hydrogen peroxide (H2O2) formed by the respiratory burst to generate hypochlorous acid (HOCl), which efficiently destroys a wide range of organisms [8], including bacteria [9], fungi [10], and virus [11]. In addition, MPO has other immunomodulatory functions and mediates neutrophil activation [12], stimulates macrophages [13], and contributes to the general inflammatory response. KRT-8 serves an intermediate filament (IF) proteins of epithelial cells that attaches to desmosomes, supports the tensile strength and shape of cells and interacts with a variety of cell structures such as in hepatocytes, pancreatic acinar and islet cells, and proximal tubular kidney epithelial cells. The functions of KRT-8 in response of viral or bacterial infection have not been defined in full. However, the primary function of KRT-8 is to protect epithelial cells from mechanical and nonmechanical stresses that result in cell death by regulating cell signaling cascades and susceptibility to apoptosis [14]. Keratins can be capable of inducing macrophage polarization at sites of injury and have essential in the role of macrophages in wound healing and tissue repair [15]. Keratins also provide structural support to the cell and can help cells to cope with stress [16,17]. DUSP-1 plays a key regulatory role in the innate immune response which depends on mitogen-activated protein kinase (MAPK) signaling pathways that regulate proliferation, differentiation, stress responses, inflammation, growth arrest, and apoptosis [18e20]. In addition, DUSP-1 controls the levels of both proinflammatory (TNFa) and anti-inflammatory (IL10) cytokines in response to LPS [21]. More recently, DUSP-1 expression has been shown to be strongly upregulated in response to several stimuli including hypoxia [22], oxidative stress [23], growth factors [24], UV [25], and heat shock [26]. The aim of this study was to monitor the expression patterns of MPO, KRT-8 and DUSP-1 in response to viral and bacterial pathogens for better understanding the innate immune response of crucian carp against CyHV-2 infection. 2. Materials and methods 2.1. Viral and bacterial challenge Naive crucian carp with an average weight of 200 g were obtained from a local farm and acclimatized to laboratory conditions for two weeks in the Shanghai Ocean University fish-breeding farm. They are all from the same family (Cyprinidae). To study the response of MPO, KRT-8, and DUSP-1 to viral and bacterial infections and comparison of mRNA expression levels of immune-related genes between susceptible and resistant fish after viral challenge. The CyHV-2 strain was isolated from diseased crucian carp (C. auratus gibelio) samples cultured in Sheyang City, Jiangshu Province, in May 2012. The purified viral solution and LD50 dose have been described previously (LD50 dose ¼ 1  106 particles/ mL) [6]. For the infection, fish were intraperitoneally injected with 1 mL of virus at a concentration of 106 viral particles/mL. The fish were kept at a controlled water temperature between 20 and 23  C. A. hydrophila (AH10) was isolated and identified from diseased grass carp as described by Roxana et al. [27] in 2011 (NCBI accession number: JX413114.1) and stored in the National Aquatic Pathogen Collection Center (No.2011AH10). The LD50 for AH10 is 1  106 CFU/ mL [28]. For the bacterial infection, fish were intraperitoneally injected with 400 mL of bacteria at 106 CFU/mL. The fish was kept at a controlled water temperature of 28e30  C. For both viral and

bacterial infection, a mock-infected control group, 18 fish/group has been injected with PBS. 2.2. Sample collection To assess the tissue distribution of MPO, KRT-8, and DUSP-1 in the liver, kidney, spleen, heart, gills, and muscles tissues were collected from 3 healthy crucian carp for mRNA extraction. To examine the expression of immune-related genes after CyHV-2 and A. hydrophila infection within 72 h post pathogen challenge. The kidney tissue was collected at 0, 6, 12, 24, 48, and 72 h post-injection (hpi). Three individual fish were sampled for each tested group. To characterize MPO, KRT-8, and DUSP-1 expression in susceptible and resistant fish after challenge with CyHV-2, assessed for clinical signs including gasping movements in shallow water, bleeding and pale gills, and pink ascites in the abdominal cavity (data not shown). In our infection system, mortality was only detected at 72 h post viral challenge [6]. Susceptible samples from viral infection confirmed by PCR were defined as susceptible infection sample. No further mortality was observed after 168 h post viral challenge. Samples collected at 168 hpi, were defined as resistant infection sample. Kidney tissue was collected from 4 individuals from each group. All of the samples were collected in three biological replicates per fish and stored at 80  C until further analysis. 2.3. RNA extraction and cDNA synthesis Total RNA was isolated from the kidney tissue usingTRIzol (Invitrogen, USA) per the manufacturer's protocol. The purity of the extracted RNA was determined by the OD260nm/OD280nm ratio, with expected values between 1.8 and 2.0. All of the RNA samples were treated with RNase free-DNaseI (Takara, Japan) to remove residual genomic DNA before being reverse transcribed into cDNA using random hexamer primers and MMLV Reverse Transcriptase (Takara, Japan) according to the manufacturer's instructions. 2.4. Cloning the full-length cDNAs of MPO, KRT-8, and DUSP-1 Gene specific primers were designed from partial gene sequences using the Primer Premier 5 program and were used with adaptor primers, UPM and NUP, to amplify the genes from crucian carp cDNA (Table 1). The full-length sequence, 50 -untranslated regions (50 -UTRs), and 30 -untranslated regions (30 -UTRs) for the MPO, KRT-8, and DUSP-1 genes were obtained using the SMARTer™ RACE cDNA amplification kit (Clontech Laboratories, Inc.) to synthesize first stand cDNA according to the manufacturer's instructions. The PCR conditions were: 94  C for 1 min, 25 cycles of 94  C for 30 s, 68  C for 30 s, 72  C for 2 min, and 72  C for 10 min. The PCR products were gel-purified using the Wizard® SV Gel and PCR Clean-Up System (Promega) before being cloned into the pMD 19-T vector (Takara). The pMD 19-T vector with the full length gene was transformed into Escherichia coli DH5a competent cells, plated on an LB-agar Petri-dish, and incubated overnight at 37  C. Positive colonies containing inserts of the expected size were screened by colony PCR. Three of the positive clones were picked for commercial sequencing (Shenggong Biotech, Shanghai). 2.5. Multiple sequence alignment and phylogenetic analysis The BLAST program from the National Center for Biotechnology Information (NCBI) was used to search homologous sequences in GenBank. The open reading frames (ORF) for MPO, KRT-8, and DUSP-1 were determined using ORF Finder (http://www.ncbi.nlm. nih.gov/projects/gorf/). DNAstar software was used to predict the

P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540 Table 1 Primers used for the sequencing of full-length transcripts and real-time RT-PCR. Primer name

Sequence (50 -30 )

Annealing temperature ( C)

50 -RACE-MPO 30 -RACE-MPO 50 -RACE-KRT8 30 -RACE-KRT8 50 -RACE-DUSP1 30 -RACE-DUSP1 Universal Primer A Mix (UPM)

GCGGAAGACAGGGAGACAGGTGCCA CGTTGCTGCCCCTGGTCAGATTGG CCTTTCACGGCATCAATCTCGGACTG GGTTGTCCAAGATTGAGCGAGTCCCC TCTCCCATCTCCAGACTGCGGTCATCC CTGGATGACCGCAGTCTGGAGATGGG Long:CTAATACGACTCACTATAGGGCAAGCA GTGG TATCA ACGCAGAGT Short: CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT

68 68 68 68 68 68

Nested Universal Primer A (NUP) MPO Forward: CGGTCACTCTCTATGTCAGCA Reward: GTATCTCCCAGCCCAAAGGT KRT-8 Forward: GTTGAGAGGGAAGGTCAGGAAT Reward: CAAGGATGGCAGAGTTGTGTC DUSP-1 Forward: TCTTCACTTCTCCCATCTCCA Reward: CATTTTACCCAACGAGGACAC

533

eukaryotic polyadenylation signal (AATAAA) followed by a poly (A) tail (Fig. 1A). The MPO ORF coded a polypeptide estimated to contain 762 amino acid (aa). Multiple sequence alignment was used to compare the amino acid sequences from crucian carp MPO to MPO from the zebrafish, mandarin fish, African clawed frog, domestic cat, house mouse and human using the DNAMAN software program (Fig. 1B). There was a high frequency of identical (blue ) or similar (pink > 75%; grey > 50%) amino acids. However, phylogenetic analysis showed that the crucian carp MPO was most closely related to zebrafish with an identity of 84% (E-value: 0.0; Fig. 1C). 3.2. Characterization of crucian carp KRT-8

60 60 60

coded protein. Multiple sequence alignments were generated with DNAMAN software (Lynnon Biosoft, Pointe-Claire, Canada). Neighbor-Joining phylogenetic analysis was performed using the projected amino acid sequence. The tree was generated from a ClustalW alignment using the MEGA5 program. Robustness was ensured using 1000 bootstrap iterations. 2.6. Real-time RT-PCR analysis Real-time RT-PCR was conducted to assess gene expression. First-strand cDNA was used as the template for the gene-specific primers shown in Table 1 b-actin was used as a reference gene for the relative quantification of gene expression from each sample. Real-time RT-PCR was carried out in a 20 mL reaction volume containing 1 mL of cDNA sample, 7 mL of nuclease-free water, 10 mL of 2  SsoAdvanced™ SYBR Green Supermix (Bio-Rad), and 1 mL of each gene specific primer (10 mM). The amplification conditions were: 95  C for 30 s, 40 cycles of 95  C for 5 s, 60  C for 30 s, 95  C for 1 min, 65  C for 1 min, followed by a dissociation curve analysis to verify the amplification of a single product going from 65  C to 95  C in 0.5  C increments at 5 s intervals. Real-time RT-PCR was performed in a CFX96™ Real-time PCR Detection System (Bio-Rad, USA). After the PCR program was completed, the threshold cycle (CT) value was determined using the manual setting on the CFX Manager 2.1 software (Bio-Rad, USA) and exported into a Microsoft Excel Sheet for subsequent data analyses in SPSS. For tissue distribution analysis, the 2CT reference =2CT target ratio of the target gene vs. reference gene (b-actin) was calculated as previously described [29]. The relative expression levels of MPO, KRT-8, and DUSP-1 after viral or bacterial infection were calculated as the relative fold change compared to b-actin by the 2DDCT method [30]. The expression data obtained from the independent biological replicates were subjected to one-way analysis of variance (one-way ANOVA), followed by a paired-samples t-test. P-values <0.05 were considered statistically significant. 3. Results 3.1. Characterization of crucian carp MPO The full length cDNA sequence of MPO (GenBank accession no. KJ784543.1) contained 3279 bp. The gene was composed of a 24 bp 50 -untranslated region (UTR), an ORF containing 2289 bp, and a 966 bp 30 -UTR that contained mRNA instability motifs (ATTTA) and a

The full length transcript of KRT-8 (GenBank accession no. KJ139990.1) contained 2258 bp. The gene contained an ORF with 1575 bp, a 50 UTR of 90 bp, and a 30 UTR of 593 bp containing two ATTTA repeats and a polyadenylation signal (AATAAA) followed by a poly (A) tail (Fig. 2A). The ORF encoded a polypeptide estimated to contain 524 aa. The amino acid sequence of KRT-8 was compared to other species including: zebrafish, Fugu rubripes, African clawed frog, pig, house mouse, and human. As with MPO, there was a high frequency of identical (blue) and similar (pink > 75%; grey > 50%) amino acids between the KRT-8 proteins (Fig. 2B). Phylogenetic analysis showed that the crucian carp and zebrafish KRT-8 sequences were most similar with an identity of 86% (E-value: 0.0; Fig. 2C). 3.3. Characterization of crucian carp DUSP-1 Finally, the full-length cDNA of DUSP-1 (GenBank accession no. KJ139989.1) was characterized. It was 2125 bp in length with an ORF of 1083 bp, a 50 UTR of 190 bp, and a 30 -UTR of 852 bp containing three repeats of ATTTA and a polyadenylation signal (AATAAA) followed by a poly (A) tail (Fig. 3A). The presence of a poly (A) tail in MPO, KRT-8 and DUSP-1, suggested that the expressed sequence tag (EST) represented the true 30 region of these genes. The DUSP-1 ORF coded for a polypeptide containing 360 aa. The crucian carp DUSP-1 amino acid sequence was compared to that of the zebrafish, house mouse, cow (bovine), western clawed frog, pig, chicken, Rhesus monkey, and human (Fig. 3B). The crucian carp DUSP-1 had a very high frequency of identical (blue) and similar amino acids (pink > 75%, grey > 50%) compared with the other species. As with MPO and KRT-8, DUSP-1 from the crucian carp was most closely related to zebrafish DUSP-1 with an identity of 87% (E-value: 0.0; Fig. 3C). 3.4. Tissue distribution of MPO, KRT-8 and DUSP-1 genes in healthy crucian carp The mRNA transcripts of MPO, KRT-8, and DUSP-1 genes were analyzed using real-time RT-PCR in the liver, spleen, gill, muscle, heart, and kidney of healthy crucian carp and normalized using bactin levels (Fig. 4). All three of the genes were expressed at very low levels in all of the tissues examined. The comparable higher mRNA levels were found in kidney, liver and muscle, while the lowest expression levels were observed in heart, kidney and spleen, respectively. Interestingly, in healthy crucian carp the mRNA expression levels of DUSP-1 and KRT-8 are higher than those of MPO in the same tissues. 3.5. The mRNA expression of MPO, KRT-8, and DUSP-1 genes after CyHV-2 and A. hydrophila infection within 72 h post pathogen challenge CyHV-2 and A. hydrophila infections had opposing effects on the expression levels of all three genes in the kidney (Fig. 5). Compared to

534 P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540 Fig. 1. Characterizing MPO from the crucian carp. (A) The nucleotide sequence with the projected amino acid sequences, numbers on the left hand side indicate sequence position. The box indicates the start codon (ATG) and the * marks the stop codon (TAG). Underlining indicates motifs associated with mRNA instability (ATTTA), the dashed line indicates the polyadenylation signal (AATAAA). (B) Multiple alignment of MPO amino acid sequences from different organisms. Missing amino acids are marked by dots, identical amino acids (100%) are indicated in blue, similar amino acids (75%) are shown in pink, and similar amino acids (50%) are shown in grey. The number on the right indicates the amino acid position in the corresponding species. (C) Neighbor-Joining phylogenetic tree generated from a ClustalW alignment with the MEGA5 program. The number near each node represents the bootstrap values. The scale bar shows the number of substitutions per site. All sequences are available from GenBank; zebrafish (Danio rerio), NM212779.1; mandarin fish (Siniperca chuatsi), DQ341375.1; African clawed frog (Xenopus laevis), NM001087639.1; domestic cat (Felis catus), NM001122746.2; house mouse (Mus musculus), NM010824.2; human (Homo sapiens), NM000250.1. (For interpretation of the references to color in this figure caption, the reader is referred to the web version of this article.)

P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540 535

Fig. 2. Characterizing KRT-8 from the crucian carp. (A) The nucleotide sequence and projected amino acid sequence, the numbers to the left indicate sequence position. The box indicates the start codon (ATG) and the * indicates the stop codon (TGA). Underlining indicate motifs associated with mRNA instability (ATTTA) and the dashed line indicates the polyadenylation signal (AATAAA). (B) Multiple alignment of the KRT-8 amino acid sequences from different organisms. Missing amino acids are marked by dots, identical amino acids (100%) are indicated in blue, similar amino acids (75%) are shown in pink, and similar amino acids (50%) are shown in grey. The number on the right indicates the amino acid position in the corresponding species. (C) Neighbor-Joining phylogenetic tree generated from a ClustalW alignment with the MEGA5 program. The number near each node represents the bootstrap values. The scale bar shows the number of substitutions per site. All sequences are available from GenBank; zebrafish (Danio rerio), NM200080.2; Fugu rubripes (Takifugu rubripes), NM001011879.2; African clawed frog (Xenopus laevis), NM001087056.1; pig (Sus scrofa), NM001159615.1; house mose (Mus musculus), NM031170.2; human (Homo sapiens), NM001256293.1. (For interpretation of the references to color in this figure caption, the reader is referred to the web version of this article.)

536 P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540 Fig. 3. Characterizing DUSP-1 from the crucian carp. (A) The nucleotide sequence and projected amino acid sequence, the numbers to the left indicate sequence position. The box indicates the start codon (ATG) and the * indicates the stop codon (TGA). Underlining indicate motifs associated with mRNA instability (ATTTA) and the dashed line indicates the polyadenylation signal (AATAAA). (B) Multiple alignment of DUSP-1 amino acid sequences from different organisms. Missing amino acids are marked by dots, identical amino acids (100%) are indicated in blue, similar amino acids (75%) are shown in pink, and similar amino acids (50%) are shown in grey. The number on the right indicates the amino acid position in the corresponding species. (C) Neighbor-Joining phylogenetic tree generated from a ClustalW alignment with the MEGA5 program. The number near each node represents the bootstrap values. The scale bar shows the number of substitutions per site. All sequences are available from GenBank; zebrafish (Danio rerio), NM213067.1; House mouse (Mus musculus), NM013642.3; Bovine (Bos Taurus), NM001046452.2; western clawed frog (Xenopus (Silurana) tropicalis), NM001005450.2; pig (Sus scrofa), NM001256075.1; chicken (Gallus gallus), NM001085359.1; rhesus monkey (Macaca mulatta), NM001257450.2; human (Homo sapiens): NM004417.3. (For interpretation of the references to color in this figure caption, the reader is referred to the web version of this article.)

P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540

537

2 earlier than either MPO or KRT-8 at 6 hpi (8.70-fold, P < 0.01). DUSP1 expression peaked at 12 hpi (10.70-fold, P < 0.01), then gradually decreased over time from 24 (8.11-fold, P < 0.01), 48 (8.10-fold, P < 0.01), and 72 hpi (2.82-fold, P < 0.05). DUSP-1 also had higher peak mRNA expression than either MPO or KRT-8. Following A. hydrophila infection, DUSP-1 mRNA levels were comparable to mock infected fish at 6, 24, and 48 hpi, but significantly downregulated at 12 hpi (0.21-fold,P < 0.01) and 72 hpi (0.41-fold, P < 0.05; Fig. 5C). 3.6. Comparison of mRNA expression levels of MPO, KRT-8, and DUSP-1 genes between susceptible and resistant infection Fig. 4. Tissue expression profiles of MPO, KRT-8, and DUSP-1 genes from healthy fish. The levels of gene expression were measured using real-time RT-PCR analysis in tissue isolated from healthy crucian carp (N ¼ 3). Each gene was measured in biological triplicates from the tissue of each fish. b-actin served as the internal reference gene.

mock infection, CyHV-2 infection significantly upregulated MPO expression at 24 hpi (2.71-fold, P < 0.05), reached its peak at 48 hpi (3.51-fold, P < 0.01) and normalized by 72 hpi (P > 0.05). In contrast, after bacterial challenge, MPO expression was significantly downregulated at 6 hpi (0.03-fold, P < 0.01) and 12 hpi (0.19-fold, P < 0.01), but normalized at 24, 48, and 72 hpi (0.66-fold, 0.63 and 1.06-fold, respectively, P > 0.05) (Fig. 5A). KRT-8 mRNA expression levels peaked earlier than MPO after CyHV-2 infection at 12 hpi (3.80-fold, P < 0.01) and decreased gradually over time at 24 (3.24-fold, P < 0.01), 48 (3.14-fold, P < 0.01), and 72 hpi (2.54-fold, P < 0.05), although remaining elevated above levels seen in mock infected fish (Fig. 5B). Similar to MPO, the level of KRT-8 mRNA was significantly downregulated compared to mock infection following A. hydrophila infection (Fig. 5B). The decrease in KRT-8 expression was first detectable at 12 hpi (0.48-fold, P < 0.05) and was sustained at 24 (0.31-fold, P < 0.05), 48 (0.30-fold, P < 0.05), and 72 hpi (0.55-fold, P < 0.05). DUSP-1 expression was significantly upregulated by CyHV-

In our previous study [6], crucian carp infected with 106 CyHV-2 particles/mL had a 50% mortality rate, and the resistant fish became virus-carrier without any symptoms. To determine whether the expression levels of MPO, KRT-8, and DUSP-1 impacted resistance, we compared the mRNA expression levels after CyHV-2 infection in susceptible fish and resistant fish compared to mock infected controls by real-time RT-PCR analysis using b-actin as an internal reference gene (Fig. 6). MPO (Fig. 6A) and KRT-8 (Fig. 6B) mRNA expression was significantly upregulated compared to mock infected controls in resistant fish (P < 0.01), whereas their expression was significantly downregulated in susceptible fish (P < 0.01). These results confirmed upregulation of MPO and KRT-8 were only observed in resistant fish, and not in susceptible fish. In contrast, DUSP-1 expression was detected at levels similar to mock infection in both susceptible and resistant fish and only a slightly higher level in samples of resistant fish (Fig. 6C). 4. Discussion Our results indicated that MPO was expressed at low levels in all the tissues we examined from healthy carp and was significantly

Fig. 5. Kinetics of MPO, KRT-8, and DUSP-1 expression following CyHV-2 and A, hydrophila infection. The mRNA expression level of MPO (A), KRT-8 (B), and DUSP-1 (C) was measured using real-time RT-PCR analysis in the kidney 6, 12, 24, 48, and 72 h post challenge with 106 CyHV-2 particles or 400 mL of A. hydrophila at 106 CFU/mL. Mock infected controls were injected with an equivalent volume of PBS. b-Actin was employed as a reference gene. Error bars indicate standard error (N ¼ 3). Asterisks indicate significant differences between the infected groups and control group using a paired-samples t-test (*P < 0.05 and **P < 0.01).

538

P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540

Fig. 6. mRNA expression of MPO, KRT-8, and DUSP-1 in susceptible (S) and resistant (R) crucian carps after CyHV-2 infection compared to mock infected controls. Crucian carp were infected with 106 CyHV-2 particles intraperitoneally, mock infected controls were injected with an equivalent volume of PBS (N ¼ 4/group). Expression of MPO, KRT-8, and DUSP-1 was measured in the kidney of susceptible (72 hpi) and resistant (168 hpi) carp using b-actin as an internal reference gene. Error bars indicate standard error (N ¼ 3). Asterisks indicate significant differences between the CyHV-2 infected and control groups with a paired-samples t-test (**P < 0.01).

upregulated 24 h after CyHV-2 infection. In zebrafish, MPO is expressed in the cytoplasm in the kidney and spleen but not in gut or gill arches by in situ hybridization [31]. In the kidney of adult zebrafish, MPO was expressed in granulocytes and the myeloid precursor cells, which are similar to cells in human bone marrow specific to the neutrophil lineage [32]. Following trauma in the zebrafish, MPO and peroxidase-expressing cells were localized at the site of acute inflammation within several hours and resulted in inflammation at tip of the embryo's tail [31]. Here, we find that MPO was significantly upregulated in crucian carp that survived being infected with CyHV-2. Taken together, these results are consistent with Lau et al., 2005 [12], who reported that MPO plays important roles in pro-inflammatory responses and in some inflammatory diseases. Moreover, MPO was mainly found at sites of neutrophil accumulation, and involved in tissue damage at inflammatory sites in addition to its primary role in host defense [33]. Indeed, the level of MPO was significantly increased in plasma of patients infected with influenza virus H5N1 [34] and MPO in neutrophils kills influenza virus in vitro [35]. It was released from neutrophils which were activated by the H5N1 virus in the epithelial cells in lung [36]. Furthermore, in human, MPO in neutrophils raised the possibility that the peroxidase system utilizing H2O2 contributed to the host defense against Human Immunodeficiency Virus (HIV) [11]. In contrast, the level of MPO mRNA was significantly downregulated after A. hydrophila challenge, and neutrophils retained 52% of their initial MPO after ingestion of staphylococci. Furthermore, MPO of circulating neutrophils was significantly decreased after Staphylococcus aureus infection in adult rats [37]. MPO might be used to ingested bacterium by discharged into the phagosome during the degranulation process [38] and the level of MPO was decreased in total cellular activity after phagocytosis of bacterial [37]. In addition, MPO bound to the outer surface of bacteria and associated with both E. coli and Pseudomonas aeruginosa, which enhanced their susceptibility to killing by H2O2 [39].

The comparably higher mRNA expression of KRT-8 healthy crucian carp was detected in liver, similar to in adult human, KRT-8 and -18 were exclusively expressed in hepatocytes [40]. After CyHV-2 challenge, the expression level of KRT-8 was significantly upregulated at 12 hpi. and remained elevated at 72 hpi. This could be because keratin aggregates are shed from host cells during the later stages of the apoptotic process to protect the cell, when the integrity of the cytoplasmic membrane becomes compromised by rapid phosphorylation of KRT-8 at Ser431 [41]. In addition to the finding by Ku et al., 2007 [42], KRT-8 and -18 mRNA and their protein levels increased 3 fold in response to liver injury as noted in mice exposed to agents that induced Mallor Denk body (MDB) formation, which protected perpetuate liver injury. Remarkably, Keratin involvement in liver disease included modulating disease progression upon mutation. Indeed, KRT-8 and -18 variants were associated with chronic hepatitis C virus and that their presence correlates with progression of fibrosis [43]. Moreover, KRT-8 and -18 played essential roles in the protecting hepatocytes against mechanical and toxic stress in mice [44]. The levels of soluble KRT-8 and -18 were increased 2.5 fold after heat stress and this correlated with the increased expression of 70 kDa heat shock protein [45]. Keratin biomaterials have been examined for their role in inflammation. Keratin treatment increases M2 macrophages, which were considered anti-inflammatory and support tissue remodeling [15]. On the other hand, the expression level of KRT-8 was significantly downregulated after A. hydrophila infection and in susceptible infection of CyHV-2. Similar to previous reports in KRT-8 and -18 from human and mice, the absence or mutation of KRT-8 or -18 predisposed their carriers to acute and chronic end-stage liver disease, and increased susceptibility to injury and apoptosis [46,47]. In this study, DUSP-1 expression was significantly upregulated during CyHV-2 infection as early as 6 hpi. These findings are similar to previous reports following infection with vaccinia virus, in which

P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540

DUSP-1 was upregulated at the same time as early viral gene expression [48]. Following CyHV-2 infection, DUSP-1 was the only gene that was found at normal levels in both susceptible and resistant fish, while both MPO and KRT-8 were significantly upregulated. Also, in contrast to the findings in susceptible and resistant fish, DUSP-1 expression increased rapidly, as soon as 6 h, after CyHV-2 infection. One possible explanation for this apparent discrepancy is that DUSP-1 expression gradually started to decrease beginning 12 h after CyHV-2 challenge and may have normalized by the time its expression was examined in surviving crucian carp. DUSP-1 expression was significantly downregulated following A. hydrophila infection. In macrophages, DUSP-1 deficiency was found to be associated with excessive pro-inflammatory cytokine production in response to TLR agonists or heat-killed bacteria, both in vitro and in vivo [49]. However, the lack of DUSP-1 did not affect survival or bacterial replication after a challenge with live S. aureus in mice [50]. Furthermore, Dickinson and Keyse [21] reported that DUSP-1 controls the levels of both pro-inflammatory (TNFa) and anti-inflammatory (IL10) cytokines in response to LPS. High levels of TNFa are seen only at early time points after LPS challenge, prior to induction of DUSP-1 expression. In contrast, at later times as DUSP-1 expression declines and followed by IL10 expression increases. This is the first study to clone and characterize MPO, KRT-8, and DUSP-1 genes from crucian carp. We don't have solid data to show any relationship or interactions among these three genes during CyHV-2 infection. Based on the functions of the genes, we hypothesized that virus-induced cellular stress could be counteracted by cellular gene expressions, which might include MPO in inactivation of invading viral particles, KRT-8 in maintaining cell morphology and avoid apoptosis, and DUSP-1 in regulating signal pathways. In conclusion, all these three genes were upregulated following CyHV-2 challenge in crucian carp within 72 hpi. but not induced by bacteria. For the fish survived from viral infection, expression levels of MPO and KRT-8 were significantly higher than those of fish died from susceptible infection, and similar level of DUSP-1 was observed in samples of survived fish. Together the results suggest, these three genes are involved in anti-viral immunity in the crucian carp. MPO and KRT-8 could serve as immune markers for host immune response to CyHV-2 infection in crucian carp. Acknowledgments This work was supported by grants from the Earmarked Fund for China Agriculture Research System (No.CARS-46-12) and the Shanghai Outstanding Undergraduate Scholarship for Interdisciplinary Training (No. B5201-12-0039). References [1] Wu T, Ding Z, Ren M, An L, Xiao Z, Liu P, et al. The histo-and ultra-pathological studies on a fatal disease of Prussian carp (Carassius gibelio) in mainland China associated with Cyprinid herpesvirus 2 (CyHV-2). Aquaculture 2013;412e413:8e13. [2] Xu J, Zeng L, Zhang H, Zhou Y, Ma J, Fan Y. Cyprinid herpesvirus 2 infection emerged in cultured Prussian carp, Carassius auratus gibelio in China. Vet Microbiol 2013;166:138e44. [3] Austin B, Adams C. Fish pathogens. In: Austin B, Altwegg M, Gosling PJ, Joseph S, editors. The genus aeromonas. Chichester: John Wiley & Sons; 1996. p. 197e243. [4] Zhan WB. Diseases of aquatic animals. Beijing: China Agriculture Press; 2004. [5] Wu ZX, Pang SF, Chen XX, Yu YM, Zhou JM, Chen X, et al. Effect of Coriolus versicolor polysaccharides on the hematological and biochemical parameters and protection against Aeromonas hydrophila in allogynogenetic crucian carp (Carassius auratus gibelio). Fish Physiol Biochem 2013;39(2):181e90. [6] Xu L, Podok P, Xie J, Lu L. Comparative analysis of up regulated genes in kidney tissues of moribund and surviving crucian carp (Carassius auratus gibelio) in response to Cyprinid herpesvirus 2 infection. Arch Virol 2014;38(1):65e73.

539

[7] Kettle AJ, Gedye CA, Winterbourn CC. Superoxide is an antagonist of antiinflammatory drugs that inhibit hypochlorous acid production by myeloperoxidase. Biochem Pharmacol 1993;45(10):2003e10. [8] Foster CB, Lehrnbecher T, Mol F, Steinberg SM, Venzon DJ, Walsh TJ, et al. Host defense molecule polymorphisms influence the risk for immune-mediated complications in chronic granulomatous disease. J Clin Investig 1998;102: 2146e55. [9] Klebanoff SJ. Myeloperoxidase-halide-hydrogen peroxide antibacterial system. J Bacteriol 1968;95:2131e8. [10] Diamond RD, Clark RA, Haudenschild CC. Damage to Candida albicans hyphae and pseudohyphae by the myeloperoxidase system and oxidative products of neutrophil metabolism in vitro. J Clin Invest 1980;66:908e17. [11] Klebanoff SJ, Coombs RW. Viricidal effect of lactobacillus acidophilus on human immunodeficiency virus type 1: possible role in heterosexual transmission. J Exp Med 1991;174:289e92. [12] Lau D, Mollnau H, Eiserich JP, Freeman BA, Daiber A, Gehling UM, et al. Myeloperoxidase mediates neutrophil activation by association with CD11b/ CD18 integrins. Proc Natl Acad Sci U S A 2005;102:431e6. [13] Grattendick K, Stuart R, Roberts E, Lincoln J, Lefkowitz SS, Bollen A, et al. Alveolar macrophage activation by myeloperoxidase: a model for exacerbation of lung inflammation. Am J Respir Cell Mol Biol 2002;26:716e22. [14] Coulombe PA, Omary MB. “Hard” and “soft” principles defining the structure, function and regulation of keratin intermediate filaments. Curr Opin Cell Biol 2002;14:110e22. [15] Fearing BV, Van Dyke ME. In vitro response of macrophage polarization to a keratin biomaterial. Acta Biomater 2014;10:3136e44. [16] Fuchs E, Cleveland DW. A structural scaffolding of intermediate filaments in health and disease. Science 1998;279:514e9. [17] Ku NO, Zhou X, Toivola DM, Omary MB. The cytoskeleton of digestive epithelia in health and disease. Am J Physiol 1999;277:G1108e37. [18] Chambard JC, Lefloch R, Pouyssegur J, Lenormand P. ERK implication in cell cycle regulation. Biochim Biophys Acta 2007;1773(8):1299e310. [19] Liu J, Lin A. Role of JNK activation in apoptosis: a double-edged sword. Cell Res 2005;15(1):36e42. [20] Cuenda A, Rousseau S. p38 MAP-kinases pathway regulation, function and role in human diseases. Biochim Biophys Acta 2007;1773(8):1358e75. [21] Dickinson RJ, Keyse SM. Diverse physiological functions for dual-specificity MAP kinase phosphatises. J Cell Sci 2006;119(22):4607e15. [22] Shields KM, Panzhinskiy E, Burns N, Zawada WM, Das M. Mitogen activated protein kinase phosphatase-1 is a key regulator of hypoxia-induced vascular endothelial growth factor expression and vessel density in lung. Am J Pathol 2011;178(1):98e109. [23] Liu YX, Wang J, Guo J, Wu J, Lieberman HB, Yin Y. DUSP1 is controlled by p53 during the cellular response to oxidative stress. Mol Cancer Res 2008;6(4): 624e33. [24] Lasa M, Gil-Araujo B, Palafox M, Aranda A. Thyroid hormone antagonizes tumor necrosis factor-alpha signaling in pituitary cells through the induction of dual specificity phosphatase 1. Mol Endocrinol 2010;24(2):412e22. [25] Franklin CC, Srikanth S, Kraft AS. Conditional expression of mitogen activated protein kinase phosphatase-1, MKP-1, is cytoprotective against UV induced apoptosis. Proc Natl Acad Sci U S A 1998;95(6):3014e9. [26] Lee KH, Lee CT, Kim YW, Han SK, Shim YS, Yoo CG. Preheating accelerates mitogen-activated protein (MAP) kinase inactivation post-heat shock via a heat shock protein 70-mediated increase in phosphorylated MAP kinase phosphatase-1. J Biol Chem 2005;280(13):13179e86. [27] Roxana BH, Anabel A, Noemi B, Jesus LR, Maria JF. Comparison of phenotypical and genetic identification of aeromonas strains isolated from diseased fish. Syst Appl Microbiol 2010;3(33):149e53. [28] Xu L, Wang H, Yang X, Lu L. Integrated pharmacokinetics/pharmacodynamics parameters-based dosing guidelines of enrofloxacin in grass carp Ctenopharyngodon idella to minimize selection of drug resistance. BMC Vet Res 2013;9: 126. [29] Inderjit SM, Beate J, Thu QE. Differentially expression genes following persistent infection with infectious pancreatic necrosis virus in vitro and in vivo. Fish Shellfish Immunol 2010;28:845e53. [30] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [31] Lieschke GJ, Oates AC, Crowhurst MO, Ward AC, Layton JE. Morphologic and functional characterization of granulocytes and macrophages in embryonic and adult zebrafish. Blood 2001;98(10):3087e96. [32] Bennett CM, Kanki JP, Rhodes J, Liu TX, Paw BH, Kieran MW, et al. Myelopoiesis in the zebrafish, Danio rerio. Blood 2001;98(3):643e51. [33] Phung TT, Sugamata R, Uno K, Aratani Y, Ozato K, Kawachi S, et al. Key role of regulated upon activation normal T-cell expressed and secreted, nonstructural protein1 and myeloperoxidase in cytokine storm induced by influenza virus PR-8 (A/H1N1) infection in A549 bronchial epithelial cells. Microbiol Immunol 2011;55(12):874e84. [34] Phung TTB, Luong ST, Kawachi S, Nunoi H, Nguyen LT, Nakayama T, et al. Interleukin 12 and myeloperoxidase (MPO) in Vietnamese children with acute respiratory distress syndrome due to Avian influenza (H5N1) infection. J Infect 2011;62:104e8. [35] Yamamoto K, Miyoshi-Koshio T, Utuki Y, Mizuno S, Suzuki K. Virucidal activity and viral protein modification by myeloperoxidase:a candidate for defense factor of human polymorphonuclear leukocytes against influenza infection. J Infect Dis 1991;164:8e14.

540

P. Podok et al. / Fish & Shellfish Immunology 41 (2014) 531e540

[36] Liem NT, Nakajima N, Phat le P, Sato Y, Thach HN, Hung PV, et al. H5N1infected cells in lung with diffuse alveolar damage in exudative phase from a fatal case in Vietnam. Jpn J Infect Dis 2008;61:157e60. [37] Bradley PP, Christensen RD, Rothstein G. Cellular and extracellular myeloperoxidase in pyogenic inflammation. Blood 1982;60(3):618e22. [38] Klebanoff SJ. Myeloperoxidase-mediated antimicrobial systems and their role in leukocyte function. In: Schultz J, editor. Biochemistry of the phagocytic process; 1970. p. 89e110. Amsterdam, North Holland. [39] Britigan BE, Ratcliffe HR, Buettner GR, Rosen GM. Binding of myeloperoxidase to bacteria: effect on hydroxyl radical formation and susceptibility to oxidantmediated killing. Biochim Biophys Acta 1996;1290(3):231e40. [40] Omary MB, Ku NO, Toivola DM. Keratins: guardians of the liver. Hepatology 2002;35:251e7. [41] Schutte B, Henfling M, Kolgen W, Bouman M, Meex S, Leers MPG, et al. Keratin 8/18 breakdown and reorganization during apoptosis. Exp Cell Res 2004;297: 11e26. [42] Ku NO, Strnad P, Zhong BH, Tao GZ, Omary MB. Keratins let liver live: Mutations predispose to liver disease and crosslinking generates Mallory-Denk bodies. Hepatology 2007;46:1639e49. [43] Strnad P, Lienau TC, Tao GZ, Lazzeroni LC, Stickel F, Schuppan D, et al. Keratin variants associate with progression of fibrosis during chronic hepatitis C infection. Hepatology 2006;43:1354e63.

[44] Fortier AM, Riopel K, Desaulniers M, Cadrin M. Novel insights into changes in biochemical properties of keratins 8 and 18 in griseofulvin-induced toxic liver injury. Exp Mol Pathol 2010;89(2):117e25. [45] Liao J, Lowthert LA, Ghori N, Omary MB. The 70-kDa heat shock proteins associate with glandular intermediate filaments in an ATP-dependent manner. J Biol Chem 1995;270(2):915e22. [46] Ku NO, Gish R, Wright TL, Omary MB. Keratin 8 mutations in patients with cryptogenic liver disease. N Engl J Med 2001;344:1580e7. [47] Strnad P, Zhou Q, Hanada S, Lazzeroni LC, Zhong BH, So P, et al. Keratin variants predispose to acute liver failure and adverse outcome: race and ethnic associations. Gastroenterology 2010;139(3):828e35. [48] Caceres A, Perdiguero B, Gomez CE, Cepeda MV, Caelles C, Sorzano CO, et al. Involvement of the cellular phosphatase DUSP1 in vaccinia virus infection. PLoS Pathog 2013;9(11):e1003719. [49] Arthur JSC, Ley SC. Mitogen-activated protein kinases in innate immunity. Nat Rev Immunol 2013;13:679e92. [50] Wang X, Meng X, Kuhlman JR, Nelin LD, Nicol KK, English BK, et al. Knockout of Mkp-1 enhances the host inflammatory responses to gram-positive bacteria. J Immunol 2007;178:5312e20.