- Email: [email protected]
Characterization of new variant human ES line VH9 hESC (INSTEMe001-a): a tool for human stem cell and cancer research
Stem Cell Research 37 (2019) 101444
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Characterization of new variant human ES line VeH9 hESC (INSTEMe001a): a tool for human stem cell and cancer research
T
Radhika Rao Arasalaa,b, Manjunath Jayarama, Jagamohan Chattaic, Thangaraj Kumarasamyb, ⁎ Ramkumar Sambasivana, Shravanti Rampallia, a
Centre For Inflammation and Tissue Homeostasis, Institute For Stem Cell Biology and Regenerative Medicine, GKVK PO, Bellary Road, Bangalore 560065, India Sastra University, Tirumalaisamudram, Thanjavur 613 401, TamilNadu, India c CSIR-Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500007, India b
A B S T R A C T
Human pluripotent stem cells (hPSCs) acquire changes at the genomic level upon proliferation and differentiation (Peterson and Loring, 2014). Studies from International Stem Cell Initiative and independent laboratories identified a copy number variant (CNV) in hES cell lines displaying a normal karyotype, which provided a selective advantage to hES cells in culture. In our laboratory we have identified variant H9-hESC (derived from H9-hESC) with normal karyotype, pluripotency expression, differentiation profile but with altered traits of high cell survival and low E-CADHERIN expression.
Cell line repository/bank Ethical approval
Resource table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution
Contact information of distributor
Type of cell line Origin Additional origin info Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date
⁎
INSTEMe001-A
https://hpscreg.eu/cell-line/INSTEMe001-A Approvals were obtained from Institute Committee for Stem Cell Research and Therapy at inStem WiCell Agreement No: 16-W0029
V-H9 hESC Institute For Stem Cell Biology and Regenerative Medicine (inStem) Bangalore 560065 India Shravanti Rampalli Institute for Stem Cell Biology and Regenerative Medicine (inStem) [email protected] ESC Human Sex: Female WA09 (H9) hESC Mixed NA No NA NA NA NA NA Not Applicable 24/02/2014
Resource utility VeH9 hESC is characterized by survival advantage retaining differentiation capacity, thus may be an abundant source for in vitro differentiation studies. Lowered E-CADHERIN expression in VeH9 hESC and enhanced survival overlaps with traits of cancer cells. Therefore, the novel V-H9hESC line could potentially be used to unravel the mechanism of neoplastic progression. Resource details V-H9hESC line was derived from low passage (P# 41) WA-09 hESC (established by WiCell Research Institute Inc. Wisconsin) through enzymatic passaging. During passaging of H9-hESC using CTK dissociation buffer (for 5–7 min), one dish of H9-hESC culture was incubated for approximately 15 min in CTK solution. Upon plating these cells we observed massive cell death, possibly due to destruction of cell contacts that imposes stress on isolated hES cell. However, surprisingly 2–3 small colonies appeared post three days of passaging. These cells were eventually expanded using manual passaging method and the line was established. Morphologically, colonies of VeH9 hESC had loosely
Corresponding author. E-mail address: [email protected] (S. Rampalli).
https://doi.org/10.1016/j.scr.2019.101444 Received 9 November 2018; Received in revised form 3 April 2019; Accepted 16 April 2019 Available online 18 April 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 37 (2019) 101444
R.R. Arasala, et al.
Fig.1. Characterization of Variant human ES (V-H9hESC) line
2
Stem Cell Research 37 (2019) 101444
R.R. Arasala, et al.
every 5 days post seeding with split ratio of 1:2, whereas VeH9 hESCs were split every third day after seeding with split ratio of 1:3.
packed cells with elongated cell morphology at the edge of the colony (Fig. 1A). These cells exhibited higher population doubling compared to the parent ES line as in cell growth assay (Supplementary Fig. 1A). Split ratio of VeH9 hESC was 1:3 every three days in contrast to 1:2 for parent H9-hESC every 5 days. To demonstrate that VeH9 hESC indeed grow faster, we passaged confluent well of H9-hESC and VeH9 hESC at split ratio of 1:2 and performed alkaline phosphatase staining post 48 h. Higher number of alkaline phosphatase positive colonies in Supplementary Fig. 1B demonstrates accelerated growth of VeH9 hESCs. Examining the levels of OCT4 and SOX2, we identified no changes in their gene expression levels in VeH9 hESC compared to control H9 hESC (Fig. 1B & C). Immunostaining for pluripotency markers such as TRA-1-60, NANOG and E-CADHERIN identified expression of TRA-1-60 and NANOG in all the cells of the varient colony (Fig. 1D & E). However, we noticed that E-CADHERIN staining was excluded at the edge of variant hESCs colonies, which exhibited elongated morphology (Fig. 1F). In addition, the overall levels of E-CADHERIN protein was low in VeH9 hESC as seen by Western blot analysis (Fig. 1G). In spite of all the changes mentioned above, VeH9 hESC maintained the normal karyotype (Fig. 1H). Short Tandem Repeat (STR) analysis for 16 loci confirmed that the VeH9 hESC are derived from parental H9-hESCs. Previous studies demonstrate that the protumorigenic gene BCL-XL provides cell survival advantage and drives culture adaptation of hESC (Avery et al., Stem Cell Reports, 2013). Increased expression of BCL-XL observed in our variant hESCs may explain the accelerated population doubling (Fig. 1I). Next we assessed the differentiation potential of VeH9 hESC cells using teratoma assay. Of three mice injected, two mice developed teratomas. Variant-derived teratomas exhibited differentiation into all three germ layers (Fig. 1 J, K & L). To ensure that above results are not due to additional cellular stress inducing factors such as mycoplasma we have monitored the mycoplasma levels in normal and V-H9 hESC routinely using Mycoalert kit. As shown in Supplementary Table S1, we did not detect mycoplama contamination in our lines throughout the studies Tables 1 and 2.
Teratoma assay VeH9 hESCs were washed with PBS and detached using Collagenase-IV (1 ml/10 cm dish) (Sigma-C5138-100 mg) treatment for approximately 7 min. Cells were scraped gently in PBS using 2 ml pipette and were collected in a 15 ml falcon tube (in 2 ml PBS). Cells were counted using a cell Countess counter. V-H9hESCs were then centrifuged at 1000 rpm for 1 min. PBS was aspirated and cells were suspended in a final concentration of 5 × 10^6 cells in 30 μl PBS. Cell suspension was placed on ice until used for injection. NOD/SCID mice were placed on a warm heating pad and anesthetized with isoflurane. Surgical area was washed with iodine solution and hair was removed from the dorsal region. Epididymal fat pad along with testis was pulled out carefully and ~30 μl of cell suspension was injected. Needle was removed slowly to avoid backflow of cells. The testis was returned to their original location and the wound was sutured. Teratomas were extracted 12 weeks post injection. Part of teratoma embedded in paraffin and sectioned (5–10 μ) for processing towards H and E staining (Hematoxylin Sigma GHS316-500ML & Eosin Sigma-HT110116-500ML) and a part of tissue was used for RNA extraction using Trizol (Invitrogen- 15,596-026). H and E staining Formaldehyde fixation: The teratoma tissue was rinsed with PBS and fixed in 4% PFA (Sigma-P6148) at 4 °C overnight, followed by PBS washes for two hours at the interval of 15 min. The tissue was then treated with 30% sucrose and incubated overnight at 4 °C, followed by Bouins solution (Sigma-HT-10132) overnight at room temperature. This treated tissue was washed the following day with distilled water for two hours and dehydrated by treating it with 30% ethanol (1 h), 50% ethanol (1 h), 70% ethanol (overnight), 95% ethanol (1 h) and Xylene (two washes each for 45mins). Paraffin was melted at 55-60 °C and the tissue was kept in it for 1 h, after which the tissue was transferred to freshly melted paraffin wax and embedded at room temperature. Paraffin blocks were trimmed as required and sectioned at 5-10 μ thicknesses, the sections were then mounted on glass slides. Dewaxing of the sections were done by immersing it in xylene solution followed by rehydration, which was done by placing the sections in 100%, 95%, 80% and 75% ethanol solution each for 5mins, rinsed with distilled water and dried. Hematoxylin and Eosin staining: The paraffin sections were stained with Hematoxylin for 10 min and rinsed with tap water for 15 min. Eosin dye was added for 2 min and washed with tap water. The sections
Materials and methods Cell culture H9-hESCs and V-H9 hESCs were maintained on Matrigel (Corning® Matrigel® hESC-Qualified Matrix-354,277) in hESC-medium containing Knockout-DMEM (Gibco-10,829-018) supplemented with 20% Knockout-serum (Gibco-10,828-028), GlutaMax (Gibco- 25,030-081), non-essential amino acids (Gibco-11,140,050), β-mercaptoethanol (Sigma- 21,985-023) and 8-ng/ml recombinant bFGF (Perprotech-10018B). Both the lines were passaged by manual dissection using microtip and were incubated with 5% CO2 and at 37 °C. H9-hESCs were passaged Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis Quantitative analysis Karyotype (G-banding) and resolution
Altered morphology Positive for pluripotency markers: NANOG and TRA-1-60 Positive for pluripotency markers: OCT4 and SOX2 was tested Normal- 46, XX Resolution 550 bands Not done 16 loci tested all matched with parent line Not Applicable
Fig. Fig. Fig. Fig.
Mycoplasma testing by luminescence Assay. Negative All the three germ layers Neural rosette structures (Ectoderm) Cartilage (Mesoderm) Secretory Epithelium (Endoderm) were seen. NA NA NA
Table S1 Fig. 1, J, K and L
Genotype Identity Mutation analysis (IF APPLICABLE)
Microsatellite PCR (mPCR) OR STR analysis Sequencing
Microbiology and virology Differentiation potential
Mycoplasma Teratoma Assay
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
3
1A 1D and E 1 B and C 1H
N/A Available with the authors
NA NA NA
Stem Cell Research 37 (2019) 101444
R.R. Arasala, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry
Pluripotency markers
Differentiation markers Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Mouse-anti-TRA-1-60 Mouse-E-CADHERIN Rabbit-NANOG N/A Goat anti Rabbit 488 Donkey anti mouse 568 Goat anti mouse HRP
1:50 1–100 1–100 N/A 1:200 1:200 1:200
Santa Cruz, Sc-21,705 and AB_628385 Abcam ab1416 and AB_300946 Abcam ab21624 and AB_446437 N/A AF A11008 and AB_143165 A10037 and AB_2534013 Biorad 172–1011 and AB_11125936
Primers Target
Forward/Reverse primer (5′-3′)
Episomal Plasmids (qPCR) (qPCR) Pluripotency Markers
N/A SOX2 OCT4
House-Keeping Genes (qPCR)
GAPDH
Genotyping Other Genes
N/A BCL-XL
N/A SOX2 – Forward AACGTTTGCCTTAAACAAGACCAC SOX2 - Reverse- CGAGATAAACATGGCAATCAAATG OCT4-Forward- AGACTATTCCTTGGGGCCACAC OCT4-Reverse-GGCTGAATACCTTCCCAAATAGA GAPDH-Forward-GAAATCCCATCACCAATCTTCCAGG GAPDH-Reverse-GCAATTGAGCCCCAGCCTTCTC N/A BCL-XL -Forward- GGTTGAGCCCATCCCTATTAT BCL-XL -Reverse- CTGACTCCAGCTGTATCCTTTC
were resuspended in 1× PBS buffered and filtered through 70 μ filter to obtain single cell suspension. Equal numbers of cells (50,000) were seeded on Matrigel coated 12-well plates in presence of ROCK inhibitor (Sigma-Y27632). Number of cells was counted in each well 72 h post seeding. Cell count was plotted to determine the growth rate.
were air-dried, mounted with DPX and imaged using IX-73 microscope. Western blotting Cell extracts were prepared in RIPA buffer. 30 μg of the protein was run on a 10% Tris-glycine gel, and transferred onto PVDF membrane (Thermo Scientific - 88,518). Post transfer the blot was incubated in 5% skim milk for 1 h at room temperature. Blots were then incubated with indicated antibodies at 4 °C overnight. Blots were then washed with 1× PBST and incubated with secondary HRP antibody for 1 h at room temperature. TFX signal enhancer Chemiluminescent substrate was used for detection.
Genomic DNA isolation bi Genomic DNA was isolated from H9-hESC and V-H9-hESCs using lysis extraction procedures. Cells from one well of 12 well plates was collected and lysed in 250 μl of lysis buffer (NaOH, 25 mM, Na2EDTA.2H2O, 0.2 mM) at 55 °C for 5–6 h. Post incubation, the cell lysate was centrifuged and supernatant was collected. First Phenol and then chloroform Isoamyl alcohol extraction was performed using 1:1 ratio. After brief vortexing and centrifuging, the aqueous layer was transferred to fresh tubes. Chilled ethanol in 2.5 ratios was added to the supernatant to precipitate the genomic DNA. After gentile mixing the tubes were kept in −80 for precipitation for 4 h. Precipitated DNA was spun down and washed with 70% ethanol. Finally genomic DNA was suspended in autoclaved water.
Immunostaining H9-hESCs or VeH9 hESCs were fixed with 4% paraformaldehyde (Sigma-P6148) for 10 min, followed by permeabilization using 5% Triton-X100 (Sigma-93,443) dissolved in 1×PBS for 15 min and blocked with 4% BSA (Sigma-A2058) dissolved in 1×PBS for 1 h at room temperature. Post blocking, cells were incubated with the indicated antibodies (antibodies were diluted in 1X PBS solution containing 0.5% BSA) at 4o C overnight and then added secondary antibody for 1 h at room temperature. Nuclei were visualized using DAPI (Life Technologies-R37606). The images were acquired using confocal microscope (FV1000 Olympus).
Karyotyping and STR analysis VeH9 hESC (passage 43) were given for karyotyping at Anand Lab Diagnostics, Bangalore India. Total 50 cells were screened and 10 metaphase spreads were counted. STR analysis was performed at CCMB in Thangaraj laboratory. Total of 16 loci were analyzed using AmpFlSTR® Identifiler® PCR Amplification Kit. Amplified products were sequenced at Bioserve sequencing facility at CCMB. Data was analyzed by GeneMapper software.
q-PCRs Total RNA was isolated using Trizol reagent as per manufacturer instructions. RNA was subjected to cDNA synthesis using Superscript III cDNA synthesis kit (Invitrogen11752–050). Quantitative PCRs were performed using Maxima SYBR green qPCR master mix (Thermo Scientific- K0251) and BIORAD CFX384-Real Time machine. GAPDH was used as internal control.
Alkaline phosphatase assay H9-hESC and V-H9-hESC were seeded in the four well formats. Post 48hs, culture media was aspirated from the cells and washed with 1XTBS. For fixation, 4% PFA (made 4% PFA in distilled water) was added to the cultures and at room temperature for 15 min. Cells were then washed with cold 1XTBS three times. Meanwhile ready to use
Cell growth assay Confluent wells of H9-hESCs or VeH9 hESCs were dissociated in Accutase (StemPro-A1110501) dissociation buffer for 2–3 min. Cells 4
Stem Cell Research 37 (2019) 101444
R.R. Arasala, et al.
staining solution was prepared by dissolving 1 NBT/BCIP tablet (Roche Cat no. 11697471001) of alkaline phosphatase in 10 ml MilliQ water. Staining solution was added to the cells and incubated in the dark for 10–20 min. Blue staining was monitored under microscope for optimal staining intensity. Images of the cultures were acquired using the camera.
Appendix A. Supplementary data
Acknowledgments
Avery, Stuart, Hirst, Adam J., Baker, Duncan, Lim, Chin Yan, Alagaratnam, Sharmini, Skotheim, Rolf I., Lothe, Ragnhild A., Pera, Martin F., Colman, Alan, Robson, Paul, Andrews, Peter W., Knowles, Barbar B., 2013. BCL-XL mediates the strong selective advantage of a 20q11.21 amplification commonly found in human embryonic stem cell cultures. Stem Cell Rep 1, 379–386. Peterson, Suzanne E., Loring, Jeanne F., 2014. Genomic instability in pluripotent stem cells: implications for clinical applications. JBC 289, 4578–4584.
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101444. References
This work was supported by funds from DBT-Innovative Young Bioscientist Award (IYBA) (BT/08/IYBA/2014-9) to Shravanti Rampalli. Radhika R. Arasala is supported by funds from ICMR-SRF fellowship.
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Characterization of new variant human ES line VeH9 hESC (INSTEMe001a): a tool for human stem cell and cancer research
T
Radhika Rao Arasalaa,b, Manjunath Jayarama, Jagamohan Chattaic, Thangaraj Kumarasamyb, ⁎ Ramkumar Sambasivana, Shravanti Rampallia, a
Centre For Inflammation and Tissue Homeostasis, Institute For Stem Cell Biology and Regenerative Medicine, GKVK PO, Bellary Road, Bangalore 560065, India Sastra University, Tirumalaisamudram, Thanjavur 613 401, TamilNadu, India c CSIR-Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500007, India b
A B S T R A C T
Human pluripotent stem cells (hPSCs) acquire changes at the genomic level upon proliferation and differentiation (Peterson and Loring, 2014). Studies from International Stem Cell Initiative and independent laboratories identified a copy number variant (CNV) in hES cell lines displaying a normal karyotype, which provided a selective advantage to hES cells in culture. In our laboratory we have identified variant H9-hESC (derived from H9-hESC) with normal karyotype, pluripotency expression, differentiation profile but with altered traits of high cell survival and low E-CADHERIN expression.
Cell line repository/bank Ethical approval
Resource table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution
Contact information of distributor
Type of cell line Origin Additional origin info Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date
⁎
INSTEMe001-A
https://hpscreg.eu/cell-line/INSTEMe001-A Approvals were obtained from Institute Committee for Stem Cell Research and Therapy at inStem WiCell Agreement No: 16-W0029
V-H9 hESC Institute For Stem Cell Biology and Regenerative Medicine (inStem) Bangalore 560065 India Shravanti Rampalli Institute for Stem Cell Biology and Regenerative Medicine (inStem) [email protected] ESC Human Sex: Female WA09 (H9) hESC Mixed NA No NA NA NA NA NA Not Applicable 24/02/2014
Resource utility VeH9 hESC is characterized by survival advantage retaining differentiation capacity, thus may be an abundant source for in vitro differentiation studies. Lowered E-CADHERIN expression in VeH9 hESC and enhanced survival overlaps with traits of cancer cells. Therefore, the novel V-H9hESC line could potentially be used to unravel the mechanism of neoplastic progression. Resource details V-H9hESC line was derived from low passage (P# 41) WA-09 hESC (established by WiCell Research Institute Inc. Wisconsin) through enzymatic passaging. During passaging of H9-hESC using CTK dissociation buffer (for 5–7 min), one dish of H9-hESC culture was incubated for approximately 15 min in CTK solution. Upon plating these cells we observed massive cell death, possibly due to destruction of cell contacts that imposes stress on isolated hES cell. However, surprisingly 2–3 small colonies appeared post three days of passaging. These cells were eventually expanded using manual passaging method and the line was established. Morphologically, colonies of VeH9 hESC had loosely
Corresponding author. E-mail address: [email protected] (S. Rampalli).
https://doi.org/10.1016/j.scr.2019.101444 Received 9 November 2018; Received in revised form 3 April 2019; Accepted 16 April 2019 Available online 18 April 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 37 (2019) 101444
R.R. Arasala, et al.
Fig.1. Characterization of Variant human ES (V-H9hESC) line
2
Stem Cell Research 37 (2019) 101444
R.R. Arasala, et al.
every 5 days post seeding with split ratio of 1:2, whereas VeH9 hESCs were split every third day after seeding with split ratio of 1:3.
packed cells with elongated cell morphology at the edge of the colony (Fig. 1A). These cells exhibited higher population doubling compared to the parent ES line as in cell growth assay (Supplementary Fig. 1A). Split ratio of VeH9 hESC was 1:3 every three days in contrast to 1:2 for parent H9-hESC every 5 days. To demonstrate that VeH9 hESC indeed grow faster, we passaged confluent well of H9-hESC and VeH9 hESC at split ratio of 1:2 and performed alkaline phosphatase staining post 48 h. Higher number of alkaline phosphatase positive colonies in Supplementary Fig. 1B demonstrates accelerated growth of VeH9 hESCs. Examining the levels of OCT4 and SOX2, we identified no changes in their gene expression levels in VeH9 hESC compared to control H9 hESC (Fig. 1B & C). Immunostaining for pluripotency markers such as TRA-1-60, NANOG and E-CADHERIN identified expression of TRA-1-60 and NANOG in all the cells of the varient colony (Fig. 1D & E). However, we noticed that E-CADHERIN staining was excluded at the edge of variant hESCs colonies, which exhibited elongated morphology (Fig. 1F). In addition, the overall levels of E-CADHERIN protein was low in VeH9 hESC as seen by Western blot analysis (Fig. 1G). In spite of all the changes mentioned above, VeH9 hESC maintained the normal karyotype (Fig. 1H). Short Tandem Repeat (STR) analysis for 16 loci confirmed that the VeH9 hESC are derived from parental H9-hESCs. Previous studies demonstrate that the protumorigenic gene BCL-XL provides cell survival advantage and drives culture adaptation of hESC (Avery et al., Stem Cell Reports, 2013). Increased expression of BCL-XL observed in our variant hESCs may explain the accelerated population doubling (Fig. 1I). Next we assessed the differentiation potential of VeH9 hESC cells using teratoma assay. Of three mice injected, two mice developed teratomas. Variant-derived teratomas exhibited differentiation into all three germ layers (Fig. 1 J, K & L). To ensure that above results are not due to additional cellular stress inducing factors such as mycoplasma we have monitored the mycoplasma levels in normal and V-H9 hESC routinely using Mycoalert kit. As shown in Supplementary Table S1, we did not detect mycoplama contamination in our lines throughout the studies Tables 1 and 2.
Teratoma assay VeH9 hESCs were washed with PBS and detached using Collagenase-IV (1 ml/10 cm dish) (Sigma-C5138-100 mg) treatment for approximately 7 min. Cells were scraped gently in PBS using 2 ml pipette and were collected in a 15 ml falcon tube (in 2 ml PBS). Cells were counted using a cell Countess counter. V-H9hESCs were then centrifuged at 1000 rpm for 1 min. PBS was aspirated and cells were suspended in a final concentration of 5 × 10^6 cells in 30 μl PBS. Cell suspension was placed on ice until used for injection. NOD/SCID mice were placed on a warm heating pad and anesthetized with isoflurane. Surgical area was washed with iodine solution and hair was removed from the dorsal region. Epididymal fat pad along with testis was pulled out carefully and ~30 μl of cell suspension was injected. Needle was removed slowly to avoid backflow of cells. The testis was returned to their original location and the wound was sutured. Teratomas were extracted 12 weeks post injection. Part of teratoma embedded in paraffin and sectioned (5–10 μ) for processing towards H and E staining (Hematoxylin Sigma GHS316-500ML & Eosin Sigma-HT110116-500ML) and a part of tissue was used for RNA extraction using Trizol (Invitrogen- 15,596-026). H and E staining Formaldehyde fixation: The teratoma tissue was rinsed with PBS and fixed in 4% PFA (Sigma-P6148) at 4 °C overnight, followed by PBS washes for two hours at the interval of 15 min. The tissue was then treated with 30% sucrose and incubated overnight at 4 °C, followed by Bouins solution (Sigma-HT-10132) overnight at room temperature. This treated tissue was washed the following day with distilled water for two hours and dehydrated by treating it with 30% ethanol (1 h), 50% ethanol (1 h), 70% ethanol (overnight), 95% ethanol (1 h) and Xylene (two washes each for 45mins). Paraffin was melted at 55-60 °C and the tissue was kept in it for 1 h, after which the tissue was transferred to freshly melted paraffin wax and embedded at room temperature. Paraffin blocks were trimmed as required and sectioned at 5-10 μ thicknesses, the sections were then mounted on glass slides. Dewaxing of the sections were done by immersing it in xylene solution followed by rehydration, which was done by placing the sections in 100%, 95%, 80% and 75% ethanol solution each for 5mins, rinsed with distilled water and dried. Hematoxylin and Eosin staining: The paraffin sections were stained with Hematoxylin for 10 min and rinsed with tap water for 15 min. Eosin dye was added for 2 min and washed with tap water. The sections
Materials and methods Cell culture H9-hESCs and V-H9 hESCs were maintained on Matrigel (Corning® Matrigel® hESC-Qualified Matrix-354,277) in hESC-medium containing Knockout-DMEM (Gibco-10,829-018) supplemented with 20% Knockout-serum (Gibco-10,828-028), GlutaMax (Gibco- 25,030-081), non-essential amino acids (Gibco-11,140,050), β-mercaptoethanol (Sigma- 21,985-023) and 8-ng/ml recombinant bFGF (Perprotech-10018B). Both the lines were passaged by manual dissection using microtip and were incubated with 5% CO2 and at 37 °C. H9-hESCs were passaged Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis Quantitative analysis Karyotype (G-banding) and resolution
Altered morphology Positive for pluripotency markers: NANOG and TRA-1-60 Positive for pluripotency markers: OCT4 and SOX2 was tested Normal- 46, XX Resolution 550 bands Not done 16 loci tested all matched with parent line Not Applicable
Fig. Fig. Fig. Fig.
Mycoplasma testing by luminescence Assay. Negative All the three germ layers Neural rosette structures (Ectoderm) Cartilage (Mesoderm) Secretory Epithelium (Endoderm) were seen. NA NA NA
Table S1 Fig. 1, J, K and L
Genotype Identity Mutation analysis (IF APPLICABLE)
Microsatellite PCR (mPCR) OR STR analysis Sequencing
Microbiology and virology Differentiation potential
Mycoplasma Teratoma Assay
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
3
1A 1D and E 1 B and C 1H
N/A Available with the authors
NA NA NA
Stem Cell Research 37 (2019) 101444
R.R. Arasala, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry
Pluripotency markers
Differentiation markers Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Mouse-anti-TRA-1-60 Mouse-E-CADHERIN Rabbit-NANOG N/A Goat anti Rabbit 488 Donkey anti mouse 568 Goat anti mouse HRP
1:50 1–100 1–100 N/A 1:200 1:200 1:200
Santa Cruz, Sc-21,705 and AB_628385 Abcam ab1416 and AB_300946 Abcam ab21624 and AB_446437 N/A AF A11008 and AB_143165 A10037 and AB_2534013 Biorad 172–1011 and AB_11125936
Primers Target
Forward/Reverse primer (5′-3′)
Episomal Plasmids (qPCR) (qPCR) Pluripotency Markers
N/A SOX2 OCT4
House-Keeping Genes (qPCR)
GAPDH
Genotyping Other Genes
N/A BCL-XL
N/A SOX2 – Forward AACGTTTGCCTTAAACAAGACCAC SOX2 - Reverse- CGAGATAAACATGGCAATCAAATG OCT4-Forward- AGACTATTCCTTGGGGCCACAC OCT4-Reverse-GGCTGAATACCTTCCCAAATAGA GAPDH-Forward-GAAATCCCATCACCAATCTTCCAGG GAPDH-Reverse-GCAATTGAGCCCCAGCCTTCTC N/A BCL-XL -Forward- GGTTGAGCCCATCCCTATTAT BCL-XL -Reverse- CTGACTCCAGCTGTATCCTTTC
were resuspended in 1× PBS buffered and filtered through 70 μ filter to obtain single cell suspension. Equal numbers of cells (50,000) were seeded on Matrigel coated 12-well plates in presence of ROCK inhibitor (Sigma-Y27632). Number of cells was counted in each well 72 h post seeding. Cell count was plotted to determine the growth rate.
were air-dried, mounted with DPX and imaged using IX-73 microscope. Western blotting Cell extracts were prepared in RIPA buffer. 30 μg of the protein was run on a 10% Tris-glycine gel, and transferred onto PVDF membrane (Thermo Scientific - 88,518). Post transfer the blot was incubated in 5% skim milk for 1 h at room temperature. Blots were then incubated with indicated antibodies at 4 °C overnight. Blots were then washed with 1× PBST and incubated with secondary HRP antibody for 1 h at room temperature. TFX signal enhancer Chemiluminescent substrate was used for detection.
Genomic DNA isolation bi Genomic DNA was isolated from H9-hESC and V-H9-hESCs using lysis extraction procedures. Cells from one well of 12 well plates was collected and lysed in 250 μl of lysis buffer (NaOH, 25 mM, Na2EDTA.2H2O, 0.2 mM) at 55 °C for 5–6 h. Post incubation, the cell lysate was centrifuged and supernatant was collected. First Phenol and then chloroform Isoamyl alcohol extraction was performed using 1:1 ratio. After brief vortexing and centrifuging, the aqueous layer was transferred to fresh tubes. Chilled ethanol in 2.5 ratios was added to the supernatant to precipitate the genomic DNA. After gentile mixing the tubes were kept in −80 for precipitation for 4 h. Precipitated DNA was spun down and washed with 70% ethanol. Finally genomic DNA was suspended in autoclaved water.
Immunostaining H9-hESCs or VeH9 hESCs were fixed with 4% paraformaldehyde (Sigma-P6148) for 10 min, followed by permeabilization using 5% Triton-X100 (Sigma-93,443) dissolved in 1×PBS for 15 min and blocked with 4% BSA (Sigma-A2058) dissolved in 1×PBS for 1 h at room temperature. Post blocking, cells were incubated with the indicated antibodies (antibodies were diluted in 1X PBS solution containing 0.5% BSA) at 4o C overnight and then added secondary antibody for 1 h at room temperature. Nuclei were visualized using DAPI (Life Technologies-R37606). The images were acquired using confocal microscope (FV1000 Olympus).
Karyotyping and STR analysis VeH9 hESC (passage 43) were given for karyotyping at Anand Lab Diagnostics, Bangalore India. Total 50 cells were screened and 10 metaphase spreads were counted. STR analysis was performed at CCMB in Thangaraj laboratory. Total of 16 loci were analyzed using AmpFlSTR® Identifiler® PCR Amplification Kit. Amplified products were sequenced at Bioserve sequencing facility at CCMB. Data was analyzed by GeneMapper software.
q-PCRs Total RNA was isolated using Trizol reagent as per manufacturer instructions. RNA was subjected to cDNA synthesis using Superscript III cDNA synthesis kit (Invitrogen11752–050). Quantitative PCRs were performed using Maxima SYBR green qPCR master mix (Thermo Scientific- K0251) and BIORAD CFX384-Real Time machine. GAPDH was used as internal control.
Alkaline phosphatase assay H9-hESC and V-H9-hESC were seeded in the four well formats. Post 48hs, culture media was aspirated from the cells and washed with 1XTBS. For fixation, 4% PFA (made 4% PFA in distilled water) was added to the cultures and at room temperature for 15 min. Cells were then washed with cold 1XTBS three times. Meanwhile ready to use
Cell growth assay Confluent wells of H9-hESCs or VeH9 hESCs were dissociated in Accutase (StemPro-A1110501) dissociation buffer for 2–3 min. Cells 4
Stem Cell Research 37 (2019) 101444
R.R. Arasala, et al.
staining solution was prepared by dissolving 1 NBT/BCIP tablet (Roche Cat no. 11697471001) of alkaline phosphatase in 10 ml MilliQ water. Staining solution was added to the cells and incubated in the dark for 10–20 min. Blue staining was monitored under microscope for optimal staining intensity. Images of the cultures were acquired using the camera.
Appendix A. Supplementary data
Acknowledgments
Avery, Stuart, Hirst, Adam J., Baker, Duncan, Lim, Chin Yan, Alagaratnam, Sharmini, Skotheim, Rolf I., Lothe, Ragnhild A., Pera, Martin F., Colman, Alan, Robson, Paul, Andrews, Peter W., Knowles, Barbar B., 2013. BCL-XL mediates the strong selective advantage of a 20q11.21 amplification commonly found in human embryonic stem cell cultures. Stem Cell Rep 1, 379–386. Peterson, Suzanne E., Loring, Jeanne F., 2014. Genomic instability in pluripotent stem cells: implications for clinical applications. JBC 289, 4578–4584.
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101444. References
This work was supported by funds from DBT-Innovative Young Bioscientist Award (IYBA) (BT/08/IYBA/2014-9) to Shravanti Rampalli. Radhika R. Arasala is supported by funds from ICMR-SRF fellowship.
5