Characterization of promoter region and genomic structure of the murine and human genes encoding Src like adapter protein

Gene 262 (2001) 267±273

www.elsevier.com/locate/gene

Characterization of promoter region and genomic structure of the murine and human genes encoding Src like adapter protein Irina Kratchmarova a, Tomasz Sosinowski b, Arthur Weiss b,c, Klaus Witter d, Claudius Vincenz e, Akhilesh Pandey f,g,* b

a Department of Biochemistry and Molecular Biology, University of Southern Denmark, Odense University, Odense M, DK-5230, Denmark Department of Microbiology and Immunology, Howard Hughes Medical Institute, University of California at San Francisco, San Francisco, CA 94143, USA c Department of Medicine, Howard Hughes Medical Institute, University of California at San Francisco, San Francisco, CA 94143, USA d Labor fuÈr Immungenetik, Paul-Heyse-Strasse 33, 80336 MuÈnchen, Germany e Department of Pathology, University of Michigan, Ann Arbor, MI 48109, USA f Whitehead Institute for Biomedical Research, Cambridge, MA, USA g Department of Pathology, Brigham and Women's Hospital, Boston, MA 02115, USA

Received 24 May 2000; received in revised form 22 September 2000; accepted 24 October 2000 Received by V. PacÏes

Abstract Src-like adapter protein (SLAP) was identi®ed as a signaling molecule in a yeast two-hybrid system using the cytoplasmic domain of EphA2, a receptor protein tyrosine kinase (Pandey et al., 1995. Characterization of a novel Src-like adapter protein that associates with the Eck receptor tyrosine kinase. J. Biol. Chem. 270, 19201±19204). It is very similar to members of the Src family of cytoplasmic tyrosine kinases in that it contains very homologous SH3 and SH2 domains (Abram and Courtneidge, 2000. Src family tyrosine kinases and growth factor signaling. Exp. Cell. Res. 254, 1±13.). However, instead of a kinase domain at the C-terminus, it contains a unique C-terminal region. In order to exclude the possibility that an alternative form exists, we have isolated genomic clones containing the murine Slap gene as well as the human SLA gene. The coding regions of murine Slap and human SLA genes contain seven exons and six introns. Absence of any kinase domain in the genomic region con®rm its designation as an adapter protein. Additionally, we have cloned and sequenced approximately 2.6 kb of the region 5 0 to the initiator methionine of the murine Slap gene. When subcloned upstream of a luciferase gene, this fragment increased the transcriptional activity about 6-fold in a human Jurkat T cell line and approximately 52-fold in a murine T cell line indicating that this region contains promoter elements that dictate SLAP expression. We have also cloned the promoter region of the human SLA gene. Since SLAP is transcriptionally regulated by retinoic acid and by activation of B cells, the cloning of its promoter region will permit a detailed analysis of the elements required for its transcriptional regulation. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Signal transduction; Tyrosine kinases; Ephrins; T cell receptor

1. Introduction Receptor protein tyrosine kinases are cell surface molecules that transmit the extracellular signals by growth factors to the cell's interior (Ullrich and Schlessinger, 1990; van der Geer et al., 1994). The largest subfamily of RPTKs is the Eph subfamily (Pandey et al., 1995b). which contains an immunoglobulin-like domain, a cysteine-rich sequence and two Abbreviations: EST, expressed sequence tag; KO, knockout; PDGF, platelet derived growth factor SH2, Src homology 2; RPTK, receptor protein tyrosine kinase; SH3, Src homology 3; SLAP, Src like adapter protein * Corresponding author. Present address: Visiting Scientist, University of Southern Denmark, Odense University, Odense M, DK-5230, Denmark. Tel.: 145-6550-2366; fax: 145-6593-3018. E-mail address: [email protected] (A. Pandey).

®bronectin type III repeats. The ligands for this subfamily, called ephrins, exist as transmembrane or GPI anchored molecules (Eph Nomenclature Committee, 1997). Signals by transmembrane tyrosine kinase receptors are transmitted to the nucleus by a variety of proteins that may or may not possess catalytic activities (Hunter and Cooper, 1985). A majority of these proteins contain domains that bind to phosphorylated tyrosine residues. These domains fall in two major subclasses: Src homology 2 (SH2) or phosphotyrosine interaction domain (PID) (Ullrich and Schlessinger, 1990; Pawson, 1995; Mayer, 1998). Using a yeast two hybrid system to identify interacting partners for EphA2, a novel molecule was isolated (Pandey et al., 1995a). This molecule contains SH3 and SH2 domains that are homologous to those found the Src family

0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(00)00516-3

268

I. Kratchmarova et al. / Gene 262 (2001) 267±273

of tyrosine kinases. Since it did not contain a catalytic domain, it was designated Src-like adapter protein. Northern blot analysis indicates that it is expressed in most tissues with highest levels seen in spleen, thymus and lung (Pandey et al., 1995a; Sosinowski et al., 2000). It associates with EphA2 upon addition of its ligand ephrin-A1 (Holzman et al., 1990; Bartley et al., 1994; Pandey et al., 1995a). Additionally, it has been shown to associate with PDGF receptor. Overexpression of SLAP in ®broblasts inhibits serum and PDGF-induced mitogenesis (Roche et al., 1998). This effect requires an intact SH2 domain but not the SH3 domain. When SLAP is overexpressed in Jurkat T cells, it can inhibit T cell receptor signaling leading to NFAT-dependent transcription. SLAP associates with CD3, ZAP-70, SLP-76, and Vav in stimulated Jurkat T cells (Sosinowski et al., 2000). These results suggest that SLAP might participate in downregulation of the T cell receptor. The gene for human SLAP was shown to be located in a 64 kb intron of the thyroglobulin gene (Angrist et al., 1995; Meijerink et al., 1998). SLAP mRNA was shown to be induced in a variety of hematopoietic cell lines that undergo differentiation in response to all-trans retinoic acid (Ohtsuki et al., 1997). This suggests that SLAP may play a role in the differentiation process. SLAP was also recently shown to be highly expressed in activated B cells (Alizadeh et al., 2000). Another study found that SLAP transcripts were undetectable in thymocytes obtained from mice de®cient in CD3-1, RAG-1 or TCR-b but were found in wild type or CD-z, TCRa or TCR-d knockout mice suggesting a developmental regulation of SLAP transcript expression (Carrier et al., 1999). This correlated with SLAP expression in thymus obtained from E16 or later. Since SLAP mRNA is ubiquitously expressed in several tissues and its expression is upregulated under certain conditions, we decided to isolate and study the promoter region of SLAP. Isolation of a genomic clone would also exclude the possibility that an alternative transcript containing a kinase domain existed in the genome. 2. Material and methods 2.1. Materials Restriction endonucleases were purchased from New England Biolabs or Boehringer Mannheim. Taq polymerase was purchased from Roche Biochemicals, Basel, Switzerland. pBluescript vector was from Strategene, La Jolla, California. Dye terminator cycle sequencing kit was from PE Applied Biosystems, Foster City, California. Automated sequencing was performed on an ABI Prism 310 Genetic Analyzer. All other reagents were of the highest grade available. 2.2. Cell culture The human Jurkat T cell line was grown in RPMI supplemented with 10% fetal bovine serum. The murine EL-4

lymphoblastoid T cell line was grown in Dulbecco's modi®ed Eagle's medium supplemented with 10% fetal bovine serum, 4 mM l-glutamine, 1.5 g/l sodium bicarbonate, 4.5 g/l glucose, 1 mM sodium pyruvate and antibiotics. Both cell lines were obtained from ATCC and grown at 378C in the presence of 5% CO2. 2.3. Cloning of a genomic Slap fragment A bacterial arti®cial chromosome (BAC) containing a fragment of murine SLAP gene (clone DMPC -HFF#1255-A7) was obtained from Genome Systems INC (St. Louis, Missouri). The clone was identi®ed by screening a murine embryonic stem (ES) cells genomic library, generated from mouse strain 129, with a probe corresponding to nucleotides 1 through 458 of murine SLAP cDNA (based on the sequence contained in accession #U29056). Sequences adjacent to the SLAP translation initiation codon were established by direct sequencing of the BAC clone; the upstream region was sequenced using SLAP (R) 147 to 120 primer, and the downstream region was sequenced using SLAP (F) 218 to 14 primer (the numbering is relative to the ATG). Based on these sequences, two PCR probes for Southern blotting were generated: the 5 0 - probe (with respect to the translation initiation codon) was generated using SLAP (F) 2622 to 2601 and SLAP (R) 147 to 120 primers, and the 3 0 -probe was generated using SLAP (F) 218 to 14 and SLAP (R) 1432 to 1409 primers. Digestion of the BAC DNA with XbaI restriction enzyme, with subsequent Southern analysis, yielded an 11 kb fragment hybridizing with a 5 0 -probe, and a 10 kb fragment hybridizing with a 3 0 -probe. Both XbaI fragments were subcloned into pBluescript KS(1) vector (Stratagene), and used to generate the restriction enzyme map (see Fig. 3A). The sequences of primers used were SLAP (R) 147 to 120 primer: GCC TCT CCG AAG GTG GAG ATG TGG; SLAP (F) 218 to 14 primer: GCT CAA GGA GAG AAA GAG ATG G; SLAP (R) 1432 to 1409 primer: CCG GAA GTC ATG AGC TGA GGA GCG; and SLAP (F) 2622 to 2601 primer: GGC TAG AGT AGA GGT GAA TGT G. Because the clone DMPC-HFF#1-255-A7 contained only the ®rst coding exon of SLAP we obtained an additional clone by screening an ES-129/SvJ genomic library by PCR. Two primers from the 3 0 UTR region of the murine Slap gene were used. The sequence of the 5 0 primer was ACGTTCATGGTGGGCGACAGC and the sequence of the 3 0 primer was TACAGACAGGCACAGGATTTG. This genomic clone was then digested with several different enzymes and subcloned into pBluescript. 2.4. DNA sequencing and intron-exon determination of the murine Slap gene The intron-exon boundaries were determined by using the following primers. The 5 0 primers were: TGGGGAATAGCATGAAA, AAA-

I. Kratchmarova et al. / Gene 262 (2001) 267±273

269

GTGACTTCCTGGCTGTG, TGGTGGAAAGCCATTTCTC, TGGCTGTTTGAAGGACTG, TTCCCAACAACTGGTACTAC, TTCACCTGTCACCTTGCG, and AGCAGAGAACCCACTCAGAGT and the 3 0 primers were: TAATGTCAGGAGATGGGTAG, TCTGGCCACACATATCCCTG, AATCATGAAGCTACCAATC, TTGTATCTGGCAGCTGCAG, AATGAGTCACCAGGTCCTCC, TCTTCCAGTCAAAGGTCTTC, and CTGCTGTCATCCCCTGTCAG. 0

2.5. 5 region analysis by TFSEARCH The sequence of the 5 0 regions was searched for potential transcription factor binding sites using TFSEARCH program to search the TRANSFAC pro®le database (Heinemeyer et al., 1998). A 2577 bp region from murine Slap gene and a 4018 bp region from the human SLA gene was used in this search. 2.6. Promoter construct The promoter region of murine Slap gene was derived by PCR using the following primers. The sequence of the 5 0 primer was ATGGATCCAGTGGTGACTTAACTCC and it contained a BamH I site. The sequence of the 3 0 primer was ATAAGCTTCAGAGCACATGGTGCATC and it contained a Hind III site. The locations of these primers are indicated in bold in Fig. 3b. The ampli®ed fragment (2471 bp) was then subcloned into pGL3 luciferase vector (Promega). The pGL3 vector alone was used as a control for all luciferase reporter assays. 2.7. Electroporation Both Jurkat and EL-4 cells were grown to a density of approximately 10 6 cells/ml. For electroporation, 10 7 cells were washed once in RPMI without serum and then resuspended at 10 7 cells in 0.7 ml of culture medium. 40 mg of luciferase plasmid (pGL3 vector or pGL3 containing Slap promoter region) was mixed with 5 mg of bGal plasmid as a transfection control and added to the cells. The cells were transferred to 0.4 cm cuvettes and electroporated at 960 mF and 0.25 kV. After electroporation, the cells were transferred to ¯asks containing fresh medium.

Fig. 1. An alignment of the coding exons of the murine Slap and human SLA genes. The numbers within the boxes denote the number of amino acids encoded by the respective exons. The presence of an additional ®ve amino acids in murine SLAP result in the difference in composition of the sixth and seventh coding exons between the human and murine genes.

3. Results and discussion 3.1. Structure of murine Slap and human SLA genes Two overlapping genomic clones for the murine Slap gene were obtained by screening an ES-129/SvJ genomic library by PCR. A clone corresponding to the human SLA gene was derived by screening a human PAC library by PCR and will be described in detail elsewhere (Witter et. al., manuscript in preparation). The number of exons and their distribution (Fig. 1), as well as the exon-intron boundaries (Tables 1 and 2), are absolutely conserved between human and murine genes. The coding region of both genes comprise of seven exons joining their respective introns in accordance to the GT/AG rule (Padgett et al., 1986). Since ESTs are cDNA fragments, any spliced version of SLAP that contains a kinase domain may be detected as an EST. Further, independently isolated full length cDNAs are indicative of the SLAP transcripts present in cells or tissues. Both of these can be used for detecting alternative splicing events that may be missed by conventional Northern blot experiment (Pandey and Lewitter, 1999). An analysis of the expressed sequence tags (ESTs) that span murine or human SLAP genes, or of independently isolated full length cDNAs was thus carried out. An alignment of various EST fragments as well as cDNAs corresponding to SLAP identi®ed to date is shown in Fig. 2. As seen in the ®gure, none of the clones contain any extraneous sequence that does not correTable 1 Intron±Exon boundaries of the murine Slap gene. The numbering refers to the coding exons. The corresponding amino acid sequences are shown above the nucleotide sequence

I.

2.8. Luciferase assay Forty-eight hours after electroporation, the cells were pelleted and lysed in lysis buffer. The luciferase and bGal activities were measured using a kit from Tropix Inc. (Bedford, MA) on a Microlumat luminometer (EG&G Berthold). The luciferase activity of the reporter genes was normalized based on the bGal measurements. The measurements were done in duplicates.

50

Exon

II. III. IV. V. VI.

S AGT I ATT Y TAC K AAG Y TAT V GTA

E GAG S TCT H CAT K AAA S TCT S TCC

G G D GA G GG G G E G R AG

Intron 3 0

gtaagt...tcctag gtgagt...tgacag gtgagt...tcttag gtgagc...ttgcag gtaaga...tcatag gtatgt...acacag

Exon G GA D T G C G GT E AA R A

L CTT E GAA W TGG F TTC V GTG L TTG

E GAA G GGG L CTG Y TAT A GCT Q CAA

270

I. Kratchmarova et al. / Gene 262 (2001) 267±273

Table 2 Intron±Exon boundaries of the human SLA gene. The numbering refers to the coding exons. The corresponding amino acid sequences are shown above the nucleotide sequence 50

Exon I. II. III. IV. V. VI.

P CCG I ATT Y TAC K AAG Y TAT V GTG

E GAG S TCT H CAT K AAA S TCT S TCC

G G D GA G GG G G E G R AG

Intron 3 0

gtaagt...ccccag gtgagt...ttacag gtgagt...tcccag gtgagt...ctgcag gtaaga...cctcag gtgagt...ccacag

Exon G GA D T G C G GG E AG R A

L CTG E GAA W TGG F TTT V GTG L CTG

D GAT G GGG L CTG Y TAC A GCT Q CAG

spond to the known coding regions of SLAP. In addition, we failed to identify any known consensus motif characteristic of kinase domains within the genomic region of murine or human SLAP genes, thus con®rming its designation as a bona®de adapter protein. 3.2. Cloning of the murine Slap promoter A genomic clone derived from an ES cell genomic library was identi®ed by screening with a probe corresponding to nucleotides 1±458 of murine SLAP cDNA. The isolated genomic clone was then con®rmed to be the correct one by sequencing across the initiator methionine. A schematic representation of the upstream region of murine Slap gene is shown in Fig. 3A. The Hind III/Xba I fragment containing the initiator methionine and the upstream region was subcloned into pBluescript vector and was used for the sequencing of the promoter region. 3.3. Analysis of the promoter regions of the murine and human genes encoding SLAP SLAP mRNA has been shown to undergo upregulation in response to stimuli that induce differentiation such as reti-

noic acid (Ohtsuki et al., 1997). Using microarray analysis of over 17,000 cDNAs, Alizadeh et. al. showed that SLAP mRNA was one of a handful of genes that were speci®cally upregulated in activated B cells (Alizadeh et al., 2000). It has also been shown to be developmentally expressed in thymocytes. Carrier et al. found SLAP transcripts to be expressed in thymocytes on and after day E16. They detected SLAP transcripts in thymocytes obtained from wild type mice and those de®cient in CD3-z, TCR-a or TCR-d but not in CD3-1, RAG-1 or TCR-b knockout (Carrier et al., 1999). This is an interesting observation since CD3-1 and RAG-1 knockout mice mainly contain double negative cells (DN) (corresponding to E14±15 thymus), CD3-z and TCR-a KO mice contain equal numbers of double positive (DP) and DN cells (corresponding to E16±17 thymus) and TCR-d and wild type mice contain DN, DP and single positive cells (corresponding to E18 thymus) mice suggesting upregulation of SLAP gene expression during the transition from DN to DP cell stages. In order to characterize this transcription regulation, we decided to isolate the promoter fragments of murine and human genes encoding SLAP. A 2577 bp fragment of the upstream murine Slap gene was completely sequenced. A computer search for potential regulatory elements in the promoter region was performed using TF Search program. As shown in Fig. 3B, there are multiple potential transcription factor binding sites that might be responsible for transcriptional regulation of the murine Slap gene. These include binding sites for myoD, C/EBPa, Oct-1, AP-1, c-myb and several members of the GATA and STAT families. We also analyzed the upstream region of human SLA gene. In the case of human SLA gene, most of the transcripts originate just upstream of the ATG. However, in a minoritiy of transcripts, an additional exon of 278 bp is located about 5 kb upstream of the ATG (Meijerink et al., 1998). We have sequenced the promoter region just upstream of ATG which is used in the majority of human tissues and cell lines. The overall structure of the human genomic region upstream of the ATG is shown as a schematic in Fig. 3C, and the sequence of 4018 bp of the region just upstream of the ATG has been deposited with GenBank (accession #AJ238592). The sequence of the region upstream of the additional exon found in some transcripts is being characterized and will be described later (Witter, K., unpublished data). These upstream regions in the human SLA gene share several of the binding sites such as those for GATA, STAT, MyoD and C/EBPa transcription factors. 3.4. Slap promoter is functional in T cells

Fig. 2. An alignment of various expressed sequence tags (ESTs) and full length cDNAs in the public databases with the corresponding exon-exon junctions of murine and human genes encoding SLAP. The extent of clones is indicated as a line below the corresponding exons. The 5 0 and 3 0 UTR sequences are shown as wavy lines. Database accession numbers for each of the clones are indicated in addition to the species they are derived from.

This putative promoter region (2471 bp)of the murine Slap gene was ampli®ed by PCR and subcloned upstream of the luciferase gene. This construct was electroporated into Jurkat T cells since SLAP is expressed in T cells as well as thymocytes. As shown in Fig. 4A, more than six-fold

I. Kratchmarova et al. / Gene 262 (2001) 267±273

271

Fig. 3. (A) Organization of the 5 0 end of murine Slap gene. Unique restriction sites are indicated along with approximate distances in kb. The fragment between Hind III and Xba I was subcloned and sequenced. The shaded region corresponds to the fragment that was cloned into the luciferase vector. The initiator methionine (ATG) is indicated by an arrow. (B) Nucleotide sequence of the promoter region of murine Slap gene. The numbers upstream of the translational start site are shown beginning with 21. Putative transcription factor binding sites are underlined and marked with the name of the corresponding transcription factor(s). The promoter fragment of Slap gene was ampli®ed using primers derived from sequences indicated in bold. The sequence shown in the ®gure has been deposited with GenBank (accession #AF305203). (C) Organization of the 5 0 end of human SLA gene. The initiator methionine (ATG) is indicated by an arrow. An additional exon of 278 bp found in some transcripts is indicated by a black box. Approximate distances in kb are indicated.

272

I. Kratchmarova et al. / Gene 262 (2001) 267±273

inducible by some stimuli in these cells. In any case, these experiments served to con®rm the identi®cation of this upstream region of murine Slap gene as a functional promoter and will enable a detailed analysis of the exact transcription factors responsible for this activity. Acknowledgements A.P was supported by the Howard Temin Award by the National Cancer Institute (K01 CA 75447). We would like to thank Minerva Fernandez and Mogens Nielsen for help with sequence and analysis and Dr. Karsten Kristiansen for a critical reading of this manuscript. References

Fig. 4. Promoter activity of the upstream region of murine Slap gene. Human Jurkat T cell line (Panel A) and murine EL-4 cell line (Panel B) were transfected with the control vector, pGL3, (marked Vector control) or with the upstream promoter region from murine Slap gene cloned into pGL3 (marked SLAP Promoter) as indicated in addition to a bGal plasmid. 48 hours after transfection, the cells were lysed, and the luciferase activities measured and normalized to bGal values. Data are shown as means ^SD.

activation of the reporter was seen when the Slap promoter was placed upstream of luciferase as compared to control. This demonstrates that the cloned DNA fragment indeed has promoter activity in a relevant cell line where SLAP message is normally expressed (Sosinowski, T., unpublished data). To con®rm that this promoter activity was not con®ned to a single T cell line, we repeated the analysis in a murine T cell line, EL-4. As shown in Fig. 4B, there is approximately ®fty two-fold activation of the luciferase activity in this cell line. When we used this construct in a human B cell line (Ramos), we failed to observe any promoter activity (data not shown). This is in agreement with our previously reported observation that SLAP transcripts were undetectable in a number of B cell lines tested (Sosinowski et al., 2000). It is possible that SLAP transcripts may be

Abram, C.L., Courtneidge, S.A., 2000. Src family tyrosine kinases and growth factor signaling. Exp. Cell. Res. 254, 1±13. Alizadeh, A.A., Eisen, M.B., Davis, R.E., Ma, C., Lossos, I.S., Rosenwald, A., Boldrick, J.C., Sabet, H., Tran, T., Yu, X., Powell, J.I., Yang, L., Marti, G.E., Moore, T., Hudson Jr, J., Lu, L., Lewis, D.B., Tibshirani, R., Sherlock, G., Chan, W.C., Greiner, T.C., Weisenburger, D.D., Armitage, J.O., Warnke, R., Levy, R., Wilson, W., Grever, M.R., Byrd, J.C., Botstein, D., Brown, P.O., Staudt, L.M., 2000. Distinct types of diffuse large B-cell lymphoma identi®ed by gene expression pro®ling. Nature 403, 503±511. Angrist, M., Wells, D.E., Chakravarti, A., Pandey, A., 1995. Chromosomal localization of the mouse Src-like adapter protein (Slap) gene and its putative human homolog SLA. Genomics 30, 623±625. Bartley, T.D., Hunt, R.W., Welcher, A.A., Boyle, W.J., Parker, V.P., Lindberg, R.A., Lu, H.S., Colombero, A.M., Elliott, R.L., Guthrie, B.A., Holst, P.L., Skrine, J.D., Toso, R.J., Zhang, M., Fernandez, E., Trail, G., Varnum, B., Yarden, Y., Hunter, T., Fox, G.M., 1994. B61 is a ligand for the ECK receptor protein-tyrosine kinase. Nature 368, 558±560. Carrier, A., Nguyen, C., Victorero, G., Granjeaud, S., Rocha, D., Bernard, K., Miazek, A., Ferrier, P., Malissen, M., Naquet, P., Malissen, B., Jordan, B.R., 1999. Differential gene expression in CD3epsilon- and RAG1-de®cient thymuses: de®nition of a set of genes potentially involved in thymocyte maturation. Immunogenetics 50, 255±270. Eph Nomenclature and Committee, 1997. Uni®ed nomenclature for Eph family receptors and their ligands, the ephrins. Cell 90, 403±404. Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H., Kel, A.E., Kel, O.V., Ignatieva, E.V., Ananko, E.A., Podkolodnaya, O.A., Kolpakov, F.A., Podkolodny, N.L., Kolchanov, N.A., 1998. Databases on transcriptional regulation: TRANSFAC TRRD and COMPEL. Nucleic Acids Res. 26, 362±367. Holzman, L.B., Marks, R.M., Dixit, V.M., 1990. A novel immediate-early response gene of endothelium is induced by cytokines and encodes a secreted protein. Mol. Cell. Biol. 10, 5830±5838. Hunter, T., Cooper, J.A., 1985. Protein-tyrosine kinases. Annu. Rev. Biochem. 54, 897±930. Mayer, B.J., 1998. Protein-protein interactions in signaling cascades. Methods Mol. Biol. 84, 33±48. Meijerink, P.H., Yanakiev, P., Zorn, I., Grierson, A.J., Bikker, H., Dye, D., Kalaydjieva, L., Baas, F., 1998. The gene for the human Src-like adaptor protein (hSLAP) is located within the 64-kb intron of the thyroglobulin gene. Eur. J. Biochem. 254, 297±303. Ohtsuki, T., Hatake, K., Ikeda, M., Tomizuka, H., Terui, Y., Uwai, M., Miura, Y., 1997. Expression of Src-like adapter protein mRNA is induced by all-trans retinoic acid. Biochem. Biophys. Res. Commun. 230, 81±84.

I. Kratchmarova et al. / Gene 262 (2001) 267±273 Padgett, R.A., Grabowski, P.J., Konarska, M.M., Seiler, S., Sharp, P.A., 1986. Splicing of messenger RNA precursors. Annu. Rev. Biochem. 55, 1119±1150. Pandey, A., Lewitter, F., 1999. Nucleotide sequence databases: a gold mine for biologists. Trends Biochem. Sci. 24, 276±280. Pandey, A., Duan, H., Dixit, V.M., 1995a. Characterization of a novel Srclike adapter protein that associates with the Eck receptor tyrosine kinase. J. Biol. Chem. 270, 19201±19204. Pandey, A., Lindberg, R.A., Dixit, V.M., 1995b. Cell signalling. Receptor orphans ®nd a family. Curr. Biol. 5, 986±989. Pawson, T., 1995. Protein modules and signalling networks. Nature 373, 573±580.

273

Roche, S., Alonso, G., Kazlauskas, A., Dixit, V.M., Courtneidge, S.A., Pandey, A., 1998. Src-like adaptor protein (Slap) is a negative regulator of mitogenesis. Curr. Biol. 8, 975±978. Sosinowski, T., Pandey, A., Dixit, V.M., Weiss, A., 2000. Src-like Adaptor Protein (SLAP) Is a Negative Regulator of T Cell Receptor Signaling. J. Exp. Med. 191, 463±474. Ullrich, A., Schlessinger, J., 1990. Signal transduction by receptors with tyrosine kinase activity. Cell 61, 203±212. van der Geer, P., Hunter, T., Lindberg, R.A., 1994. Receptor protein-tyrosine kinases and their signal transduction pathways. Annu. Rev. Cell Biol. 10, 251±337.