Characterization of Roseomonas and Nocardioides spp. for arsenic transformation

Accepted Manuscript Title: Characterization of Roseomonas and Nocardioides spp. for arsenic transformation Author: Aditi V. Bagade Sachin P. Bachate Bhushan B. Dholakia Ashok P. Giri Kisan M. Kodam PII: DOI: Reference:

S0304-3894(16)30694-X http://dx.doi.org/doi:10.1016/j.jhazmat.2016.07.062 HAZMAT 17918

To appear in:

Journal of Hazardous Materials

Received date: Revised date: Accepted date:

2-1-2016 18-6-2016 25-7-2016

Please cite this article as: Aditi V.Bagade, Sachin P.Bachate, Bhushan B.Dholakia, Ashok P.Giri, Kisan M.Kodam, Characterization of Roseomonas and Nocardioides spp.for arsenic transformation, Journal of Hazardous Materials http://dx.doi.org/10.1016/j.jhazmat.2016.07.062 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Characterization of Roseomonas and Nocardioides spp. for arsenic transformation

Aditi V. Bagadea, Sachin P. Bachatea, Bhushan B. Dholakiab, Ashok P. Girib, Kisan M. Kodama*

a

Department of Chemistry, Savitribai Phule Pune University, Ganeshkhind, Pune 411007, Maharashtra, India

b

Division of Biochemical Sciences, CSIR-National Chemical Laboratory, Dr. Homi Bhabha Road, Pune 411008,

Maharashtra, India

Corresponding author: Kisan M. Kodam E-mail: [email protected] Telefax: +91-20-25691728

1

HIGHLIGHTS 

Co-existence of arsenic transforming bacteria in the environment



Nocardioides and Roseomonas identified as novel genera for As transformation



Presence of genetic markers for arsenic transforming ability



Biochemical and molecular evidences for arsenic transformation

ABSTRACT The metalloid arsenic predominantly exists in the arsenite [As(III)] and arsenate [As(V)]. These two forms are respectively oxidized and reduced by microbial redox processes. This study was designed to bioprospect arsenic tolerating bacteria from Lonar lake and to characterize their arsenic redoxing ability. Screening of sixty-nine bacterial species isolated from Lonar lake led to identification of three arsenic-oxidizing and seven arsenicreducing species. Arsenite oxidizing isolate Roseomonas sp. L-159a being closely related to Roseomonas cervicalis ATCC 49957 oxidized 2 mM As(III) in 60 h. Gene expression of large and small subunits of arsenite oxidase respectively showed 15- and 17-fold higher expression. Another isolate Nocardioides sp. L-37a formed a clade with Nocardioides ghangwensis JC2055, exhibited normal growth with different carbon sources and pH ranges. It reduced 2 mM As(V) in 36 h and showed constitutive expression of arsenate reductase which increased over 4-fold upon As(V) exposure. Genetic markers related to arsenic transformation were identified and characterized from the two isolates. Moderate resistance against the arsenicals was exhibited by the two isolates in the range of 1-5 mM for As(III) and 1-200 mM for As(V). Altogether we provide multiple evidences to indicate that Roseomonas sp. and Nocardioides sp. exhibited arsenic transformation ability.

Keywords: Arsenic; Arsenite oxidation; Arsenate reduction; Roseomonas sp.; Nocardioides sp.

2

1. Introduction Arsenic (As) is ranked first on the ”Superfund Priority List” of hazardous materials by Environmental Protection Agency and World Health Organization because of its potent carcinogenic properties [1]. Inorganic arsenic usually occurs in two predominant forms: arsenate [As(V)] and arsenite [As(III)]. Compared to As(V), As(III) is highly toxic in nature due to its solubility. Arsenate is a structural analogue of phosphate and hence uncouples oxidative phosphorylation, which is a key reaction of energy metabolism in many organisms including humans [2]. Similarly, As(III) binds to reactive sulphur atoms (-SH groups) of proteins and enzymes including those involved in the respiration and other important vital processes [1, 2]. It often exceeds permissible limit of 10 μg/L in drinking water leading to alarming health risk to humans and animals. It also causes arsenicosis, skin diseases, black foot disease, bronchitis, myocardial infarction and cancers of bladder, lung and kidney. In spite of the toxic nature of arsenic, microorganisms have evolved different tolerance mechanisms to reduce its deleterious effects [2]. Bacteria metabolize arsenic by oxidation, reduction and methylation [3]. Arsenite oxidase is a heterodimeric enzyme with a large subunit AioA and a small subunit AioB, which catalyses As(III) oxidation [4]. Heterotrophic mode of As(III) oxidation is reported in Agrobacterium albertimagni and Alcaligenes sp. [5], while Rhizobium-like bacteria NT-25 and NT-26 generate energy by utilizing As(III) as electron donor [6]. Arsenate reductases (arsC) are small proteins that catalyze the conversion of As(V) to As(III) [7]. Transformation or arsenic tolerance mechanism in many bacteria comprises of plasmid or chromosomal encoded ars operon with three or five genes. This operon tolerates As(III), As(V) and antimony. Escherichia coli exhibits 3 open reading frames viz. arsR, arsB and arsC. Reduction of As(V) to As(III) is carried by arsC, while arsB codes for membrane bound As(III) efflux pump proteins. However, arsR negatively regulates the operon by expression of a repressor protein. There 3

are two sub-families of arsC depending on the reducing systems that catalyze this reaction. In the first sub-family represented by E. coli, ArsC uses reduced glutathione, glutaredoxin and single catalytic cysteine residue (Cys-12) to convert arsenate to arsenite. Glutaredoxin reduces the enzyme-bound As(V) intermediate to an enzyme-bound As(III) intermediate, and can participate in the reduction of disulfides between protein thiols and glutathione. The second sub-family uses thioredoxin/thioredoxin reductase for arsenate reduction as seen in Staphylococcus aureus and the mycothiol/mycoredoxin-dependent class as found in Actinobacteria [8]. It has been proposed [9] that these arsenic oxidizing and reducing bacteria coexist in the environment. Due to their omnipresence in particular niche, metabolic activity contributes to the speciation of arsenic [9]. Existence of many arsenic reducing and few oxidizing bacteria have been reported from arsenic enriched soda lakes in California viz., Mono lake and Searles lake [10], including the well discussed GFAJ-1 isolate [11]. In order to find novel source of arsenic transforming bacteria, we target an unexplored area Lonar lake, Maharashtra, India for the detection of such bacteria and characterized their physico-chemical properties. The soil of our study area contains < 4 mg kg-1 arsenic in soil of Lonar lake [12], present study provides the multiple evidences to support the hypothesis that either arsenite oxidizing or arsenate reducing bacteria coexist in the environment.

2. Materials and methods 2.1. Field sampling and screening of arsenic transforming bacteria

Enrichment of soil sample was carried out by amending with 5 mM As(III) and As(V) separately for isolation of arsenic tolerant and transforming bacteria. Soil sample (3 g) was inoculated in a 100 mL Erlenmeyer flask containing 30 mL Tris–mineral medium (TMM) 4

supplemented with 0.0005% ferric ammonium citrate and 0.1% trace element solution [13], along with 0.04% yeast extract and 0.5% sodium acetate. Flasks were incubated on orbital shaker at 30°C, 150 rpm for 7 days. Sub-culturing was repeated twice to isolate arsenic tolerant bacteria by serial dilution on 0.1x tryptic soya agar (TSA) plates. All the cultures were screened for their arsenic oxidation and reduction ability by growing them on TSA with 1 mM As(III)/As(V) for 5 days at 30°C and using silver nitrate screening method [13]. The colonies positive for As(III) oxidation and As(V) reduction were further characterized. Morphologically different colonies were isolated and purified by repeated sub-culturing on 0.1x TSA with 2 mM As(III) or As(V). Isolated cultures were stored routinely on 0.1X TSA and 20% glycerol at -80°C until further use.

2.2. Identification of the bacterial isolates and their phylogenetic relationship Identification of the potential isolates L-159a and L-37a were carried on the basis of 16S rDNA sequencing. Chromosomal DNA of the cultures grown in TMM supplemented with 0.5% sodium acetate was isolated [14] and was used as a template to amplify 16S rRNA sequences by polymerase chain reaction (PCR). The universal primers used were F27 and 1492R. The PCR products were sequenced using Big Dye terminator kit (Macrogen Inc, Seoul, South Korea). The 16S rDNA sequences were searched for homology at NCBI server using the BLAST (blastn) tool [15]. Phylogenetic analysis of 16S rDNA sequences were performed and phylogenetic tree was constructed using the neighbor-joining distance method with 1000 iterations using MEGA 6.0 [16].

2.3. Physiochemical characterization of identified bacterial isolates Oxidation of As(III) by Roseomonas sp. L-159a and reduction of As(V) by Nocardioides sp. L-37a was determined by molybdenum blue assay [17]. Roseomonas sp. L5

159a was grown for 48 h in TMM with glucose at pH 7.0, 1 mM As(III) and the inoculum (1%) was added to 30 mL media containing 2 mM As(III) and incubated at 30°C with 150 rpm orbital shaking. Nocardioides sp. L-37a was grown in As(V) in a similar manner. Samples were harvested after every 12 h to check colony forming unit (cfu) and arsenic transformation. Growth curve was plotted by taking absorbance at 600 nm, samples were serially diluted and 0.1 mL was spread on 0.1X TSA plate. The carbon source (glucose, fructose, sucrose, sodium acetate, sodium gluconate, glycerol and lactate), pH (4.0 to 10.0), temperature (25, 30 and 37oC) for the growth performance were optimized for these isolates. Further arsenic transformation abilities for Roseomonas sp. L-159a and Nocardioides sp. L37a were also determined. Abiotic control containing media and arsenic without bacterial cultures were used as a negative control for all the physiochemical parameters. For optimized conditions, biotic control containing media and bacterial culture without arsenic was used as positive control. To evaluate the As(III) and As(V) tolerance level the isolates Roseomonas sp. L-159a and Nocardioides sp. L-37a were grown in tryptic soya broth subjected to increasing concentrations of As(III) (1 to 20 mM) and of As(V) (10 to 150 mM). Biotic and abiotic flasks were kept as controls. Flask with media and bacterial cells was the positive biotic control, while only media and arsenic was the negative abiotic control. The entire test isolates, biotic and abiotic controls were kept for 5 days at 30°C, 150 rpm and growth was observed after every 24 h. Tolerance was checked in terms of measuring the maximum inhibitory concentration of arsenic at which there was no growth. Morphological changes occurring in the bacteria at maximum inhibitory concentration of arsenic was assessed by scanning electron microscopy.

2.4. Amplification of arsenic tolerance marker genes and enzyme assays 6

Marker genes coding for arsenite oxidase large (aioA) and small (aioB) sub-units, and arsenate reductase (arsC) were used for validating the arsenic oxidizing and reducing abilities of Roseomonas sp. L-159a and Nocardioides sp. L-37a, respectively. Primers used in this study were designed with Primer-BLAST [18] at the NCBI server and checked using the Oligocalc [19] (Table 1). Each reaction mixture contained approximately 15 ng of DNA; 3 mM MgCl2; 1X GC PCR buffer; 200 μM nucleotide mix; 2 pmol each of forward and reverse primer; and 1.5 U of Taq DNA polymerase (TaKaRa Bio Inc., Shiga, Japan) in a final volume of 25 μL. The PCR was carried out using Veriti thermal cycler (Applied Biosystems, Massachusetts, USA) with a cycle of 94°C for 4 min; 35 cycles of 94°C for 1 min, 55°C to 50°C with 0.5°C decrease per cycle for first 10 cycles and 72°C for 1 min each; and final extension at 72°C for 10 min. The PCR products were sequenced using Big Dye terminator kit (Macrogen Inc, Seoul, South Korea) and the sequences were confirmed by Blastp [18]. Arsenite oxidase small subunit (AioB) phylogenetic tree was constructed with 72 homologous protein sequences from NCBI. Similarly, all the reviewed 20 protein sequences of ArsC from Uniprot [20] were utilized for arsenate reductase (ArsC) phylogenetic analysis. All the input sequences were manually checked before using them in phylogenetic analysis. The multiple sequence alignments and phylogenetic analysis were performed with 1000 iterations using MEGA 6.0 [16]. To determine the arsenite oxidase activity, Roseomonas sp. L-159a cells were grown in optimized conditions and collected after 48 h growth and washed thrice with saline (0.9 % NaCl). Cells were re-suspended in buffer (200 mM Tris-HCl, pH 8.0 containing 0.5 mM sucrose, 1 mM EDTA, 1 mM phenyl methyl sulfonyl fluoride, 1 mg/mL lysozyme and 0.03% Igepal), incubated at 37°C for 90 min and was further sonicated for 7 min with a pulse of 60 sec at 100 Hz, centrifuged at 10000 × g at 4°C for 20 min and the supernatant was used for further analysis. Protein estimations were carried out by Bradford assay using bovine serum 7

albumin as a standard [21]. Arsenite oxidase enzyme was assayed for both the isolates by coupled reaction using artificial electron acceptor 2, 4-dichlorophenol indophenol (DCIP) and As(III) as the substrate. Reduction of 60 μM DCIP was monitored at 600 nm for 5 min in the presence of 200 μM As(III) in 50 mM 2-(N-morpholino) ethane sulfonic acid (MES) buffer, pH 6.0 at 30°C [4]. One unit (U) of arsenite oxidase activity was defined as the amount of enzyme necessary to convert one μM of arsenite per min under the standard conditions. Arsenate reductase activity was measured by NADH oxidation coupled with As(V) reduction [22]. Optimally grown Nocardioides sp. L-37a were washed thrice with saline, and sonicated for 5 min with a lapse of one min. Cell lysate was centrifuged at 10000 × g for 20 min at 4°C to obtain cell free extract. The assay mixture included cell free extract, reaction buffer (10 mM Tris pH 7.5; 1mM Na2EDTA; 1 mM MgCl2), 10 mM dithiothreitol, 2 mM arsenate and 3 mM NADH. The absorbance was read at 340 nm for 5 min. One unit of arsenate reductase was defined as reduction of one µM As(V) min-1 under given assay conditions. Enzyme assays were carried out in triplicate.

2.5. Quantification of transcripts Expression of aioA, aioB and arsC was analyzed with reverse transcriptase PCR (RTPCR). Primers were designed and checked for specificity using Primer-BLAST software (Table 1). RNA was isolated with nucleospin RNA III extraction kit (Macherey Nagel, Duren, Germany) using the manufacture’s protocol. Cells treated with 2 mM As(III) for Roseomonas sp. L-159a and 2 mM As(V) for Nocardioides sp. L-37a along with respective control cells at an interval of 12 h were used. Isolated RNA was treated with RNAse free DNAse (New England Lab, Massachusetts, USA) for removing DNA. The cDNA was synthesized using PrimescriptTM RT-PCR kit (TaKaRa Bio Inc., Shiga, Japan) using random hexamer primers. The real time PCR was performed using Master cycler ep realplex 8

(Eppendorf, Hamburg, Germany) with thermal cycling conditions of 10 min denaturation at 95°C followed by 40 cycles of 95°C for 0.15 sec and 60°C for 1 min [23,24]. The experiments were performed in duplicates for each transcript. Dissociation curve generated was checked to see the specificity of qRT-PCR products along with comparison with no template control. The generated threshold cycle (Ct) was used to calculate the transcript abundance relative to the reference gene according to the 2-ΔΔCt method [24]. Normalization of each gene was performed against 16S gene as reference [25].

3. Results 3.1. Elemental analysis of soil samples in Lonar lake Metal content analysis of soil sample from Lonar lake showed contents of arsenic to be 3 mg kg -1. Iron was found to be 105 g kg-1, molybdenum 20 g kg-1, selenium 850 mg kg-1, chromium 28 mg kg-1 and mercury 0.74 mg kg-1, in the soil samples. Other physicochemical parameters of soil were as follows (i) pH, 10.5; (ii) electrical conductivity, 5862 µS cm-1; (iii) total organic carbon, 0.39%; (iv) zeta potential, -29.13 mV and (v) cation exchange capacity, 65.70 meq/100 g of soil.

3.2. Identification of the bacterial isolates and phylogenetic analysis A total of sixty-nine bacterial isolates were screened for their arsenic tolerance and transformation abilities (Supplementary table S1). Based on their arsenic transformation ability, isolates L-159a and L-37a were further characterized. Isolate L-159a was a Gram negative, non-motile organism that grows as groups with pale white colonies, and showed 97.14% sequence similarity with 16S rRNA of Roseomonas cervicalis ATCC 49957. In the phylogeny tree, Roseomonas sp. L-159a also formed close group with R. aerophila NBRC

9

108923 and R. musae PN1. Other Roseomonas sp. were distantly related to Roseomonas sp. L-159a (Fig. 1). Isolate L-37a was yellow pigment producing, Gram positive short rod and non-motile bacteria showing 98.48% sequence similarity with 16S rRNA from Nocardioides ganghwensis JC2055. Nocardioides albertanoniae CD40127 and N. luteus ATCC 43052 formed sister groups with each other but clade out with Nocardioides sp. L-37a (Fig. 1).

3.3. Physiochemical characterization of identified bacterial isolates The growth and arsenic transformation of the isolates were optimized with varying physiological parameters viz. carbon source, pH and temperature. Roseomonas sp. L-159a efficiently used sodium gluconate for growth and As(III) oxidation amongst the different carbon sources. It failed to grow on lactate, glycerol and sodium acetate; however, moderate growth was observed on glucose, fructose and sucrose (Figs. 2a and 3a). On the other hand, Nocardioides sp. L-37a grew rapidly using all the carbon sources screened, except lactate. Poor growth was observed in glycerol, while there was no growth with lactate as carbon source. Growth of Nocardioides sp. L-37a and As(V) reduction was directly proportional and rapid when it was grown with glucose as the chief carbon source (Figs. 2b and 3b). Roseomonas sp. L-159a showed maximum growth and As(III) oxidation at pH 5.0 (Figs. 2c and 3c). Optimum pH for growth and As(V) reduction for Nocardioides sp. L-37a was obtained at pH 7.0. Arsenate reduction was maximum at pH 7.0, it was not significantly affected between pH 5.0 to 9.0 (Figs. 2d and 3d). After exposure of isolates to different temperatures from 25 to 37°C, it was found that Roseomonas sp. L-159a could grow and transform As (III) efficiently at 30°C (Figs. 2e and 3e) and Nocardioides sp. L-37a at 37°C (Figs. 2f and 3f). Under the optimized conditions arsenic transformation demonstrated that Roseomonas sp. L-159a oxidized 2 mM As (III) in 60 h (Figs. 2g and 3g). Nocardioides sp. 10

L-37a reduced 2 mM As (V) in 36 h (Fig. 2h and 3h). Roseomonas sp. L-159a showed tolerance towards 50 mM As(V) and 2 mM As(III), while Nocardioides sp. L-37a tolerated 100 mM As(V) and 5 mM As(III) (Supplementary Table S2).

3.4. Molecular insights in to arsenic tolerance mechanisms in these two bacterial isolates The presence of genetic mechanism for arsenic transformation was examined by amplification of arsenite oxidase large subunit aioA (GenBank accession no. KP782026) and small subunit aioB (GenBank accession no. KP782027) in Roseomonas sp. L-159a. Phylogenetic analysis of AioB showed 100% identity with small subunit arsenite oxidase of Roseomonas cervicalis ATCC 49957 (Fig. 4). Presence of arsenate reductase arsC in Nocardioides sp. L-37a was also recorded and deposited at NCBI with accession number KP782028. Partial sequence of ArsC from Nocardioides sp. L-37a formed close group with Oceanobacillus iheyensis (Q8ENQ5) (Fig. 5). However, additional characterization is required with full-length sequence of arsC from Nocardioides sp. L-37a as well as other species.

3.5. Candidate gene expression analysis correlated with biochemical analysis Roseomonas sp. L-159a showed inducible expression of aioA and aioB in arsenite treated cells. We noted 15 and 17-fold increase in the expression aioA and aioB transcripts, respectively at 48 h exposure of 2 mM As(III) as compared to untreated cells (Fig. 6a). Arsenate reductase (arsC) displayed 4.6-fold higher expression compared to unexposed cells of Nocardioides sp. L-37a at 2 mM arsenite in 36 h (Fig. 6b). Further arsenic treated Roseomonas sp. L-159a cells showed over 17-fold increase in arsenite oxidase activity compared to untreated cells at 48 h (Table 2). There was no detectable arsenite oxidizing activity in As(V) reducing Nocardioides sp. L-37a isolate. Arsenate reductase enzyme 11

activity was increased by over 4-fold than untreated cells (Table 2). While arsenate reducing activity was not detectable in Roseomonas sp. L-159a, it failed to show under various conditions tested.

4. Discussion Lonar lake is the only meteorite impact crater lake in the world, its hypersaline and hyperalkaline nature provides important ecosystems coping with extreme conditions. We explored Lonar soil for arsenic speciation, with a view to find new bacteria transforming arsenic oxyanions. Speciation of arsenic in a particular niche depends on the soil conditions: under aerobic oxidized condition As(V) is predominant while in anoxic reducing condition As(III) is predominant [34]. This study confirms that arsenic transforming organisms can coexist and are widely distributed in environment. Interestingly such organisms are not only found in arsenic contaminated areas but also in arsenic limited or devoid areas [9,17,30,35]. Although the significance of such occurrence is still unclear, a probable explanation is the presence of arsenic metabolizing system in these organisms that might be inducible in nature. Usually arsenic non contaminated sites have average <10 mg kg-1 of arsenic [27,30,31] while heavily arsenic contaminated soil in West Bengal, India has 54 mg kg-1 of arsenic [32]. Andalusia region of Spain has 33 mg kg-1 [33] arsenic which is far greater than the permissible limit. Previous geochemical studies by Osae et al. (2005) on various types of rocks in Lonar lake revealed arsenic concentration of 1.44 mg kg-1 in melt rocks while 0.6 and 0.58 mg kg-1 in glass spherule and basalt rock respectively. Chromium concentration of 117 mg kg-1 was found to be maximum in the basalt rock [12]. Roseomonas sp. L-159a was found to have ability of As(III) oxidation. It preferentially utilized sodium gluconate as the carbon source which ascertained the presence of active gluconate pathway in the organism. Gluconic acid is converted to pyruvate via three 12

intermediate steps with the help of gluconokinase, 6-phosphogluconate dehydrogenase and an aldolase [46]. Arsenic toxicity in Roseomonas sp. L-159a resulted in morphological changes that were visible under arsenic stress than control (Supplementary Figs. S1a and S1b). These changes were also supported by the growth curve studies, wherein growth was faster in control compared to arsenic stress samples [45]. Growth of Roseomonas sp. was insignificant below pH 4.0, hence, it did not favor lactate as carbon source [47]. Even though the optimum pH for arsenic transformation in minimal media was pH 5.0, it was able to grow from pH 6.09.0 in nutrient media with optimum at pH 8.0 (Supplementary Fig. S2), which was in accordance to the conditions of Lonar lake. Enzyme assays performed by cell free extracts confirmed that oxidation of As (III) was mediated by arsenite oxidase. Expression studies also confirmed the inducible nature of arsenite oxidase which is well documented [48]. Exposure to As(III) caused shrinkage in cells of Roseomonas sp. L-159a while Nocardioides sp. L-37a showed increase in cell size (Supplementary Figs. S1c and S1d); this finding is similar to that in Exiguobacteria As9 [28]. Growth curve studies revealed that growth of As (V) exposed cells was faster than control cells, thus, causing arsenate reduction at a faster rate. This might be due to direct fuelling of glucose into glycolytic pathway [49]. Nocardioides L-37a was able to grow at all pH ranges used. Its growth rate increased gradually from pH 4.0 to pH 6.0, it was optimum at pH 7.0 then decreased from pH 8.0 to 10.0. Interestingly when Roseomonas sp. L-159a and Nocardioides sp. L-37a were cocultured with both As(III) and As(V) together, oxidation of As(III) prevailed over reduction (Supplementary Fig. S3). Roseomonas has been used for pigment production [36] and preparation of butyrolactones [37], but not for arsenite oxidation. Nocardioides is known for biodegradation of p-nitrophenol [38], crude oil [39] and 2,4 dinitroanisole [40]. The present study shows that it can also be used for arsenite reduction. We characterized both the isolates with respect to 13

their arsenic transformation abilities at physiological, biochemical and molecular levels. To the best of our knowledge, there are no detailed findings on the arsenic resistant bacterial isolates from Lonar lake till now. However, Lunatimonas lonarensis was isolated from Lonar lake that showed nitrate reductase activity. Two arsenic tolerant genes were pointed out through gene annotation studies, but detailed arsenic transforming studies are lacking [41]. Though Roseomonas sp. L-159a and Nocardioides sp. L-37a were isolated from soil samples with 3 mg kg-1 of arsenic content, both the isolates were able to tolerate moderate concentration of As(III) and As(V). These findings clearly demonstrated that arsenic tolerance level of bacteria is not correlated to the arsenic content of the environment in which they thrive [14]. Bosea, an α-proteobacteria inspite of being isolated from arsenic rich groundwater, could resist 100 mM As(V) and 2 mM As(III) [26]. While Agrobacterium isolated from hot creek tolerated 5 mM As (III) [5]. Roseomonas could tolerate 2 ppm As (III) and 3 ppm of gold separately but could not tolerate 3 ppm gold when amended with 2 ppm As (III) indicating influence of arsenic on gold tolerance, where arsenic transformation activity was not reported [42]. Whole genome sequencing of Nocardioides sp. revealed the presence of arsenate reductase gene [43]. However, detailed physiological studies of arsenic tolerance and transformation mechanisms of these isolates are not known. Amongst the identified arsenic resistant Actinobacteria, Corynebacterium glutamicum could resist 12 mM As (III) and 500 mM As (V) [44]. Studies on the evolutionary inheritance of arsenite oxidase and arsenate reductase revealed that arsenite oxidase evolved prior to Archae and bacterial divergence took place, while arsenate reductase originated later in the evolution [50]. Phylogenetic analysis of arsenite oxidase from Roseomonas sp. L-159a shows clustering with Belnapia sp. F-4-1 (WP 043364505.1). Neighbor joining tree exhibited two major groups where α-proteobacteria covered the major part of the phylogenetic tree. Few organisms belonged to β-proteobacteria 14

were also present, followed by γ and ε-proteobacteria. Arsenite oxidase from archaebacteria Kineosphaera limosa formed an out-group. Interestingly AioB of Roseomonas sp. L-159a exhibited high sequence conservation at Cys, His and Gly at 107, 109 and 111th positions, respectively, among all the organisms used in phylogenetic analysis (Supplementary Fig. S4). Evolutionary analysis of arsenite oxidase from sea hydrothermal system revealed that aiolike functional genes were mainly associated with 2 classes of proteobacteria namely α- and β-proteobacteria. Phylogenetic tree of arsenotrophs with aioA gene contains mostly α and βproteobacteria, followed by some γ-proteobacteria. Roseomanas cervicalis was found to have aio gene to be present in Palaeochori Bay but did not report their arsenic transformation potential [51]. In the present study, Aio from Roseomonas sp. L-159a did not group with Aio from Starkeya, Roseovarius and Agrobacterium sp. which was similar to earlier report [51]. Chlorflexus Aio formed group with other bacterial groups like Proteobacteria, Aquificales, Deinococci and Chlorobia [52] which is also evident from the present study [52]. Arsenate reductase showed convergent evolution [53], with a separate cluster from Enterobacteriaceae species among the γ-proteobacteria [54]. The neighbor joining tree of Nocardioides sp. L-37a displayed two major subgroups; the first belonged to all Gram-positive organisms, where arsenate reductase from N. simplex and Nocardioides sp. L-37a were present. Further, the second group consisted of two parts, one belonging to Gram-negative organisms and the other part consisting of Gram-positive Nocardioides species. As expected arsC from Nocardioides sp. was present in other Gram-positive reviewed sequences (Fig. 5). Kimbrel et al. [43] suggested the presence of thioredoxin-like fold in arsenate reductase of Nocardioides sp. isolate CF 8, which was validated by the phylogeny of ArsC from Nocardioides sp. L-37a that grouped with Bacillus subtilis using thioredoxin for arsenate reduction activity [55]. Roseomonas sp. L-159a could oxidize As (III) while Nocardioides sp. L-37a could not; this was confirmed by the presence of genes encoding arsenite oxidase (aioA and aioB) 15

only in Roseomonas sp. L-159a. The AioB protein showed sequence homology with previously reported α-proteobacteria. Unlike arsenite oxidase, arsenate reductase was expressed constitutively and found in microorganisms like Synechocystis sp. isolate PCC 6803 [56] as well as in plants [57]. However, we could detect arsenate reductase gene only in Nocardioides sp. L-37a that corroborates As(V) reducing activity. Enzyme assay and expression studies support the arsenic oxidizing and reducing nature of Roseomonas sp. L159a and Nocardioides sp. L-37a respectively.

5. Conclusion Present study described the isolation of seven-arsenate reducing and three-arsenite oxidizing bacteria from Lonar lake soil. Further, the arsenite oxidizing ability of Roseomonas sp. and arsenate reduction by Nocardioides sp. were validated at the biochemical, enzymatic, genomic and transcriptional levels. This study reveals presence of significant number of arsenic resistant and transforming bacteria in soil containing less concentration of arsenic and provides clear evidence for the hypothesis that bacterial arsenic resistance is widespread environmentally. Lonar lake, unexplored for arsenic transforming isolates, shows bacteria with the novel function of arsenic transformation. Studies on the use of Roseomonas sp. L159a with antibiotic resistance for bioremediation of arsenic contaminated water in bacterial consortia are in progress. It will therefore be interesting to study the molecular structure and mode of action of arsenate reductase from Nocardioides sp. L-37a. It appears to be an ecologically robust organism because it can thrive under a wide variety carbon sources and wide pH range.

Acknowledgements Authors thank Dr. Rajendra Patil and Mr. Balkrishna Shinde for their help in gene expression work. We thank Sophisticated Analytical Instrument Facility, Indian Institute of Technology-Bombay (SAIF, IIT-B) for elemental analysis. This work at Savitribai Phule Pune University is supported by University Grants Commission, New Delhi, and University with Potential for Excellence (UPE-II). 16

6. References: [1] [2] [3] [4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14] [15] [16]

World Health Organization, Arsenic, (2012) Factsheet Number 372. R. Mukhopadhyay, B.P. Rosen, L.T. Phung, S. Silver, Microbial arsenic: Fromgeocycles to genes and enzymes, FEMS Microbiol. Rev. 26 (2002) 311–325. P.L. medley, D.G. Kinniburgh, A review of the source, behavior and distribution of arsenic in natural waters, Appl. Geochemistry 17 (2002) 517–568. G.L. Anderson, J. Williams, R. Hille, The purification and characterization of arsenite oxidase from Alcaligenes faecalis, a molybdenum-containing hydroxylase, J. Biol. Chem. 267 (1992) 23674–23682. T.M. Salmassi, K. Venkateswaren, M. Satomi, D.K. Newman, J.G. Hering, Oxidation of arsenite by Agrobacterium albertimagni AOL15 sp. nov., isolated from hot creek, California, Geomicrobiol. J. 19 (2002) 53–66. J.M. Santini, L.I. Sly, R.D. Schnagl, J.M. Macy, A new chemolithoautotrophic arseniteoxidizing bacterium isolated from a gold mine: Phylogenetic, physiological, and preliminary biochemical studies, Appl. Environ. Microbiol. 66 (2000) 92–97. C. Richey, P. Chovanec, S.E. Hoeft, R.S. Oremland, P. Basu, J.F. Stolz, Respiratory arsenate reductase as a bidirectional enzyme, Biochem. Biophys. Res. Commun. 382 (2009) 298–302. L. V Escudero, E.O. Casamayor, G. Chong, C. Pedrós-Alió, C. Demergasso, Distribution of microbial arsenic reduction, oxidation and extrusion genes along a wide range of environmental arsenic concentrations, PLoS One. 8 (2013) e78890. R.E. Macur, C.R. Jackson, L.M. Botero, T.R. McDermott, W.P. Inskeep, Bacterial populations associated with the oxidation and reduction of arsenic in an unsaturated soil, Environ. Sci. Technol. 38 (2004) 104–111. T.R. Kulp, S.E. Hoeft, L.G. Miller, C. Saltikov, J.N. Murphy, S. Han, B. Lanoil, R.S. Oreamland, dissimilatory arsenate and sulfate reduction in sediments of two hypersaline, arsenic-rich soda lakes: Mono and Searles lakes, California, Appl. Environ. Microbiol. 72 (2006) 6514–6526. F. Wolfe-Simon, J.S. Blum, T.R. Kulp, G.W. Gordon, S.E. Hoeft, J. Pett-Ridge, J. F. Stolz, S. M. Webb, P. K. Webber, P. C. Davies, A. D. Anbar, R. S. Oreamland, A bacterium that can grow by using arsenic instead of phosphorus, Science 80 (332) (2011) 1163–1166. S. Osae, S. Misra, C. Koeberl, D. Sengupta, S. Ghosh, Target rocks, impact glasses, and melt rocks from the Lonar impact crater, India: Petrography and geochemistry, Meteorit. Planet. Sci. 40 (2005) 1473–1492. M. Mergeay, L.D. Nies, H.G. Schlegel, J. Gerits, P. Charles, F.V.A.N. Gijsegem, Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to heavy metals, J. Bacteriol.162 (1985) 328–334. S.P. Bachate, R.M. Khapare, K.M. Kodam, Oxidation of arsenite by two β proteobacteria isolated from soil, Appl. Microbiol. Biotechnol. 93 (2012) 2135–2145. S.F. Altschul, W. Gish, W. Miller, E.W. Myers and D. Lipman, Basic Local Alignment Search Tool, J. Mol. Biol. 215 (1990) 403-410. K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0, Mol. Biol. Evol. 24 (2007) 1596–1599. 17

[17] S.P. Bachate, V.S. Nandre, N.S. Ghatpande, K.M. Kodam, Simultaneous reduction of Cr(VI) and oxidation of As(III) by Bacillus firmus, Chemosphere 90 (2013), 22732278. [18] J. Ye, G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen, T.L. Madden, PrimerBLAST: A tool to design target-specific primers for polymerase chain reaction, BMC Bioinformatics 13 (2012) 134. [19] W.A. Kibbe, OligoCalc: an online oligonucleotide properties calculator, Nucleic Acids Res. 35 (2007) W43–W46. [20] R. Apweiler, A. Bairoch , C.H. Wu, Protein sequence databases, Curr. Opin. Chem. Biol. 8 (2004) 76-80. [21] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [22] C.R. Anderson, G.M. Cook, Isolation and characterization of arsenate-reducing bacteria from arsenic-contaminated sites in New Zealand, Curr. Microbiol. 48 (2004) 341–347. [23] S. Koechler, J. Cleiss-Arnold, C. Proux, O. Sismeiro, M.-A. Dillies, F. GoulhenChollet, F. Hommais, D. Lièvremont, F. Arsène-Ploetze, J.Y. Coppée, P.N. Bertin, Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans, BMC Microbiol. 10 (2010) 53. [24] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T)) Method, Methods. 25 (2001) 402–408. [25] M. Li, Y. Hong, M.G. Klotz, J.D. Gu, A comparison of primer sets for detecting 16S rRNA and hydrazine oxidoreductase genes of anaerobic ammonium-oxidizing bacteria in marine sediments, Appl. Microbiol. Biotechnol. 86 (2010) 781–790. [26] V.H. Liao, Y.J. Chu, Y.C. Su, S.Y. Hsiao, C.C. Wei, C.W. Liu, C.M. Liao, W.C. Shen, F.J. Chang, Arsenite-oxidizing and arsenate-reducing bacteria associated with arsenicrich groundwater in Taiwan, J. Contam. Hydrol. 123 (2011) 20–29. [27] J. Ackermann, D., Vetterlein, H. Tanneberg, U. Neue, J. Mattusch, R. Jahn, Speciation of arsenic under dynamic conditions, Engg. Life Sci., 8 (2008) 589–597. [28] A.R. Achour, P. Bauda, P. Billard, Diversity of arsenite transporter genes from arsenicresistant soil bacteria, Res. Microbiol. 158 (2007) 128–137. [29] C.R. Jackson, S.L. Dugas, K.G. Harrison, Enumeration and characterization of arsenate-resistant bacteria in arsenic free soils, Soil Biol. Biochem. 37 (2005) 2319– 2322. [30] L. Cai, G. Liu, C. Rensing, G. Wang, Genes involved in arsenic transformation and resistance associated with different levels of arsenic-contaminated soils, BMC Microbiol. 9 (2009) 4. [31] E. Moreno-jiménez, E. Esteban, J.M. Peñalosa, The fate of arsenic in soil-plant systems, D. M. Whitacre (Eds.), Reviews of Environmental Contamination and Toxicology, Springer, New York, 978 (2012), pp. 14614-14636. [32] Shrivastava, A. Barla, H. Yadav, S. Bose, Arsenic contamination in shallow groundwater and agricultural soil of Chakdaha block, West Bengal, India, Front. Environ. Sci. 2 (2014) 1–9. [33] F. Martín, M. Diez, I. García, M. Simón, C. Dorronsoro, Á. Iriarte, J. Aguilar, Weathering of primary minerals and mobility of major elements in soils affected by an accidental spill of pyrite tailing, Sci. Total Environ. 378 (2007)49-52. 18

[34] S. Ramachandran, P. Fontanille, A. Pandey, C. Larroche, Gluconic acid: Properties, applications and microbial production, Food Technol. Biotechnol. 44 (2006) 185–195. [35] C.Y. Jiang, X. Dai, B.J. Wang, Y.G. Zhou, S.J. Liu, Roseomonas lacus sp. nov., isolated from freshwater lake sediment, Int. J. Syst. Evol. Microbiol. 56 (2006) 25–28. [36] K. Furuhata, K. Goto, Y. Kato, K. Saitou, J. Sugiyama, M. Hara, S. Yoshida, M. Fukuyama, Characteristics of a pink-pigmented bacterium isolated from biofilm in a cooling tower in Tokyo, Japan, Microbiol. Immunol. 51 (2007) 637-641. [37] D. Slyemi, D. Moinier, E. Talla, V. Bonnefoy, Organization and regulation of the arsenite oxidase operon of the moderately acidophilic and facultative chemoautotrophic Thiomonas arsenitoxydans, Extremophiles 17 (2013) 911–920. [38] N. Pandey, R. Bhatt, Arsenic resistance and accumulation by two bacteria isolated from a natural arsenic contaminated site, J. Basic Microbiol. (2015) 1275-1286. [39] M. Verma, D. Lal, A. Saxena, S. Anand, J. Kaur, J. Kaur, R. Lal, Understanding alternative fluxes/effluxes through comparative metabolic pathway analysis of phylum actinobacteria using a simplified approach, Gene. 531 (2013) 306–317. [40] H.F. Olivo, A.V. Antonio V. Osorio-Lozada, Microbial sulfoxidation and amidation of benzhdryl sulfanyl carboxylic acids and uses thereof, United States Patent US20070026507 A1, 2 (2009). [41] Y.P.J. Yoon, Y. Cho, S. Lee, K. Suzuki, T. Nakase, Nocardioides nitrophenolicus sp. nov., a p-nitrophenol-degrading bacterium, Int. J. Sys. Bacteriol. 49 (2016) 675–680. [42] Schippers, P. Schumann, C. Spro, Nocardioides oleivorans sp . nov., a novel crude-oil-degrading bacterium, Int. J. Sys. Evol. Microbiol. 55 (2005) 1501–1504. [43] T. Fida, S. Palamuru, G. Pandey, J. C. Spain, Aerobic biodegradation of 2,4dinitroanisole by Nocardioides sp. strain JS1661, Appl. Environ. Microbiol. 80 (2014) 7725–7731. [44] T.N.R. Srinivas, S. Aditya, V. Bhumika, P.A. Kumar, Lunatimonas lonarensis gen. nov., sp. nov., a haloalkaline bacterium of the family Cyclobacteriaceae with nitrate reducing activity, Syst. Appl. Microbiol. 37 (2014) 10–16. [45] V.H. Liao, Y.J. Chu, Y.C. Su, S.Y. Hsiao, C.C. Wei, C.W. Liu, C.M. Liao, W.C. Shen, F.J. Chang, Arsenite-oxidizing and arsenate-reducing bacteria associated with arsenicrich groundwater in Taiwan, J. Contam. Hydrol. 123 (2011) 20–29. [46] F. Moghadami, M. Payeghadr, Isolation of native arsenic bacteria from gold mine and evaluation of their tolerance, Int. Res. J. Appl. Basic Sci. 4 (2013) 2663–2665. [47] J.A. Kimbrel, J. Chang, D.J. Arp, L.A. Sayavedra-Soto, The draft genome sequence of Nocardioides sp. Strain CF8 reveals the scope of its metabolic capabilities, Genome Announc. 1 (2013) e00439-13. [48] E. Ordóñez, M. Letek, N. Valbuena, J.A. Gil, L.M. Mateos, Analysis of genes involved in arsenic resistance in Corynebacterium glutamicum ATCC 13032, Appl. Environ. Microbiol. 71(10) (2005) 6206–6215. [49] S. Duval, A. Ducluzeau, W. Nitschke, B. Schoepp-cothenet, Enzyme phylogenies as markers for the oxidation state of the environment : The case of respiratory arsenate reductase and related enzymes, BMC Evol. Biol. 8 (2008) 206. [50] T. Pichler, P. Jan, J.L. Meyer, Biological, archaeal and bacterial diversity in an arsenicrich shallow-sea hydrothermal system undergoing phase separation, 4 (2013) 1–19.

19

[51] E. Tatio, G. Field, A.S. Engel, L.R. Johnson, M.L. Porter, Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from EI Tatio Geyser Field, Chile, FEMS Microbiol. Ecol. 83 (2013) 745-756. [52] J. Messens, S. Silver, Arsenate reduction: Thiol cascade chemistry with convergent evolution, J. Mol. Biol. 362 (2006) 1–17. [53] N. Chaturvedi, P.N. Pandey, Phylogenetic analysis of gammaproteobacterial arsenate reductase proteins specific to Enterobacteriaceae family, signifying arsenic toxicity, Interdiscip. Sci. 6 (2014) 57–62. [54] J.A. Kimbrel, J. Chang, D.J. Arp, L.A. Sayavedra-Soto, The draft genome sequence of Nocardioides sp. Strain CF8 reveals the scope of its metabolic capabilities, Genome Announc. 1 (2013) e00439-13. [55] M.S. Bennett, Z. Guan, M. Laurberg, X.D. Su, Bacillus subtilis arsenate reductase is structurally and functionally similar to low molecular weight protein tyrosine phosphatases., Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 13577–13582. [56] L. López-Maury, a. M. Sánchez-Riego, J.C. Reyes, F.J. Florencio, The glutathione/ glutaredoxin system is essential for arsenate reduction in Synechocystis sp. strain PCC 6803, J. Bacteriol. 191 (2009) 3534–3543. [57] D.R. Ellis, L. Gumaelius, E. Indriolo, I.J. Pickering, J.A. Banks, D.E. Salt, A novel arsenate reductase from the arsenic hyperaccumulating fern Pteris vittata, Plant Physiol. 141 (2006) 1544–1554.

20

Figure legends Figure 1 Neighbor Joining phylogenetic tree comparing 16S rRNA gene sequence of Roseomonas sp. L-159a and Nocardioides sp. L-37a (highlighted) with other most closely related species following 1000 iterations; bar = 0.05 substitutions/sequence. Figure 2 Growth of Roseomonas sp. L-159a and Nocardioides sp. L-37a under different physiological parameters: (a) and (b) various carbon sources; (c) and (d) different pH range; (e) and (f) temperature; followed by growth curves of isolate Roseomonas sp. L-159a and Nocardioides sp.L-37a at optimized conditions (g) and (h) respectively. All the above experiments were carried out using orbital shaker with 150 rpm. Error bars represent mean ± SD of three experiments each performed in triplicates. Figure 3 Optimization of arsenic transformation at different physiological parameters by Roseomonas sp. L-159a and Nocardioides sp. L37a: (a) and (b) various carbon sources; (c) and (d) different pH range; (e) and (f) temperature; (g) optimized oxidation of 2 mM As(III) to As (V) by isolate Roseomonas sp. L-159a (h) Reduction of 2 mM As(V) to As(III) by isolate Nocardioides sp. L-37a, respectively. All the above experiments were carried out using orbital shaker with 150 rpm. Error bars represent mean ± SD of three experiments each performed in triplicates. Figure 4 Neighbor joining phylogenetic tree of AioB sequence of Roseomonas sp. L-159a (highlighted) with other homologous protein sequences from NCBI using 1000 iteration; bar = 0.1 substitutions/ sequence. Figure 5 Neighbor joining phylogenetic tree of ArsC partial protein sequence of Nocardioides sp. L-37a (highlighted) with reviewed sequences from Uniprot using bootstrap of 1000 iterations; bar = 0.1 substitutions/ sequence. 21

Figure 6 Transcriptional studies of Roseomonas sp. L-159a and Nocardioides sp. L-37a (a) Expression of arsenite oxidase large (aioA) and small subunits (aioB) in Roseomonas sp. L159a, (b) Expression of arsenate reductase (arsC) in Nocardioides sp. L-37a. Gene expression profiles were obtained by normalizing expression target loci with 16S rRNA as housekeeping gene and comparing it with the gene expression of untreated cells. Data points represent mean ± SD of two experiments.

22

Fig. 1 23

Fig. 2

24

Fig. 3 25

Fig

4. 26

Fig. 5

27

A)

B)

Fig 6

28

Table 1: Oligonucleotide primers used in the study Targeted

Primer name

Primer sequences 5’→ 3’

gene

aioA

aioB

arsC

Amplicon length Reference (bp)

Aio159lg-F

AAGCCTGGGCCCGGTACTCC

2600

This study

Aio159lg-R

TGGCCTACAAGCGCAACATTG

Aro159-F,

CTAGTAGAACATCGGGTAGCCCTT

346

This study

Aro159-R,

TGCGGGAGATGGAAATGTCGG

arsC4f

TCHTGYCGHAGYCAAATGGCHGAAG

350

Escudero et. al., 2013

arsC4r

GCNGGATCVTCRAAWCCCCARTG

350

Real Time primers aioA

aioB

ACR3(2)

RTroseAioLg-F

TGGCTCTGCTTCTTGTCCAG

RTroseAioLg-R

GCGAGCTGAACAACTGCTAC

RTroseARO-F

GGCGAGCCGAGCTTGATGAGCAC

RTroseARO-R

CTGGCCAATCTGCGCGACCTG

RTAcr159-F

CCTGGAGGAAGGTCACGTA

RTAcr159-R

GGCCTGGAAGAGAACCAAG

148

This study

150

This study

146

This study

29

Table 2. Arsenic transformation assay of Roseomonas sp. L-159a and Nocardioides sp. L37a Arsenite oxidase activity for Roseomonas sp. L-159a (µM min-1 mg-1 of protein) Cells without Cells with As(III) 2 mM As(III)

Arsenate reductase activity Nocardioides sp. L-37a (µM min-1 mg-1 of protein) Cells without Cells with As(V) 2 mM As(V)

0.68±0.01

13.6±1.8

12.09±0.4**

for

58.4±3.4*

Values are the mean of three independent experiments ± S.D. *p<0.0001 significantly different from control by unpaired t-test **p<0.0005 significantly different from control by unpaired t-test

30