Characterization of sequence changes in kinetoplast DNA maxicircles of drug-resistant Leishmania

Molecular and Biochemical Parasitology, 56 (1992) 197-208 © 1992 Elsevier Science Publishers B.V. All rights reserved. / 0166-6851/92/$05.00

197

MOLBIO 01844

Characterization of sequence changes in kinetoplast DNA maxicircles of

drug-resistant

Leishmania

S h o - T o n e Lee, Chi T a r n a n d C h a o - Y u a n W a n g Laboratory of Molecular Parasitology, Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan (Received 22 April 1992; accepted 20 July 1992)

We have compared kinetoplast DNA maxicircles of tunicamycin- and arsenite-resistant variants of repeatedly cloned Leishmania mexicana amazonensis showing DNA amplification with wild-type and arsenite-resistant variants of the same lineage that do not show DNA amplification. DNA restriction patterns and the degree of cross-hybridization between maxicircle DNA fragments of parasites displaying DNA amplification and those of parasites without amplification were examined. In addition, the nucleotide sequence of the cytochrome b (Cyb) gene from the coding region was compared between these two groups of parasites. Extensive changes were found in the nucleotide sequences and the amino acid sequences of the cytochrome gene of the maxicircles of variants with DNA amplification. The Cyb genes from both groups had much shorter open reading frames than the same gene from Leishmania tarentolae and Trypanosoma brucei. The simultaneous changes in maxicircles and minicircles of these variants suggest that they may confer the advantage of maintaining viable mitochondrial function under selective pressure. Key words: Kinetoplast; Kinetoplast DNA; Maxicircle; Drug resistance; Leishmania

Introduction

Kinetoplast DNA (kDNA) maxicircles of trypanosomatids are analogous to the mitochondrial genome of other eukaryotic cells. Twenty to fifty maxicircle copies are interlocked with thousands of minicircles of 0.5-2.8 kb to form a giant network [1,2]. The maxicircles range in size from 20 to 39 kb depending on the species [3-5]. They contain Correspondence address: S.T. Lee, Laboratory of Molecular Parasitology, Institute of Biomedical Sciences, Academia Sinica, Taipei, 11529, Taiwan. Note: Nucleotide sequence data reported in this paper have been submitted to the GenBankT M data base with the accession numbers M92828 (pBCyb-A'l,2), M92829 (pBCybA1,2,3,4,5) , M92830 (pBCyb-Wi,2,3)and M97359 (pBCyb-Ti.2). Abbreviations: Cyb, cytochrome b gene; pBCyb, cloned cytochrome b gene; Hepes, 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid; SDS, sodium dodecyl sulfate; EtBr, ethidium bromide; PCR, polymerase chain reaction.

rRNA genes and structural mitochondrial genes such as cytochrome b, cytochrome oxidase, N A D H dehydrogenase, and several unidentified open reading frames arranged in a segment that comprises 50-75% of the total length of the maxicircle. A 15-17-kb coding region of maxicircle DNA in Trypanosoma brucei and Leishmania tarentolae is actively transcribed and is conserved between species [6-10]. The remaining segment is a nontranscribed divergent region, totally different between species, which shows some variation within the same species [2,6,11]. The rapidly evolving divergent region contains few restriction sites, being made up predominantly of short tandem A + T rich repeats [2,11,12], which are believed to be prone to mutational changes such as deletion/insertion and sequence rearrangements. These events contribute to sequence changes and size variations in maxicircles [6,12]. The complete nucleotide sequences of the coding regions and parts of

198

the divergent regions of maxicircles from T. brucei and L. tarentolae and of portions of the maxicircles of Crithidia fasciculata are known [13-17]. The coding regions from all species and genera are organized in colinear fashion and are apparently homologous within a given species [6]. Recently, we have found that the restriction patterns of kDNA maxicircles and minicircles differ between Leishmania parasites with and without DNA amplification [18]. Two structurally and functionally different drugs, namely tunicamycin and sodium arsenite, have been reported [19,20] to produce drug-resistant variants of L. mexicana amazonensis that show extrachromosomal DNA amplification. These variants contain a 63-kb and a 69-kb circular DNA species, respectively. These two circular DNAs originate from different chromosomes, exist in multiple copies, and contain genes responsible for resistance to the respective drugs [19,20]. However, similar changes occur in both kDNA maxicircles and minicircles in the kinetoplasts of these variants. To investigate possible mechanisms for these changes, we have characterized the differences in maxicircles between drug-resistant variants with DNA amplification and those without it.

Materials and Methods Parasites. L. m. amazonensis (LV78) promastigotes were grown at 27°C in medium 199 with 20 mM Hepes, pH 7.4, supplemented with 10% heat-inactivated fetal bovine serum (HIFB_S~, 100 units m1-1 penicillin and 100 #g m l - streptomycin [18,21]. Cloning of parasites. Promastigotes grown to stationary phase were counted and cloned by limiting dilution to 2.5 parasites ml-~ in the medium, and 0.2 ml theoretically containing 0.5 parasites was distributed into wells of a 96well plate (Falcon). The plates were sealed with parafilm and incubated in a humidified incubator at 27°C. Some wells containing a single cell were observed under the microscope. A cloning efficiency of 2.5% was obtained

after 7 10 days of culture. Two clones obtained by this limiting dilution method were subcloned by the agar plating method [22] by spreading 0.1 ml medium containing 10 parasites on a 1% agar surface in complete culture medium to avoid overcrowding of the colonies formed. Colonies that formed 12-14 days after incubation at 27°C were harvested. A cloning efficiency of 55% was obtained by this procedure. Drug-resistance selection. Cloned and uncloned wildtype promastigotes (W) grown to stationary phase were selected for drug resistance by stepwise exposure to either tunicamycin or sodium arsenite [18-20]. Resistant variants with and without DNA amplification were identified in Southerns with cloned extrachromosomal DNA fragments as probes as described previously [1820]. In arsenite resistance selection, variants with (A) and without (A') DNA amplification were selected in the cloned and uncloned parasites. In tunicamycin-resistant variants (T), DNA amplification was always the case. The following is a list of the variants derived from cloned and uncloned L. m. amazonensis: W2-23, A'2-23, A2-23 and T2_23, from clone 2-23; Wz-s, A'2-a and A2-8, from clone 2-8; and uW, uA', uA and uT from uncloned parasites. W2_ 23, A'2-23 and A2-23 were subcloned again. The amplicons from arsenite- and tunicamycinresistant variants were comparable in size as well as restriction patterns to those described previously [ 19,20]. D N A isolation. Kinetoplast DNA networks were isolated as ~reviously described [22,23]. Briefly, 1 2 x 10 promastigotes were lysed in 5 ml lysis buffer (0.2 M NaC1/10 mM TrisHC1/10 #M E D T A / I % SDS, pH 8) and sheared through a 26 gauge needle. After digestion with proteinase K (100 #g m1-1) at 42°C, kDNA networks were pelleted by centrifugation and extracted with phenol/ chloroform/isoamyl alcohol (25:24:1). The kDNA was further purified by cesium chloride-ethidium bromide (CsC1-EtBr) equilibrium centrifugation and stored at 4°C. Plasmids

199 with DNA inserts were isolated by alkaline lysis [24] followed by CsC1-EtBr equilibrium centrifugation [25]. Restriction, gel electrophoresis, blotting and hybridization. DNAs were restricted by endonucleases according to the information provided by the manufacturers (BRL, NEB). Agarose gel electrophoresis, blotting on Nytran filters (Schleicher and Schuell) and Southern hybridizations were carried out by standard methods [26]. Probes for hybridization were labeled with 32p (Multiprime labeling system, Amersham). Prehybridization and hybridization of blots were carried out in the same solution (5 x SSC, pH 7.4/10 x Denhardt's/0.05 M sodium phosphate, pH 6.7/0.5 mg m1-1 salmon sperm DNA/50% formamide) at 42°C for 16 h (20 x SSC = 88.2 g sodium citrate/175 g sodium chloride, pH 7.4). Blots were washed twice with 2 x SSC/0.1% SDS for 15 min each at room temperature followed by two washes with 0.1 x SSC/0.1% SDS for 30 min each at 60-65°C. Blots were exposed to Kodak X-OMAT film for 8-24 h with the use of an intensifying screen (Dupont). Cloning and sequencing. Cytochrome b (Cyb) genes of wild-type L. m. amazonensis and its drug-resistant variants were cloned by polymerase chain reaction (PCR). We produced two oligomers derived from sequences at the 5' end (Pl, a 21-mer) and the 3' end (P2, a 19-mer) of the published Cyb gene of L. tarentolae [13]: P1 = 5'-ATAATTATAAAAGCGGAGAGA, sense (3181-3201 nt) [13]; P2 -- 5'-CTAATCTACATACAACTAG, Antisense (4246-4264 nt) [13]. PI and P2 were synthesized (ABI 391 synthesizer) using standard phosphoramidite chemistry and purified by OPEC columns (Applied Biosystems). These oligomers were used as sense and antisense primers in PCR with the kDNA networks from different variants as templates. PCR was carried out using standard buffers and Taq polymerase (Perkin Elmer Cetus). The primer and nucleotide concentrations were 0.5 #M and 50 /~M, respectively. A Perkin-Elmer thermal cycler

was used with 2 min of denaturation at 94°C, 3 min of annealing at 45°C and 3 min of extension at 72°C for each cycle. A total of 35 cycles was carried out. The products of approximately 1.1 kb from each variant were individually cloned through an EcoRI site by blunt end ligation using T4 ligase into a Bluescript (SK-) vector. After transformation into E. coli SURE strain (Stratagene), plasmids with DNA inserts were isolated and sequenced to completion by the dideoxy chain termination method [27] and by an ABI 370A DNA sequencer using the computer software 373A DNA sequencing system (Applied Biosystems). A total of 12 cloned Cyb genes were selected and sequenced using kDNA networks from different variants as templates in PCR. The following are the Cyb genes sequenced using kDNAs from different variants as templates, as indicated in parentheses: wild-type, pBCybW1,2 (W2_23) and pBCyb-W3 (uW); arseniteresistant variants without DNA amplification, pBCyb-A'l (A'2-23) and pBCyb-A'2 (A'2-8); arsenite-resistant variants with DNA amplification, pBCyb-Al,2 (A2_23), pBCyb-A3,4 (uA) and pBCyb-A5 (A2-8); tunicamycin-resistant variant with DNA amplification, pBCyb-T~ (T2_23) and pBCyb-T2 (uT). Results

Maxicircle DNAs are altered in L. m. amazonensis with DNA amplification. Fig. la compares kDNAs from wildtype (W), A', A, and T variants (derived from clone 2-23) treated with 4 different endonucleases (PstI, HpaII, HaeIII and MspI). Different restriction patterns were obtained for both maxicircles (upper part of Fig. la) and minicircles (lower part of Fig. la, below 1 kb) between parasites with DNA amplification (A and T, Group I) and those without DNA amplification (W and A', Group IX). The difference in restriction patterns between kDNAs of Group I and II parasites signifies that changes had occurred in the nucleotide sequences of maxicircles isolated from parasites with DNA amplification.

200

a

, ~

Hp

H

W A' A

T W AI A T W

AJAT

b

~ WA'A

T

W AI

H~

~ A

T

W ~

A

N T

W

c

M A~ A

T

W

A~

A

T

W

P A~ A

Hp T

W A'

A

H_ T

W

A'

A

~

p

d

M T W

A

T

~

I

Hp ~

T

~

H ~

r,"

~

~

~2 ~

Fig. 1. Difference in restriction patterns and gene sequences of kDNA ma×icircles between Group I and Group II L. m.

amazonensis promastigotes. (a) kDNAs from Group I (A and T) and Group II (W and A') parasites were digested with various endonucleases and 2 #g of each sample was electrophoresed on a 0.8% agarose gel. The blot from |a was probed with (b) pBCyb-W; (c) pBCyb-A and (d) 200 bp PCR product synthesized from pBCyb-A (see text). W, A', A and T indicate the source of kDNAs. W, wildtype; A', arsenite-resistant variants without DNA amplification; A, arsenite-resistant variants with DNA amplification; T, tunicamycin-resistant variants with DNA amplification, pBCyb-W and pBCyb-A: Cytochrome b gene cloned from wild-type and A variant respectively. P, Pstl; Hp, Hpall; H, Haelll; M, MspI.

Several DNA fragments were electroeluted from the agarose gel: a PstI-linearized single DNA fragment from wild-type (W~) and A' variants (A'I) (Fig. 2a, solid arrow) and 2 visible bands from variants A (A] and A2) and T (T1 and T2) (Fig. 2a, open arrows). These DNA fragments were used individually as probes in cross-hybridization experiments on the blot shown in Fig. 2a. W~ hybridized strongly to kDNAs from W and A' parasites (Fig, 2b) and A~ and A2 hybridized strongly to kDNAs of their own group (lanes A and T, Fig. 2c and d), when used as probes separately on the same blot after removing the probe, DNA fragments T~, T2 and A'~ behaved the same as A1, A2, and W] respectively (data not shown). Very faint cross-hybridization signals were observed between the maxicircle DNAs from the 2 groups of parasites. The difference in maxicircles between the two groups appears to be very extensive as judged by the intensity of the hybridization signals. This difference may involve both the conserved and divergent regions of the circles. The smaller hybridization bands with ladder formation represent minicircles which contaminated the probes

during electroelution from gels. Cytochrome b genes are different between drugresistant parasites with and without DNA amplification. We sequenced 12 cloned Cyb genes from parasites representing wildtype (pBCyb-W1,2,3), arsenite-resistant variants without DNA amplification (pBCyb-A'I,2), arsenite resistant variants with DNA amplification (pBCybA],2,3,4,5), and tunicamycinresistant variant with DNA amplification (pBCyb-T1,2). Nucleotide sequences of Cyb genes within each group of variants were identical irrespective of the source of kDNA templates used for PCR (see Materials and Methods for details). Furthermore, pBCyb-W (1071 bp) and pBCyb-A' (1071 bp) from Group II parasites were identical. This additional evidence proved that maxicircles of variants without DNA amplification were the same as those of wildtype. The Cyb genes from Group I variants, pBCyb-A (1089) and pBCyb-T (I 104 bp) were almost identical with 98.2% identity. The differences were mainly due to additions/deletions and several base replacements on pBCyb-T. These differences

201 a WA'AT

b WA'AT

c W A ' A T

d W ~ A T

kb

23.1 _

q ~,lor T1

9.46.6-

~,2orT2 4.3-

- - -

o.56-

-

W1

A1

A2

Fig. 2. Difference in maxicircle kDNAs between Group I and Group II parasites by cross-hybridization. (a) PstI-restricted kDNA maxicircle fragments from Group II (Wl or A'l, solid arrows) and Group I parasites (AI and A2 or T1 and T2, open arrows) were electroeluted and used as probes in Southern hybridization. The same blot from (a) was probed with (b) Wh (c) A~ and (d) A2. See legend to Fig. 1 for W, A', A and T. Maxi and mini represent the regions in the gel for maxicircles and minicircles respectively.

were mainly localized between the nucleotide sequences of 160 to 370 nt (not shown). The rest of the 5' end and the 3' end of the gene were identical, pBCyb-A and pBCyb-T shared 64-65% identity with the Group II Cyb genes. Fig. 3 shows the comparison between Group I and Group II Cyb genes as represented by pBCyb-A and pBCyb-W. They shared a stretch of 300 bp with higher homology at the 3' end of the genes, but did not align well over the rest of the sequences. Both ends of the Cyb genes from both groups were almost identical in sequence to the Cyb gene from L.

tarentolae from which the initial primers for PCR were derived (compare Fig. 3, solid underlines with arrow to P1 and P2 in Materials and Methods). Differences between the two groups of genes were verified by Southern hybridization during which the blot from Fig. la was probed either with pBCyb-W or with pBCyb-A. The pBCyb-W probe hybridized strongly in all digests to maxicircle fragments from wildtype (W) and from variants without DNA amplification (A') (Fig. lb). However, it hybridized only faintly to maxicircle DNA fragments from variants

202

p B C y b-W

I ~--~]%TTATAAAAGCGGAGAGAAAAGAAAAGGCTT

;I;I Jl li1111"[illl} pDCyb-A pBCyb

W

II J

- T T G C - - J f T A C T A C . . . . GT - G T T T A T G G T G q A G G T i T'i AS2 T fA<;<]'ii:

I

II r

I

88 ....T T T r A T T T G T - A T G C A G A T C A T A T G T G G T G T T T G T T T A G C A T G A T T A T T T T T

I

li

I

il

Ill IIIII

IL ] hl III

Lllllill

I

--

..... TAGTTGTTTTATATGTACAGAACTGATAT~']'TCFTTTA

III]II

I

I I I III] III II

lil L~J!,!

I I:

TTTTTATGAGATTTTGATTTAGGGTGTAATACGAAGATcACATATTT---GTTTACATCATTATTATTTTTTCTTCTTTATGTTACATA

II i II 198

II

I

I

II

II

III

I

II I[]

IIII II III

III II

I

I

TATqTA

I 111 Iii

ATTTTGTAATAcGAAGTAcACATA-TTAGTTTTACTTCT~TATTArTTTTAcCTTTTATAT-ATTcATATATTAAGTGTATAGTATTA

269 A G C T G C A T A - G T A T T A A T A - A T A T T T G A C A C A C A T A T T T T G T G T G T G G T A G G T T T T G T A A T A T A T A T A T T T A T A G T A G A A T - A G G T T T T A T T ~ G ? T A T C ~

pBCyb-A

294 A C c A A T r T A G G T A G T A G T A T A G A G T T T G T A T A T A T A T T T T A T A G A T - - A A T G T T T A T T G T T A T G T T T T A C C A T - G T A C A A T G A T G T C T T A T T G - - - A G G C

I I

II Ill II IL I I II

I I llll]II

I

I

[ IIII

1

III L I

II I[] lli I }I iil!!l

pBCyb-W

366 T T T A C C A T G T A C A A T G A T G T C T T A T T G G G G A T T A A C A G T G T T T A G T A A T A T T T T A G C A A C T G T C C A G T T A T T G G T A C T T G A c r T T G ~ T A T T G A A T A T ~ A G

pBCyb-A

388 T T A A C T G T A T T T A G T A A T A T T T T A - G C A A C A G T A c C T G T T A T A G G C A C T G A C T T T G T T A T T G - - - A A T A T G A G G T A - G T G A A T A T A T T A A T G A T T ~ T A C A

li II

I I

I i II I ll}

I II [ II

I

I I I

II I

I II

I i

fill

Ill I !

466 G T A G T G A G T A T A T T A A T G A T T T T A C A T T T T A A A A T T A c A T G T A T T G c A T G T A C T A T T A C c T T T T G T A T r A A T A c T G T T A T A T T - T A T G C A T T T S T T U i ~ 2

pBCyb

484 T T A C T - - - T A A A T T A C A T G T T T r A C A T G T T T T A T T G C C - - - T T T T G T A T - T A A T A T T A - - - G T T A T A T T T A T G C A T r T A T T T T G T T T A C A T T T T A T G ~ C ~

II ]Ii]

llllIIII

II

i I

I

1 III II il IIIII

II IIII II I

I

II ili I I

pBCyb-W

II I

lJl: I

ATAATI'Af'IGA

pBCyb-W

A

[ :

~TGTAGGTTTTAGTTTAGGTTT'YTT~AfTr'~]'Ti'

98 G C A A A T T A T T T G T G G T G T G T G T T T A G C A T G A c T r T T T T T T A G T T G T T T T A T T T G T A C A A A T r G G T A T T T r G T A T - T A T T T T T A ~ G A G A U : ~ T G A T T T A G ~

pBCyb-W pBCyh-A

- _-TTAACTTCAGG-

LIfiZil

] A T A A T T A T A A A A G C ~ G A G ~ ~ G A A A A G A A A A G G C T T A A C T T C A G G T T G T T T A T T A ~ G A G T~_ _ _ T :

IIllllll pBCyb-A

r]

IIII I! I

I[!ll

]

I'

pBCyb-W

565 T T A c A T - T A T T T T A T G - - A G T T C A G A T G G T T T T T G T G A T A G A T T T G C A T T T T A T T G T G A A C C T A T G T T T T ~ T A T G T G G T T T T A T T T G C G T G A T A A T G ~ f ~ ] `

pBCyb-A

574

pBCyb-W

662 T T G G C Y T T T T T G A T A T T A T T T T T T G T G A T T T T A T T T T T A T A A A

pBCyb-A

675 T A A T A T A T T T T A T T T T C A T T A ~ T T G A T A T T T T G T T T T C A T ~ A A G A G T C T T G G G T T A T T G T G - G A T A C A T G A A G A ~ T C T T ~ G G T T A T - G T G G A T A ~ A T ~ A A A

pBCyb-W

756 ~ A C A T T C T G A T ~ A G A T T c T T C C T G A A T G G T T T ~ T T T A T T T T T A T T c G G A T T T T T A A A G G C T G T A C C A G A T ~ A A A T T T A C T ~ G T T T A C T A ~ T G A T G G T A A

pBCyb-A

775 A A c A - T C T G A T A A A A r T T T G C C T G A A T G G r r T T T T ~ T A T T T T T A T T C G G C T T T T T A A A A G c A G T A C C A G A T A A A A T ? T A C T G G T T T A ~ T G T T A A T ~ G T T A

pUCyb-w

855

TTTTATTATTTTcTTTATTTTTGTTTATATrAAATTGTATATTATGATTTGTGTAT~G?AGAAGTrCATGAGTATG~TTAACATACrCATGAATCqTAT~`

pBCyb-A

824

lll[lll llJllllIl{lli[lllllilllllil]II[lliliilJlllll llIl[llIllillli[ I lllllll llIil !il II llJll TTTTRT~rZT~rTT~TT~T~TT-T~TATTAAATTGTATATTATGATTTGTATATTGTAGAAGTTCATT~TTATGATTC~C~TAT]~CAT~]`[`AT~T~AT~

I I II

1111 II

Ii i

I

II IIIIII

I I II

II}

IIII

I

IIIII

I

}ii

I

II i

TCAGATGGTTTTTGTGATAGATTTGcATTTTATTGTGAACGrTATG--TTTGTATGTGGTTTATTAAGAGATATGTTTTAGcATTTTAATAT~[~A1`~iTL~i~]

I. . . . I - ] [ F I - - q - [ - ] - I q - - I I I

illl llllil]i

IIII]

till

..... TTGATATTTTGT-TTTTCATGAAGAATCATGAGTAATAGTTGATACCTTALA

II II

III I IIIIIIIIIIIIIIII]111111111111

Ill

I ]111

llilIlll

I Iil11111

II lllllllli

II II II II

llllll]lIlllll

pBCyb-W

955 T T ~ T ~ A T A T T G A T G G G T G G A T T T T T A G C G T T A T A G T G T T A T A ~ T A G C G T ~ T ~ C T A T A T G T A T G G A ~ T T ~ C A ~ T A T T ~ G T ~ T T A C T T C T A r T T A T ~ ] ' T

pBCyb-A

974

J lill

I:1il

I II ii:'I

,

IIIIII lilll lil illl l{IIllll II li IILIIIIIIIII fiLl1111111 IIIIIIIIIIIII III II Ill II lllll!llli

pBCyb-A1073

TTATAGTATATTTATGAGTGGrTrT~TAGCT~TGTA-TGTTA~ATTAGCATATCCTATATG~ATGGAATTACAATr~TGCGrTTTACTTTTATTTAq~

/11 III]11111]111

AGTTGTATGTAGATTAG

Fig. 3. Alignment for comparison by FESTA between the cytochrome b (Cyb) genes cloned ~om wildtype (pBCyh-W) and A variant (pBCyb-A). Solid underline at 5' and 3' end with arrows: primer positions for PCR, derived ~om Cyb gene of L. tarentolae [13]. Boxes, Initiation codon for each gene; double underline, TAA for stop codon; solid underlines with solid arrowheads, antisense primers for PCR amplification with P~; solid underline with open arrowhead, sense primer for PCR with P~.

with D N A amplification (Fig. lb, lanes A and T). The reverse was true when pBCyb-A was used as probe; the hybridization signals were much stronger with maxicircle D N A fragments of A and T variants (Fig. lc) than with those of wildtype and A' variant (Fig. lc, lanes W and A'). Probing with pBCyb-A' and pBCyb-T gave the same results as with pBCyb-W and pBCyb-A respectively (not shown). Cyb genes from Group I cells (pBCyb-A and pBCyb-T) also encoded different amino acid (aa) sequences from those of Group II cells (pBCyb-W). pBCyb-W had an open reading frame of 765 bp, pBCyb-A and pBCyb-T had 723 bp and 741 bp respectively. The two groups shared only 40-45% identity with two conserved sequences of 23 and 27 aa (Fig. 4, brackets), pBCyb-T shared another short

sequence of 8 aa with pBCyb-W, but this region was totally different in pBCyb-A (Fig. 4, double underline). The main aa sequence differences between the two groups of genes were due to the use of initiation codons in the reading frames. Whereas pBCyb-W started from ATA (isoleucine) at the very 5' end (Fig. 3, boxed) pBCyb-A and pBCyb-T used A T G (methionine) at the 61 nt position (Fig. 3 boxed) as the starting site owing to the presence of a termination codon (TAA) at 34 nt (Fig. 3, double underline). This shift probably accounts for all the differences in Group I Cyb gene aa sequences. The two group I genes pBCyb-A and pBCyb-T also differed from each other in some short aa sequences (Fig. 4), but they shared 85% overall identity in aa sequence (Fig. 4, boxed areas).

203

II htCyb pBCyb-W pBCyb-A pBCyb-T TbCyb

i i 1 1

-IIIKAERKE KALTSGCLLR VYGVGFSLGF F-ICMQIICG VCLAWLFFSC -. . . . . . . . . . . FNFRL.TT CLWCR.VFR..YLYADHMWC LFSMII.VLF ................ JMVV .LV.V.---L .-V.KLFVVC .VHDFFLVVL ................ -IMVV . L V . V . - - - L .-V.KLFVVC VHDFFLVVL 1 ILYKSG.KRK G L L M .... Y. IV . . . . . . . . . -.AL ...............

LtCyb pBCyb-W pBCyb-A pBCyb-T TbCyb

79 79

FICTNWYFVL FLWDFDLGFV IRST!{ICFTS YMYRTDILFY .YEILIV.-... RS~i.. L H E .V Q I G - I L ~ . . . . . . . . . ~ S . . , ~ . . VOIG-ILIYY .YEILIVD :...S ................... %'ii::.!. . . .

III LLFFLLYV~I F-KCIVLIIL YY. ,FFML~i I, . K L H S I N N . W

FDTHILVWAV HTYFVCGRFC

GFIIYIFIVV NIY..---SR

__

..

29

59 80

IV IGFIGYVL~C TMMSYW~LTV FSNILATVPV IGTWLCYWIW .... "t. . . . . . . . . . . . . . . . . . . . . . . IQL L V L - - - D F V I

DNw .

.

.

.

.

~.

. . Y L . . . I i ! i.

.-.S.T ............

FI

v.~.

....

I_

.......................

.

.

.

.

.

.

...LFV..II

.A . . . . . . . . . . . . . . . . . . . . . . . . . . .

GSEYINDFTL

LKLHV--L~V

158

159

...F ...........

LLPFVLILVI

FM~LFCLHYF

MSSDGFCDRF

LtCyb pBCyb-W pBCyb-A pBCyb-T TbCyb

235

VYFIFINWYE

241

--.

.... I . L I I L

IL!!::. . . . . . . . . . .

DTLKTSDKIL

PEWFFLFLFG

213 235

VFHEESWVIV

D:::::::

.

.

.

CMWFYLRD-M

A ............

FLKAVPDKET

S.-

GLLLMVILLF

.. .. .. . .

.

.

.

FLAFLILFYV

.

........ - .....

SLFLFILNCI

S..LCM

LWFVYCRSSL

FW . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

'

...............

FS.RV.GYC. M.V . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

VIII LtCyb pBCyb-W pBCyb-A pBCyb-T TbCyb

AFYCERLCFC

!!i !i!!ii!! !! i!!!( . . . . . . . . . . . . . . . . . . . . . .

.

Vl

].39

--.!if:

.

I L.I .......

V LtCyb pBCyb-W pBCyb-A pBCyb-T TbCyb

.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.

YMKS . . . . . . . . . . . . . . .

Y. . . . . . .

I...F.

..F

[L

.

.

.

.

.

.

.

.

.

G.CGY.K.IW

. . . . . . . . . . . . . . . . . . . . . . . . . . .

IX

315

LWFTYSLILF YSIFMSGFLA LY-ILA~fPIW MELQFWVLLL ................................................. ................................................. ................................................

315

, ,L . . . . . . . . . .

W ........

VV . . . . . . . . . .

Y ......

FMLVVCRLD

-

L.I .....

Fig. 4. Comparison of amino acid sequences encoded by cytochrome b (Cyb) genes cloned from wildtype (pBCyb-W), A variant (pBCyb-A) and T variant (pBCyb-T) with the known sequences from Cyb of L. tarentolae (LtCyb) [13] and T. brucei (TbCyb) [28]. Dots, sequence identity shared with LtCyb; alphabets, sequence of non-identity to LtCyb; overlines, conserved membrane-spanning hydrophobic regions; shaded areas, histidine residues for heme binding; boxed areas, identity shared by pBCyb-A and pBCyb-T; brackets, conserved region shared between variants (pBCyb-A and pBCyb-T) with wild-type (pBCyb-W) Cyb genes; dashes, blanks.

Fig. 4 aligns the aa sequences of Cyb genes from Group I and Group II cells for comparison with the known sequences of Cyb genes from L. tarentolae (LtCyb) and T. brucei (TbCyb) [13,28]. L. m. amazonensis Cyb sequences were much shorter than LtCyb and TbCyb (240-255 aa vs. 362-363 aa). pBCyb-A or pBCyb-T (Group I) shared more homology (ranging from 60-75%) than pBCyb-W (Group II) (40-45%) with TbCyb and LtCyb (Fig. 4, dots). Conserved regions between pBCyb-W and LtCyb were split into intermittent short sequences while pBCyb-A and pBCyb-T shared a long stretch of 88 aa with the LtCyb. None of the 9 membrane-spanning hydrophobic domains in LtCyb [13] (Fig. 4 overline) was well conserved in pBCyb-W. At least 4 such domains were present in pBCyb-A and pBCyb-T, either partially or completely conserved (Fig. 4, domains II, III, IV and V). Several histidine residues were present in

Group I and in Group II Cyb genes. The 4 histidine residues suggested by Widger et al. [29] to be the probable ligands for two heme molecules in domains II and V were conserved in both group of genes (shaded), except that one of the histidines in domain II of pBCyb-A was replaced by tyrosine residue and one in domain V of pBCyb-W was replaced by an alanine. Is there more than one maxicircle species in the kDNA network? Differences between Group

I and Group II variants in Southern hybridization patterns and in sequences of Cyb genes (Fig. 3) suggested that these genes may originate from different maxicircle species in the same network, or even from different cells. To verify this possibility, primers with antisense orientations specific to wildtype and A variants (Fig. 3, broken underlines with solid arrowhead) were synthesized. These were used with P1 primer in PCR, using k D N A networks

204 a templates

W

b W

primers W A |

A

d

c

A

W

W

A

A

W

W

A

A

W A

w

A

w A

w

A

w

A

A'

w

e

f

A'

T

T

A'

A'

A

w

A

w

AWA

T

T

A'

A'

WAw

T

T

A

'

w

I

Fig. 5. Generation of nucleotide sequences specific to Cyb genes from Group I and Group 1I cells by PCR. Antisense primer sequences specific to W or A cells (see Primers in Fig. 3) were used with P1 primer (see Materials and Methods) in different combinations with kDNA networks (templates) from W, A', A and T variants. (a) and (d) PCR products from various combinations electrophoresed on 0.8% agarose gel. (b) and (d) blots from a and d probed with -2p-labeled pBCyb-W. (e) and (f) The same blots after washing were probed with pBCyb-A. See legend to Fig. 1 for W, A', A, T, pBCyb-W and pBCyb-A.

from different variants as templates, kDNA networks from cloned variants or from variants of the uncloned population were used as templates in PCR. Fig. 5 shows the PCR products synthesized when kDNA networks from the cloned variants (clone 2-23) were used as templates. Primers from W and A variants (Fig. 5, see Primers) and kDNA templates from various different variants (Fig. 5, see Templates) were used in different combinations to generate the PCR products. Fig. 5a and d show the results of agarose gel electrophoresis of the PCR products generated. Major bands of the expected size were obtained only when primers from wildtype (W) were used in combination with kDNA templates from wildtype or A' variants (Fig. 5a and d, lanes WW and A'W) but not from A and T variants. The same was true when primers from A variants were used in combination with kDNA from A and T variants (Fig. 5a and d, lanes AA and TA) but not from W and A' variants. When the blots from Fig. 5a and d were probed with pBCyb-W (Fig. 5b and e) strong hybridization bands at lanes WW (Fig. 5b) and A'W (Fig. 5e) at approximately 0.65 kb were observed. Very weak hybridization bands at lanes AA and TA were present in

the same blots. When the same blots were washed and probed with pBCyb-A or pBCybT, strong hybridization signals to bands at 0.7 kb at lane AA (Fig. 5c) and TA (Fig. 5t") were detected and weak signals were seen in lanes WW and A'W. None of the other lanes gave any hybridization signals. The same results were obtained using kDNA templates from variants of the uncloned populations (data not shown). Since Group I Cyb gene primers cannot generate PCR products homologous to Group I Cyb gene from the Group II kDNA templates (WA and A'A) or vice versa (AW and TW), the existence of a minor species of maxicircle in the network is in doubt. Very weak cross-hybridization between pBCyb-W and pBCyb-A in these segments of the genes verified that the 5'-end two-thirds of the Cyb gene were different between the two groups as shown in Fig. 3. As a positive control approximately 200 bp of nucleotides were synthesized by PCR from the 3' end of the Cyb gene from wild-type parasites and A variant (for sense primer see Fig. 3, broken underline with open arrowhead). As indicated in Fig. 3, this segment is the most homologous region between the two Cyb genes. Fig. ld shows the result of probing

205

the blot from Fig. la with the 200 bp PCR product synthesized from the A variant. The intensity of hybridization with the maxicircle fragments from W and A' was much stronger than that shown in Fig. lc (compare lanes W and A' in Fig. ld with Fig. lc) when the blot was washed under the same conditions (0.1 x SSC/0.1% SDS, 65°C, 2 times) and exposed for the same period of time as Fig. l c. When the PCR product from the same region of pBCyb-W was used as the probe, relatively higher intensity of hybridization was observed with maxicircles of A and T variants than with the same samples in Fig. l b (data not shown).

Discussion

We have demonstrated by endonuclease restriction, by cross-hybridization between DNA fragments, and by sequence analyses of the Cyb gene from the coding region, that maxicircles from L. m. amazonensis variants with DNA amplification (A and T) are different from those of wild-type parasites and variants without DNA amplification (W and A'). Since repeatedly cloned cells before and after drug resistance selection were used, the possibility that a minor population of cells bearing that particular maxicircle species was preferentially selected to replicate during drug selection has been rendered unlikely. We also considered the likelihood that more than one maxicircle class exists in a single kDNA network (e.g. major and minor classes like those described for minicircles) but showed that no PCR products were synthesized when wildtype-specific primers were used in PCR with kDNA networks from A variants as templates or vice versa (Fig. 5). We therefore assume that a single species of maxicircle is involved in the changes observed. The possible causes or mechanisms behind such changes are not clear. A direct effect of the drug action is unlikely as no such change can be observed in maxicircles from parasites without DNA amplification (A'). In addition, studies have repeatedly shown that sodium arsenite does not appear to cause gene mutations in vitro in

either prokaryotic or eukaryotic cells [30-32]. However, slight differences in sequences between Cyb genes from arsenite- (pBCyb-A) and tunicamycin-resistant (pBCyb-T) variants may indicate that the drug may have some influence on the changes, even though no information was available in the literature to support the contention that tunicamycin causes gene mutation. Clearly, the alteration in maxicircle sequences is closely associated with the process of DNA amplification. Whether the presence of amplified DNA is a coincidence or a necessity is not known for the time being. It is possible however that the combined effects of the drug and the presence of amplified DNA cause the kDNAs to change. The drastic change in nucleotide sequence of the Cyb gene of A and T variants was rather unexpected. Maxicircles from trypanosomatid protozoa are known to vary both in length and in sequence, not only between species but also between strains of the same species [6]. These variations, however, are contributed mainly by the rapidly-evolving maxicircle divergent regions [11,12,33,34]. The sequences in the coding region of maxicircles are conserved between species [6-10] and are believed to be homologous within a given species [6,12]. The variation caused by nucleotide substitutions in maxicircle conserved regions, as calculated for different stocks of T. brucei, is similar to that observed in mitochondrial DNA within a single species of mice or gophers [34]. In our present report the Cyb gene from wildtype L. m. amazonensis was 81% conserved as compared to the Cyb gene from L. tarentolae and T. brucei, a similar degree of conservation to that observed for the Cyb gene between L. tarentolae and T. brucei [2,7]. However, in A and T variants (Group I), derived from the same clone of wildtype L. m. amazonensis, the nucleotide sequence of Cyb gene was drastically altered. Loss of mitochondrial DNA in other eukaryotes including trypanosomatid protozoa has been reported previously [3539]. The reported losses are either spontaneous or drug-induced, and they can be partial or complete, resulting from single base replace-

206

ments, segmental sequence deletions, insertions, and rearrangements. A term dyskinetoplastidy has been used to describe the loss of kDNA from trypanosomatid protozoa [40]. The effect of mitochondrial DNA changes in these cases can range from partial deficiency in the respiratory system [40] to fatality in severe cases [39] in organisms whose functional mitochondrial genes are affected. The drastic changes in maxicircle DNA sequences of A and T variants (Group I) appear to be different from the cases cited above, because phenotypically the Group I parasites (A and T) were as normal as the wild type as regards growth patterns. We therefore assume that the genes in the mitochondrial system were functioning. Differences in reading frames, in translational products and in the preference for using initiation codons for translation characterize the structural differences between the Cyb gene of the two groups of parasites. Whether these differences affect RNA editing patterns [41,42] of these genes is of interest. The final outcome of RNA editing should be the same, but the process may be different. The alteration of maxicircle sequences is always accompanied by a change in minicircle sequences [18] (see also Fig. 1 for minicircle restriction pattern). In view of the presence of guide RNA genes in minicircles [43,44] for RNA editing of certain maxicircle genes, the simultaneous changes in minicircle and maxicircle sequences in this case may imply a need for information for RNA editing [45]. If this is true, simultaneous changes in both maxicircles and minicircles may be required for the maintenance of viable mitochondrial function under stressful conditions such as drugresistance and DNA amplification.

Acknowledgements We thank Dr. C.C. Wang for discussions, Dr. Cathy Fletcher for reading the manuscript, and Miss Lola Wen for her excellent technical assistance. Most of all, we would like to thank Dr. K.P. Chang for his help in setting up the molecular parasitology program during his

sabbatical for 3 months in 1988 in this laboratory. This work was supported by a grant from the National Science Council, Republic of China, No. NSC80-0203-B001-03 to STL.

References 1 Stuart, K. (1983) Kinetoplast DNA, mitochondrial DNA with a difference. Mol. Biochem. Parasitol. 9, 93104. 2 Simpson, L. (1986) Kinetoplast DNA in trypanosomatid flagellates. Int. Rev. Cytol. 99, 119 179. 3 Jasmer, D.P., Feagin, J.E., Payne, M. and Stuart, K. (1985) Diverse patterns of expression of cytochrome c oxidase subunit I gene and unassigned reading frames 4 and 5 during the life cycle of Trypanosoma brucei. Mol. Cell. Biol. 5, 3041-3047. 4 Feagin, J.E. and Stuart, K. (1985) Differential expression of mitochondrial gene between the life cycle stages of Trvpanosoma brucei. Proc. Natl. Acad. Sci. USA 82, 3380 3384. 5 Feagin, J.E., Jasmer, D.P. and Stuart, K. (1985) Apocytochrome b and other mitochondrial DNA sequences are differentially expressed during the life cycle of Trypanosoma brucei. Nucleic Acids Res. 13, 4577--4596. 6 Simpson, L. (1987) The mitochondrial genome of kinetoplastid protozoa, genomic organization, transcription, replication and evolution. Annu. Rev. Microbiol. 41,363-382. 7 Clayton, C.E. (1987) The molecular biology of the kinetoplastidae. Genet. Eng. 7, 1-56. 8 Stuart, K. and Gelvin, S.B. (1982) Localization of kinetoplast DNA maxicircle transcripts in bloodstream and procyclic forms of Trypanosoma brucei. Mol. Cell. Biol. 2, 845 852. 9 Hoeijmakers, J., Snijders, A., Janssen, J.W.G. and Borst, P. (1981) Transcription of kinetoplast DNA in Trypanosoma brucei blood stream and culture forms. Plasmid 5, 329 350. 10 Simpson, A.M., Simpson, L, and Livington, L. (1982) Transcription of the maxicircle kinetoplast DNA of Leishmania tarentolae. Mol. Biochem. Parasitol. 6, 237 252. 11 Maslov, D.A., Kolesnikov, A.A. and Zeitseva, G.N. (1984) Conservative and divergent base sequence regions in the maxicircle kinetoplast DNA of several trypanosomatid flagellates. Mol. Biochem. Parasitol. 12, 351-364. 12 Muhich, M.L., Neckelmann, N. and Simpson, L. (1985) The divergent region of the Leishmania kinetoplast maxicircle DNA contains diverse sets of repetitive sequences. Nucleic Acids Res. 13, 3241 3260. 13 de la Cruz, V.F., Neckelmann, N. and Simpson, L. (1984) Sequences of six genes and several open reading frames in the kinetoplast maxicircle DNA of Leishmania tarentolae. J. Biol. Chem. 259, 15136-15147. 14 Hensgens, L.A., Brakenhoff, J., De Vries, B.F., Sloof, P. and Troup, M.C. (1984) The sequence of the gene for cytochrome c oxidase subunit 1, a frame shift contain-

207 ing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochondrial maxicircle DNA. Nucleic Acids Res. 12, 7327 7344. 15 Simpson, L., Neckelmann, N., de La Cruz, V.F., Simpson, A.M. and Feagin, J.L. (1987) Comparison of the maxicircle (mitochondrial) genomes of Leishmania tarentolae and Trypanosoma brucei at the level of nucleotide sequence J. Biol. Chem. 262, 6182-6196. 16 Payne, M., RothWell, V., Jasmer, D., Feagin, J. and Stuart, K. (1985) Identification of mitochondrial genes in Trypanosoma brucei and homology to cytochrome c oxidase II in two different reading frames. Mol. Biochem. Parasitol. 15, 159-170. 17 Sloof, P., Van den Burg, J., Voogd, A., Benne, R., Agostinelli, M. et al. (1985) Further characterization of the extremely small mitochondrial ribosomal RNAs from trypanosomes. A detailed comparison of the 9S and the 12S RNAs from Crithidia fasciculata and Trypanosoma brucei with rRNAs from other organisms. Nucleic Acids. Res. 13, 41714190. 18 Lee, S.Y., Lee, S.T. and Chang, K.P. (1992) Transkinetoplastidy: a novel phenomenon involving bulk alterations of mitochondrial kinetoplast DNA of a trypanosomatid protozoan. J. Protozool. 39, 190-196. 19 Detke, S., Chaudhuri, B., Kink, J.A. and Chang, K.P. (1988) DNA amplification in tunicamycin-resistant Leishmania mexicana. Multicopies of a single 63kilobase supercoiled molecule and their expression. J. Biol. Chem. 263, 3418-3424. 20 Detke, S., Katakura, K. and Chang, K.P. (1989) DNA amplification in arsenite-resistant Leishmania. Expt. Cell Res. 180, 161-170. 21 Chang, K.P. (1980) Human cutaneous Leishmania in a mouse macrophage line: Propagation and isolation of intracellular parasites. Science 209, 1240-1242. 22 Iovannisci, D.M. and Ullman, B. (1983) High efficiency plating method for Leishmania promastigotes in semidefined or completely-defined medium. J. Parasitol. 69, 633-636. 23 Wirth, D.F. and Pratt, P.M. (1982) Rapid identification of Leishmania species by specific hybridization of kinetoplast DNA in cutaneous lesions. Proc. Natl. Acad. Sci. USA 79, 6999-7003. 24 Simpson, A.M. and Simpson, L. (1974) Isolation and characterization of kinetoplast DNA networks and minicircles from Crithidia fasciculata. J. Protozool. 2, 774~781. 25 Birboim, H.C. and Dolly, J. (1979) A rapid alkaline extraction procedure of screening recombinant plasmid DNA. Nucleic Acids Res. 7, 1517-1523. 26 Maniatis, T.M., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 27 Sanger, F., Nicklen, S. and Coulsen, A.R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463 5467. 28 Benne, R., De Vries, B.F., Van den Burg, J. and Klaver, B. (1983) The nucleotide sequence of a segment of Trypanosoma brucei mitochondrial maxicircle DNA that contains the gene for apocytochrome b and some unusual unassigned reading frames. Nucleic Acids Res. 11, 6925-6941. 29 Widger, W.R., Cramer, W.A., Herrmann, R.G. and

30

31 32

33

34

35 36

37

38 39 40

41 42 43 44

45

Trebst, A. (1984) Sequence homology and structural similarity between cytochrome b of mitochondrial complex III and the chloroplast b6-f complex: position of the cytochrome b heroes in the membrane. Proe. Natl. Acad. Sci. USA 81,674-678. Lee, T.C., Oshimura, M. and Barrett, J.C. (1985) Comparison of arsenite-induced cell transformation, cytotoxicity, mutation and eytogenetic effects in Syrian hamster embryo cells in culture. Carcinogenesis 6, 1421 1426. IARC (1982) Monograph on the evaluation of the carcinogenic risk of chemicals to humans. Suppl. 4, 5051. Rossman, T.G., Stone, D., Molina, M. and Troll, W. (1980) Absence of arsenite mutagenicity in E. coli and Chinese hamster cells. Environ. Mutagenesis 2, 371 379. Borst, P., Fase-Fowler, F., Hoeijmakers, J.H., J. and Frasch, A.C.C. (1980) Variations in maxicirele and minieircle sequences in kinetoplast DNAs from different Trypanosoma brucei strains. Biochim. Biophys. Acta 610, 197-210. Borst, P., Fase-Fowler, F. and Gibson, W. (1981) Quantitation of genetic differences between Trypanosoma brucei gambiense, rhodesiense and brucei by restriction enzyme analysis of kinetoplast DNA. Mol. Biochem. Parasitol. 3, 117-131. Attardi, G. (1985) Animal mitoehondrial DNA: an extreme example of genetic economy. Int. Rev. Cytol. 93, 93-141. Hajduk, S.L. and Cosgrove, W.B. (1979) Kinetoplast DNA from normal and dyskinetoplastie strains of Trypanosoma equiperdum. Biochim. Biophys. Acta 569, 1-9. Riou, G.E., Belnat, P. and Benard, J. (1980) Complete loss of kinetoplast DNA sequences induced by ethidium bromide or by aeriflavine in Trypanosoma equiperdum. J. Biol. Chem. 255, 5141-5144. Shoffner, J.M. III and Wallace, D.C. (1990) Oxidative phosphorylation diseases: disorders of two genomes. Adv. Human Genet. 19, 267-330. Tzargoloff, A. and Myers, A.M. (1986) Genetics of mitoehondrial biogenesis. Annu. Rev. Biochem. 55, 249-285. Vickerman, K. and Preston, T.M. (1976) Comparative cell biology of the kinetoplastid flagellates. In: Biology of the Kinetoplastidae (Lumsden, W.H.R. and Evans, D.A., eds.), vol. 1, pp. 35 130. Academic Press, New York. Simpson, L. and Shaw, J.M. (1989) RNA editing and the mitochondrial cryptogenes of kinetoplastid protozoa. Cell 57, 355-366. Benne, R. (1989) RNA editing in trypanosome mitochondria. Biochim. Biophys. Acta 1007, 131-139. Sturm, N.R. and Simpson, L. (1990) Kinetoplast DNA minieircles encode guide RNAs for editing of cytochrome oxidase subunit III mRNA. Cell 61,879-884. Sturm, R.N. and Simpson, L. (1991) Leishmania tarentolae minicircles of different sequence classes encode single guide RNAs located in the variable region approximately 150 bp from the conserved region. Nucleic Acids Res. 19, 6277-6281. Borst, P. (1991) Why kinetoplast DNA networks? Trends Genet. 7, 139-141.