- Email: [email protected]
Characterization of Streptococcus thermophilus lytic bacteriophages from mozzarella cheese plants
International Journal of Food Microbiology 138 (2010) 137–144
Contents lists available at ScienceDirect
International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / i j f o o d m i c r o
Characterization of Streptococcus thermophilus lytic bacteriophages from mozzarella cheese plants P. Zinno a, T. Janzen b, M. Bennedsen b, D. Ercolini a, G. Mauriello a,⁎ a b
Dipartimento di Scienza degli Alimenti, Università degli Studi di Napoli Federico II – 80055 Portici, Italy Strains Department, Innovation, Chr. Hansen A/S, Hørsholm, Denmark
a r t i c l e
i n f o
Article history: Received 22 September 2009 Received in revised form 2 December 2009 Accepted 5 December 2009 Keywords: Bacteriophage Streptococcus thermophilus Mozzarella
a b s t r a c t Phage infection still represents the main cause of fermentation failure during the mozzarella cheese manufacturing, where Streptococcus thermophilus is widely employed as starter culture. Thereby, the success of commercial lactic starter cultures is closely related to the use of strains with low susceptibility to phage attack. The characterization of lytic S. thermophilus bacteriophages is an important step for the selection and use of starter cultures. The aim of this study was to characterize 26 bacteriophages isolated from mozzarella cheese plants in terms of their host range, DNA restriction profile, DNA packaging mechanism, and the variable region VR2 of the antireceptor gene. The DNA restriction analysis was carried out by using the restriction enzymes EcoRV, PstI, and HindIII. The bacteriophages were distinguished into two main groups of S. thermophilus phages (cos- and pac-type) using a multiplex PCR method based on the amplification of conserved regions in the genes coding for the major structural proteins. All the phages belonged to the costype group except one, phage 1042, which gave a PCR fragment distinctive of pac-type group. Furthermore, DNA sequencing of the variable region VR2 of the antireceptor gene allowed to classify the phages and examine the correlation between typing profile and host range. Finally, bacterial strains used in this study were investigated for the presence of temperate phages by induction with mitomycin C and only S. thermophilus CHCC2070 was shown to be lysogenic. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Phage attack is a main cause of fermentation failure during the manufacture of mozzarella cheese. Dairy fermentations are vulnerable to phage infection for several reasons, i) contaminating phages may be naturally present in fluid milk; ii) repeated use of defined culture under non-aseptic processing conditions provides a constant host for phage proliferation (Klaenhammer and Fitzgerald, 1994; Neve et al., 1995); and iii) lysogenic bacteria may also be a source of new phages (Shimuzu-Kadota et al., 1983; Moineau et al., 1986; Relano et al., 1987; Tremblay and Moineau, 1999). The dairy industry has implemented many methods to reduce the consequences of phage infection such as ordinary disinfection of equipment, direct vat inoculation, propagation of starter cultures in phage inhibitory media, strain rotations and application of phage-resistant multiple strain starters (Everson, 1991). Streptococcus thermophilus strains are predominant in starter cultures used in the mozzarella cheese production and it is well known that they are often susceptible to phage attack resulting in slow lactic acid fermentation and loss of product quality (Mills et al., 2007). Since, beside Lactococcus lactis, S. thermophilus is considered the most
⁎ Corresponding author. Tel.: + 39 0812539452; fax: + 39 0812539407. E-mail address: [email protected] (G. Mauriello). 0168-1605/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2009.12.008
technologically important lactic acid bacterium by the dairy industry, the characterization of its phages is an important advancement for the selection of starter cultures. Removing the multi-sensitive strains and replacing them with strains with different phage sensitivities is an efficient approach for correct management of a defined culture rotation system. S. thermophilus phages belong to B1 Bradley's group, having a hexagonal capsid and a long non-contractile tail. They are divided into two groups (cos and pac-types) based on the number of major structural proteins and the encapsidation mechanism of doublestranded DNA (Le Marrec et al., 1997). Some bacteriophages can infect different bacterial strains and the definition of the host range is an important feature of bacteriophages to assess. The phage-host interactions were widely studied, and Duplessis and Moineau (2001) identified the phage genetic determinant (antireceptor) likely to be involved in the recognition of S. thermophilus hosts. They, in fact, characterized the antireceptor gene (orf18) of the tail morphogenesis module of the phages MD4 and DT1, finding the variable region VR2 responsible for the host specificity. The VR2 sequence was also used to classify S. thermophilus phages and verify the correlation between typing profile and host range (Binetti et al., 2005). The aim of this study was to define some specific features of 26 S. thermophilus bacteriophages for their following use in the selection of starter cultures.
138
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
borate, 1 mM EDTA pH 8.0) in 1.1% agarose gels. Running conditions: switch times 1–30 s linearly ramped over 24 h at 5.5 V/cm, 14 °C.
2. Materials and methods 2.1. Bacterial strains, bacteriophages and culture conditions
2.3. Phage propagation Bacterial strains and bacteriophages used in this study are reported in Table 1 and were from the Chr. Hansen culture collection. The origin and isolation period of each bacteriophage and the bacterial strain from which each phage was isolated, are indicated in Table 1. S. thermophilus AT1 was isolated from a natural whey culture used for traditional mozzarella cheese manufacture and belong to the culture collection of the Department of Food Science, University of Naples Federico II. Bacterial strains were identified by sequence analysis of the 16S rRNA gene and characterized at strain level by PFGE-SmaI analysis. Phages were isolated from abnormal mozzarella cheese manufactures. Host strains were stored at −80 °C in M17 (Oxoid) with 2% lactose, supplemented with 15% glycerol, and routinely cultured overnight in M17 broth at 42 °C. Phage stocks were prepared by addition of phages to an actively growing M17-Ca broth (M17 supplemented with 10 mM CaCl2) culture of the appropriate host. Host cultures were incubated at 42 °C until lysis was complete. Unlysed cells were removed by centrifugation at 8000 g for 10 min and the supernatants were filtered through 0.45 μm pore size filters (Minisart® plus, Sartorius AG, Goettingen, Germany). These phage preparations were then stored at − 80 °C with 15% glycerol. Phage enumeration (pfu/ml) was performed by the double-layer plaque titration method (Svensson and Christiansson, 1991), using M17-Ca agar and incubated at 42 °C.
Overnight S. thermophilus host bacteria culture was inoculated (1%) in 10 ml of M17-Ca broth, infected with its virulent phage suspension at a multiplicity of infection from 0.1 to 1 and incubated at 42 °C until complete lysis occurred. Then, the incubation was prolonged and 1 ml of bacterial culture was added at 1 h intervals for 4–5 times, in order to obtain a further amplification of the phage population. 2.4. Host range determination The sensitivity of S. thermophilus strains to 26 phages was determined. Phage DT1 and its host S. thermophilus SMQ-301 (Tremblay and Moineau, 1999) were used as control. Briefly, 0.1 ml of the log phase of each culture was mixed with M17 soft agar (0.5 % w/v) and plated as a thin top layer on M17-Ca/Mg (10 mM CaCl2, 10 mM MgCl2) agar (1% w/v) plates. Aliquots of 10 μl of lysates were spotted on the plates. After incubation at the conditions of growth, the presence or absence of lysis zones was recorded. The phage turbidity test was also carried out by inoculating 10 ml of a M17-Ca/Mg broth with 0.2 ml of an overnight culture of S. thermophilus strains and infecting with aliquots of phage suspension at multiplicity of infection of 0.1. The mixtures were incubated at 42 °C and observed periodically. The control tests were prepared with non infected strains to verify bacterial lysis. A total of 3 subcultures were made to increase the concentration of phages.
2.2. Strain typing with pulsed field gel electrophoresis 2.5. Phage DNA isolation The bacterial strains were typed using pulsed field gel electrophoresis (PFGE) using a BioRad CHEF Mapper XA. Harvested bacteria were cast into agarose blocks and treated subsequently with lysozyme and proteinase K. DNA was digested with SmaI restriction enzyme and electrophoresis was performed in 0.5 × TBE buffer (45 mM Tris-
Table 1 Relevant characteristics of bacteriophages used in this study. Bacteriophage
Origina
574 575 576 577 591 596 603 604 605 607 611 616 620 641 642 654 671 1027 1028 1032 1033 1034 1036 1040 1041 1042
Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella
a b
whey A whey A whey A whey B whey C whey D whey B whey E whey F whey G whey H whey I whey L whey M whey N whey O whey P whey Q whey Q whey Q whey R whey R whey R whey S whey S whey S
Isolation period
Strain of isolationb
April 1994 April 1994 April 1994 April 1994 April 1994 June 1994 August 1994 June 1994 June 1994 August 1994 September 1994 September 1994 September 1994 December 1994 September 1994 September 1994 November 1995 July 2004 July 2004 July 2004 July 2004 July 2004 July 2004 June 2005 June 2005 June 2005
CHCC2134 CHCC2070 CHCC2134 CHCC2389 CHCC2130 CHCC2134 CHCC2133 CHCC2134 CHCC2134 CHCC2130 CHCC3063 CHCC2134 CHCC2134 CHCC3049 CHCC3049 CHCC3063 CHCC3046 CHCC4323 CHCC4325 CHCC3048 CHCC4323 CHCC4327 CHCC3050 CHCC4327 CHCC4895 CHCC6592
Each different letter indicates a different dairy factory. These strains were used as starter cultures.
The DNA isolation was carried out by centrifugation of 1 ml of fresh phage lysate at 10,000 g for 10 min. RNase/DNase (1 mg/ml) was added and the preparation was incubated at 37 °C for 30 min. The supernatant was transferred to another tube and 100 μl of an SDS mixture (0.5 M Tris– HCl, 0.25 M EDTA, 2.5% SDS) were added. The solution was mixed for few seconds and was then incubated at 65 °C for 30 min. Then 125 μl of 8 M potassium acetate were added, and the preparation was mixed and placed on ice for 30 min. After centrifugation at 16,100 g for 30 min each sample was extracted twice with an equal volume of phenol–chloroform (1:1). The DNA was precipitated with an equal volume of isopropanol and each pellet was resuspended in 20 μl of water. The visualization by ethidium bromide staining was performed according to standard protocols (Sambrook et al., 1989). 2.6. Restriction analysis Purified phage DNA was digested by using three endonucleases (HindIII, PstI, EcoRV) (FastDigest™, Fermentas) according to the manufacturer's instructions. Restricted phage DNA was separated by electrophoresis in a 0.8% agarose gel in TAE buffer (40 mM Trisacetate, 1 mM EDTA), stained with ethidium bromide and visualized under UV illumination. 2.7. Determination of DNA packaging mechanism To rapidly classify S. thermophilus phages within one of the two main groups (cos- and pac-type) Quiberoni et al. (2006) developed a multiplex PCR method by using two pairs of primers (one per phage group, Table 2), designed from the conserved regions of the genes coding for the major capsid proteins of phages for which the complete genome sequence was available. The PCR reactions were performed in a total volume of 50 µl containing 125 µM deoxynucleotide triphosphate, 5 µM concentrations of the 4 primers, 2.5 U of Taq DNA
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144 Table 2 List of primers used in this study. Primer
Sequence, 5′–3′
Reference
cos FOR cos REV pac FOR pac REV HOST1 HOST5
GGTTCACGTGTTTATGAAAAATGG AGCAGAATCAGCAAGCAAGCTGTT GAAGCTATGCGTATGCAAGT TTAGGGATAAGAGTCAAGTG GAATGATACTGCTGGCAGTATTTCGGTTGG CAGTCATGTAGCTATCGATGAAATTCCAACG
Quiberoni et al. (2006) Quiberoni et al. (2006) Quiberoni et al. (2006) Quiberoni et al. (2006) Binetti et al. (2005) Binetti et al. (2005)
polymerase (Invitrogen, Milano, Italy), Taq buffer (20 mM Tris–HCl pH 8.4, 1.5 mM magnesium chloride, 50 mM potassium chloride), and 1 µl of the phage lysate. Phage DT1 (Tremblay and Moineau, 1999) was used as cos-type positive control. Phage DT1 was propagated on S. thermophilus SMQ-301. A negative control (without the template) was included for all PCR assays to control the possibility of contamination. The conditions of PCR amplifications were set as follows, 5 min at 94 °C, followed by 35 cycles (45 s at 94 °C, 45 s at 53 °C, 1 min at 73 °C), and a final step of 5 min at 73 °C. The PCR products were separated on a 2% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA), stained with ethidium bromide, and visualized under UV light. The fragments of 170 bp and 427 bp were distinctive of the cos-type and pac-type group, respectively. 2.8. Amplification and sequencing of the antireceptor gene variable region The amplification of the variable region (VR2) of the gene involved in host recognition was performed as suggested by Binetti et al. (2005). The PCR reactions were performed in a total volume of 100 µl containing 125 µM deoxynucleoside triphosphate, 5 µM concentrations of the primers HOST1 and HOST5 (Table 2), 2.5 U of Taq DNA polymerase, Taq buffer (20 mM Tris–HCl pH 8.4, 1.5 mM magnesium chloride, 50 mM potassium chloride), and 2 µl of the phage lysate. The PCR products were separated on a 1% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA), stained with ethidium bromide, and visualized under UV light. The fragments, whose sizes were
139
between 700 and 800 bp, were purified by using QIAquick PCR purification kit (QIagen, Milan, Italy) and sequencing was performed by Deoxy terminator cycle sequencing kit (Perkin-Elmer Applied Biosystems).
2.9. Induction of temperate bacteriophages Induction of temperate phages was performed by addition of mitomycin C at a final concentration of 0.2 µg/ml when the cultures had an OD600nm = 0.2. The presence of temperate phages was indicated by decrease of culture turbidity up to total clarification of the broth monitored by spectrophotometer measures at 600 nm. The lysates obtained were centrifuged at 8000 g for 10 min to remove bacterial cell debris, and the supernatants were filtered through 0.45 µm membrane and stored at 4 °C.
2.10. Data analysis The DNA restriction patterns of S. thermophilus strains and bacteriophages were captured using QuantityOne electrophoresis analysis system (Bio-Rad Laboratories). The cluster analysis was performed by the programme after band matching; the method described by Saitou and Nei (1987) was used to obtain the correlation matrix of the patterns. In the case of phages, for each enzyme a similarity matrix was created, and then joined into a single matrix. The resulting matrix was used in the average linkage method by the Cluster procedure of Systat 5.2.1 in order to estimate the percentage of similarity in the restriction profiles into phage and bacterial populations. Research for antireceptor gene variable region VR2 similarity was performed using BLAST at National Centre of Biotechnology Information GenBank (http://www.ncbi.nlm.nih.gov, Altschul et al., 1997). Phylogenetic analysis was performed using MEGA version 4.0 (Tamura et al., 2007) after multiple alignment by the ClustalW 1.8 programme (Thompson et al., 1994). Distance matrix and neighborjoining methods (Saitou and Nei, 1987) were applied for a dendrogram construction.
Fig. 1. Similarity dendrogram of Streptococcus thermophilus strains used in this study on the basis of pulsed field gel electrophoresis SmaI patterns, in parenthesis the bacteriophages to which the strains showed sensitivity.
− − − − − − − − − − − − − − − + − − − + − − − − − − − − − − − − − − − −
+ plaque formation, − no plaque formation. Identical host range is indicated by the same superscript. In the case of host range with two or more sensitive strains the asterisk indicates the microorganism used for the phage propagation.
DT1 1042 1041
− + − − − − − − − − − − + − +⁎ − − − − − − − − − − − − − − − + − − − − − + − − − − − − − + − − − − +⁎ − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − − − + − − − − − − − − − − − − + +⁎ + − − + − − − − − − − − − − − − + − − − − + +⁎ − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − − − − + − − − − − − − − + − − − − − − − − − − − − − − − − − + − − − − − − +⁎ + − − − − + − − − − − − − − − − − + − − − − − − − − − − − − − − + − − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − +* − − − − − − − − − − − − + − − − − − − + − − − − − − − − − − − − − − − − − − + +⁎ − − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − −
620a 616a 611 607 605 604a 603 596 591 577 576a
− − − − + − − − − − − − − − − − − −
The PCR analysis of the antireceptor gene variable region VR2 gave an amplification fragment (700–800 bp) for all bacteriophages except 577, 607, 642, and 1028. All DNA sequences obtained (accession numbers FJ849032 to FJ849053) appeared to be homologous to the VR2 region of S. thermophilus bacteriophages, whose sequences are available in GenBank database (i.e. AF145054, AF348737, AF348738, AY699705 and EF529515). The cluster analysis of VR2 sequences from
575
3.5. Bacteriophage clustering based on VR2 sequences
Phages
All bacteriophages, with the exception of 1042 and 575, showed an amplification fragment of 170 bp (Fig. 3), indicating to belong to the cos-type group. On the other hand only bacteriophage 1042 resulted in a PCR fragment of 427 bp, distinctive of the pac-type phage group. Surprisingly, the lysate of phage 575 able to infect strain S. thermophilus CHCC2070 (Table 3), showed both 170 bp and 427 bp amplification fragments (Fig. 3).
Strains
3.4. Determination of DNA packaging mechanism
Table 3 Host range of 27 bacteriophages against 18 Streptococcus thermophilus strains.
The DNA restriction analysis showed only HindIII and EcoRV as capable to give a pattern with 8–12 bands, suitable for the differentiation of the 26 bacteriophages, while the enzyme PstI gave patterns with less than 3 bands (data not shown). Most phages had a unique profile, with the exception of phages 604, 620 and 654, which showed identical patterns when their DNA was digested by HindIII and EcoRV, respectively (Fig. 2). Combined cluster analysis of HindIII and EcoRV DNA fingerprints showed a high genetic diversity of the phages considered in this study. As shown in Fig. 2, except for phages 604, 620 and 654, which showed 100% of similarity, the cluster analysis allowed to distinguish each bacteriophage on the basis of restriction profiles and the highest similarity (85%) was shown between phages 603 and 1033.
641
3.3. Bacteriophage DNA restriction analysis
− + − − +⁎ − − − − − − − − − + − − −
642
654
671
1027b
1028
1032
1033b
The host range of 26 lytic phages from Chr. Hansen's as well as phage DT1 on 18 S. thermophilus strains is reported in Table 3. Phages 574, 576, 604, 616, and 620 were capable to infect only the strain S. thermophilus CHCC2134. Also the phage couples 1027–1033 and 1034–1040 infected only one strain: CHCC4323 and CHCC4327, respectively. As reported in Table 3, the other phages showed unique host ranges where the number of host strains ranged between 1 and 4. Out of the 9 above reported, 8 other bacteriophages showed to be virulent against only 1 strain, 3 against 2 strains, 4 against 3 strains and 2 against 4 strains. Furthermore, phage DT1 showed to be virulent against 6 strains. On the other hand, all S. thermophilus strains except AT1 were infected by at least one bacteriophage. S. thermophilus CHCC2134 showed to be very sensitive to phage infection, being a host for 8 different bacteriophages. In contrast, the strains CHCC3046, CHCC4325, CHCC3048 and CHCC6592, were susceptible only to the phages 671, 1028, 1032, and 1042, respectively. All the other strains were sensitive to 2, 3, or 4 bacteriophages.
− − +⁎ + − − − − − − − − − − − − − −
1040c 1036 1034c
3.2. Host range
− − − − − + − − − − − − − − − − − −
The DNA restriction patterns of S. thermophilus strains and relative similarity dendrogram are reported in Fig. 1. The similarity level ranged between 75% and 100%. The 18 host strains can be distinguished into 15 DNA fingerprinting groups. Identical fingerprints (100% of similarity) were only found for the couples CHCC3046/ CHCC3048, CHCC2389/CHCC2133 and CHCC3063/CHCC4460.
− − − − + − − − − − − − − − − − − −
3.1. Strain typing with pulse field gel electrophoresis
CHCC3063 CHCC2070 CHCC2130 CHCC2133 CHCC2134 CHCC2389 CHCC3048 CHCC3049 CHCC3050 CHCC3046 CHCC4323 CHCC4325 CHCC4327 CHCC4460 CHCC4895 CHCC6592 SMQ-301 AT1
3. Results
− + − + + + − − − − − − − − + − +⁎ −
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
574a
140
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
141
Fig. 2. Restriction profiles of 26 Streptococcus thermophilus bacteriophage DNA digested by HindIII and EcoRV and their cluster analysis.
bacteriophages used in this study and S. thermophilus phages DNA sequences available in GenBank database resulted in a dendrogram where the similarity among the bacteriophages of this study ranged from 38% to 100% (Fig. 4). Only two clusters showed a similarity level of 100% including 3 (cluster A) and 9 (cluster B) bacteriophages. At 90% similarity level the dendrogram showed 9 single-phage clusters and 1 (cluster D) and 2 (clusters C and E) clusters including 3 and 2 bacteriophages, respectively. The phage DT1 showed the lowest similarity level. 3.6. Evidence of temperate bacteriophages All the bacterial strains were tested for the presence of temperate phages but only S. thermophilus CHCC2070 exhibited cell lysis after addition of mitomycin C suggesting the induction of temperate bacteriophages from this microorganism. All S. thermophilus strains from this study were tested as possible hosts for this potential temperate phage, but none of the bacterial strains appeared to be a host for the phage. 4. Discussion
Fig. 3. Multiplex PCR for the detection of the cos- and pac-type groups of Streptococcus thermophilus phages. Lane 1, representative cos-type phage 574; lane 2, negative control; lane 3, bacteriophage 575 showing both amplification products; lane 4, pactype phage 1042; lane M, 1 kb ladder.
The increasing demand for dairy products in recent years has required increase in both production capacity and process efficiency. In this optic the use of starter cultures properly meets these dairy industry needs. However, the repeated use of defined starter cultures
142
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
Fig. 4. Dendrogram showing the % of similarity of 28 Streptococcus thermophilus bacteriophages on the basis of antireceptor VR2 gene sequences. GenBank accession numbers are reported in parenthesis.
under non-aseptic processing conditions amplifies the risk of proliferation and the infection ability of phages in dairy environments. The characterization of S. thermophilus phages is an important step for the selection of phage-resistant dairy starter cultures. In this study, 26 phages isolated from mozzarella cheese whey samples were analyzed on the basis of their host range, DNA packaging mechanism, and DNA restriction profile. Furthermore, 22 of them were clustered considering the variable region VR2 sequences of the antireceptor gene and a correlation with host range was examined. The phage population assayed showed 20 different host ranges (Table 3) suggesting a high variability level in terms of infection capability. Interestingly, AT1 appeared resistant to all the bacteriophages assayed, and is the sole strain isolated from a natural whey culture used for the production of traditional mozzarella cheese (data not shown). This environment is characterized by a very high microbial diversity, which probably represents a natural barrier against phage infection (Carminati et al., 1997). This strain could be taken into account for the assessment of other industrial performances such as acidifying and proteolytic activity. On the contrary, strain CHCC2134, as well as other multi-sensitive strains, is likely not
to be considered as starter culture because of the high risk of phage infection. In fact, this strain was infected in six different dairy factories when employed as starter culture. Furthermore, it was used two times in the same dairy factory and infected by two different bacteriophages, i.e. 574 and 576 (Table 1). Our results, showing a narrow host range, were generally in agreement with Binetti et al. (2005) who described the host ranges of 15 bacteriophages against 14 S. thermophilus strains, all from dairy environment. They reported that the phages had very diverse host ranges, the number of hosts ranging from just 1 to 4 strains. By contrast, only 16 S. thermophilus strains out of 36 were found sensitive to a number of bacteriophages ranging from 1 to 4, and as many as 9 strains were sensitive to more than 11 among 27 bacteriophages tested (Le Marrec et al., 1997). Interestingly, S. thermophilus strains showing 100% similarity by SmaI PFGE were not sensitive to the same bacteriophages. In fact, three couples of strains showing identical fingerprints had different phage sensitivity. The strains CHCC3046 and CHCC3048 showed to be sensitive towards two different bacteriophages, 671 and 1032, respectively. The strains CHCC2389 and CHCC2133, both sensitive to four phages, shared sensitivity to DT1 phage. Finally, the couple CHCC4895/CHCC2070 showed to share 3 phage sensitivity (i.e. 596, 1041 and DT1).
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
Therefore, the strains within the couples were probably different, as demonstrated by phage typing. Our results suggest that the phage typing, coupled with PFGE, is a suitable tool for bacterial strain typing, previously used for strain typing in staphylococci (Murchan et al., 2004). The variability within the phage population was confirmed by restriction profile analysis. In fact, most phages showed a unique pattern, as obtained by using HindIII and EcoRV enzymes (Fig. 2). The phages 604, 620 and 654 showed the same fingerprint after DNA digestion by both restriction enzymes, but only 604 and 620 shared the same infectivity pattern. Similarly, Guglielmotti et al. (2009) reported three bacteriophages showing different host ranges but identical restriction profiles and described different possible causes to explain an analogous result. The result on genetic diversity, combined to VR2 sequence and host range results, led us to hypothesize the high correlation between the phages 604 and 620. In fact, on the basis of VR2 sequencing, the phages 574, 575, 576, 604, 605, 620 and 654 (Fig. 4, cluster B) showed 100% similarity. They also showed 100% similarity with the bacteriophages MD1 and DT4, which are known to be infective towards the strain S. thermophilus SMQ-301 (Duplessis and Moineau, 2001). However, only the phages 574, 576, 604 and 620 showed the same host range, infecting S. thermophilus CHCC2134. Furthermore, the strain S. thermophilus SMQ-301 showed to be sensitive only to DT1 (Table 3), which does not belong to the cluster B of Fig. 4 and showed a very low similarity level with all other phages. However, the phages 604 and 620 were from different dairy factories and isolated in two different periods but both infected the same strain starter (Table 1). Also the phages 1034 and 1040, strictly related after VR2 sequencing (Fig. 4, cluster E), showed the same host range (Table 3). Therefore, a high correlation between host range and VR2 sequence were shown only in phages 574, 576, 604, 620, 1034 and 1040. Among them only the phages 574 and 576 were from the same factory (Table 1). Finally, four of our phages did not give amplification of VR2 region. As a matter of fact, only few S. thermophilus phage showed 100% homology of VR2 sequence with the HOST1 and none with HOST5 primer. This result confirmed the variability of the VR2 region of antireceptor gene; a low homology of these primers with the VR2 sequences of the phages 577, 607, 642 and 1028 could justify the amplification failure. Therefore, our results might indicate that further phage factors are involved in host specificity, as previously hypothesized by other authors (Binetti et al., 2005; Duplessis et al. 2006; Guglielmotti et al., 2009). Moreover, it could be interesting to note that the phages 604, 620 and 654 shared identical fingerprint and VR2 sequence, even though similar restriction profiles do not necessarily imply identical VR2 sequences (Guglielmotti et al., 2009). Our results showed that the multiplex PCR allowed distinguishing the cos-type and the pac-type phages. In this study only the bacteriophage 1042 and the temperate phage from S. thermophilus CHCC2070 gave an amplification fragment distinctive of pac-type group. All the other bacteriophages belong to the cos-type. As reported by Quiberoni et al. (2006), discriminating the pac-type and cos-type phages could be interesting to remove S. thermophilus strains sensitive to both phages group. In this study the unique pac-type phage 1042 infected only S. thermophilus strain CHCC6592, whereas all the other strains were sensitive to cos-type phages, confirming previous study demonstrating that rarely S. thermophilus strains were infected by members of both phage groups (Lévesque et al., 2005). The high preponderance of cos-type phages in dairy environments is also reported in several studies based on S. thermophilus phage diversity (Le Marrec et al., 1997; Quiberoni et al., 2003; Guglielmotti et al., 2009). Surprisingly, the bacteriophage 575 that infected only S. thermophilus strain CHCC2070 was shown to provide both PCR products for cos-type and pac-type group. When S. thermophilus CHCC2070 was treated by mitomycin C, it showed to be lysogenic and the PCR performed with its lysate yielded an amplification fragment distinctive of the pac-type group. Therefore, the results suggested that
143
the bacteriophage 575 lysate contained both its DNA (providing the cos-type fragment) and CHCC2070 prophage (providing the pactype fragment). Since lysogenic starter strains are considered as a possible source of bacteriophages in cheese plants, the induction of all bacterial strains used in this study was carried out to evidence the presence of temperate phages and only S. thermophilus CHCC2070 appeared to be lysogenic. The high diversity within the bacteriophage population used in this study could be justified by their isolation in different dairy factories using different starter cultures and by the different isolation period. It could be interesting to notice again that different phages (574 and 576) were isolated in the same dairy factory using the same starter strain in the same period, while two similar phages (604 and 620) were isolated in two different dairy factories, in two different periods, using the same strain starter. The high diversity among bacteriophages highlights the serious risk of phage infection during fermented food processing, even though we registered the presence of a high percentage of low sensitive S. thermophilus strains. In conclusion, testing a hypothetic starter culture against a phage population, characterized by a well determined high variability, is an efficient tool to exclude bacterial strains bringing on possible fermentation failure. Acknowledgement P. Zinno thanks Dr. Giorgio Giraffa of CRA Lodi, Italy, for basic training to acquire the fundamental techniques about bacteriophage manipulation. References Altschul, S., Madden, T., Schäffer, A., Zhang, J., Zhang, Z., Miller, W., Lipman, D., 1997. Gapped BLAST and PSI-BLAST, a new generation of protein database search programs. Nucleic Acids Research 25, 3389–3402. Binetti, A.G., Del Rio, B., Martin, M.C., Alvarez, M.A., 2005. Detection and characterization of Streptococcus thermophilus bacteriophages by use of the antireceptor gene sequence. Applied Environmental Microbiology 71, 6096–6103. Carminati, D., Mazzuccotelli, L., Giraffa, G., Neviani, E., 1997. Incidence of inducible bacteriophage in Lactobacillus heleveticus strain isolated from natural whey starter cultures. Journal of Dairy Science. 80, 1505–1511. Duplessis, M., Moineau, S., 2001. Identification of a genetic determinant responsible for host specificity in Streptococcus thermophilus bacteriophages. Molecular Microbiology 41, 325–336. Duplessis, M., Lévesque, C.M., Moineau, S., 2006. Characterization of Streptococcus thermophilus host range phage mutans. Applied Environmental Microbiology 72, 3036–3041. Everson, T.C., 1991. Control of phage in the dairy plant. Practical phage control. International Dairy Federation Bulletin 263, 16–23. Guglielmotti, D.M., Binetti, A.G., Rheinhamer, J.A., Quiberoni, A., 2009. Streptococcus thermophilus phage monitoring in a cheese factory: phage characteristics and their starter sensitivity. International Dairy Journal 19, 476–480. Klaenhammer, T. R., Fitzgerald, G.F., 1994. Bacteriophage and bacteriophage resistance in Genetics and Biotechnology of Lactic Acid Bacteria, eds M.J Gasson and W.M.de Vos. Blackie Academic and Professional, Chapmanand Hall, Glasgow, pp 106–168. Le Marrec, C., van Sinderen, D., Walsh, L., Stanley, E., Vlegels, E., Moineau, S., Heinze, P., Fitzgerald, G., Fayard, B., 1997. Two groups of bacteriophages infecting Streptococcus thermophilus can be distinguished on the basis of mode of packaging and genetic determinants for major structural protein. Applied Environmental Microbiology 63, 3246–3253. Lévesque, C., Duplessis, M., Labonté, J., Labrie, S., Fremaux, C., Tremblay, D., Moineau, S., 2005. Genomic organization and molecular analysis of the virulent bacteriophage 2972 infecting an exopolysaccaride-producing Streptococcus thermophilus strain. Applied Environmental Microbiology 71, 4057–4068. Mills, S., Coffey, A., McAuliffe, O.E., Mejer, W.C., Hafkamp, B., Ross, R.P., 2007. Efficient method for generation of bacteriophage insensitive mutants of Streptococcus thermophilus yoghurt and mozzarella strains. Journal of Microbiological Methods 70, 159–164. Moineau, S., Pandian, S., Klaenhammer, T.R., 1986. Restriction/modification systems and restriction endonuclease are more effective on lactococcal bacteriophages that have emerged presently in the industry. Applied and Environmental Microbiology 59, 197–202. Murchan, S., Aucken, H.A., O'Neill, G.L., Ganner, M., Cookson, B.D., 2004. Emergence, spread, and characterization of phage variants of epidemic methicillin-resistant Staphylococcus aureus 16 in England and Wales. Journal of Clinical Microbiology 42, 5154–5160.
144
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
Neve, H., Berger, A., Heller, K.J., 1995. A method for detecting and enumerating airborne virulent bacteriophage of dairy starter cultures. Kieler Milchwirtschaftliche Forschungsberichte 47, 193–207. Quiberoni, A., Auad, L., Binetti, A., Suarez, V., Rheinheimer, J.A., Raya, R.R., 2003. Comparative analysis of Streptococcus thermophilus bacteriophage isolated from a yogurt industrial plant. Food Microbiology 20, 461–469. Quiberoni, A., Tremblay, D., Ackermann, W., Moineau, S., Reinheimer, J.A., 2006. Diversity of Streptococcus thermophilus phages in a large-production cheese factory in Argentina. Journal of Dairy Science 89, 3791–3799. Relano, P., Mata, M., Bonneau, M., Rizenthaler, P., 1987. Molecular characterization and comparison of 38 virulent and temperate bacteriophages of Streptococcus lactis. Journal of General Microbiology 133, 3053–3063. Saitou, N., Nei, M., 1987. The neighbor-joining method, new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 12, 823–833. Sambrook, J., Fritsch, E.F., Maniatas, T., 1989. Molecular Cloning, a Laboratory Manual Cold Spring Harbor Laboratory.
Shimuzu-Kadota, M., Sakurai, T., Tsuchida, N., 1983. Prophage origin of a virulent phage appearing on fermentation of L. casei S-1. Applied and Environmental Microbiology 45, 669–674. Svensson, U., Christiansson, A., 1991. Methods for phage monitoring. International Dairy Federation Bulletin 263, 29–39. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4, Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal W, improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Tremblay, D.M., Moineau, S., 1999. Complete genomic sequence of the lytic bacteriophage DT1 of Streptococcus thermophilus. Virology 255, 63–76.
Contents lists available at ScienceDirect
International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / i j f o o d m i c r o
Characterization of Streptococcus thermophilus lytic bacteriophages from mozzarella cheese plants P. Zinno a, T. Janzen b, M. Bennedsen b, D. Ercolini a, G. Mauriello a,⁎ a b
Dipartimento di Scienza degli Alimenti, Università degli Studi di Napoli Federico II – 80055 Portici, Italy Strains Department, Innovation, Chr. Hansen A/S, Hørsholm, Denmark
a r t i c l e
i n f o
Article history: Received 22 September 2009 Received in revised form 2 December 2009 Accepted 5 December 2009 Keywords: Bacteriophage Streptococcus thermophilus Mozzarella
a b s t r a c t Phage infection still represents the main cause of fermentation failure during the mozzarella cheese manufacturing, where Streptococcus thermophilus is widely employed as starter culture. Thereby, the success of commercial lactic starter cultures is closely related to the use of strains with low susceptibility to phage attack. The characterization of lytic S. thermophilus bacteriophages is an important step for the selection and use of starter cultures. The aim of this study was to characterize 26 bacteriophages isolated from mozzarella cheese plants in terms of their host range, DNA restriction profile, DNA packaging mechanism, and the variable region VR2 of the antireceptor gene. The DNA restriction analysis was carried out by using the restriction enzymes EcoRV, PstI, and HindIII. The bacteriophages were distinguished into two main groups of S. thermophilus phages (cos- and pac-type) using a multiplex PCR method based on the amplification of conserved regions in the genes coding for the major structural proteins. All the phages belonged to the costype group except one, phage 1042, which gave a PCR fragment distinctive of pac-type group. Furthermore, DNA sequencing of the variable region VR2 of the antireceptor gene allowed to classify the phages and examine the correlation between typing profile and host range. Finally, bacterial strains used in this study were investigated for the presence of temperate phages by induction with mitomycin C and only S. thermophilus CHCC2070 was shown to be lysogenic. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Phage attack is a main cause of fermentation failure during the manufacture of mozzarella cheese. Dairy fermentations are vulnerable to phage infection for several reasons, i) contaminating phages may be naturally present in fluid milk; ii) repeated use of defined culture under non-aseptic processing conditions provides a constant host for phage proliferation (Klaenhammer and Fitzgerald, 1994; Neve et al., 1995); and iii) lysogenic bacteria may also be a source of new phages (Shimuzu-Kadota et al., 1983; Moineau et al., 1986; Relano et al., 1987; Tremblay and Moineau, 1999). The dairy industry has implemented many methods to reduce the consequences of phage infection such as ordinary disinfection of equipment, direct vat inoculation, propagation of starter cultures in phage inhibitory media, strain rotations and application of phage-resistant multiple strain starters (Everson, 1991). Streptococcus thermophilus strains are predominant in starter cultures used in the mozzarella cheese production and it is well known that they are often susceptible to phage attack resulting in slow lactic acid fermentation and loss of product quality (Mills et al., 2007). Since, beside Lactococcus lactis, S. thermophilus is considered the most
⁎ Corresponding author. Tel.: + 39 0812539452; fax: + 39 0812539407. E-mail address: [email protected] (G. Mauriello). 0168-1605/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2009.12.008
technologically important lactic acid bacterium by the dairy industry, the characterization of its phages is an important advancement for the selection of starter cultures. Removing the multi-sensitive strains and replacing them with strains with different phage sensitivities is an efficient approach for correct management of a defined culture rotation system. S. thermophilus phages belong to B1 Bradley's group, having a hexagonal capsid and a long non-contractile tail. They are divided into two groups (cos and pac-types) based on the number of major structural proteins and the encapsidation mechanism of doublestranded DNA (Le Marrec et al., 1997). Some bacteriophages can infect different bacterial strains and the definition of the host range is an important feature of bacteriophages to assess. The phage-host interactions were widely studied, and Duplessis and Moineau (2001) identified the phage genetic determinant (antireceptor) likely to be involved in the recognition of S. thermophilus hosts. They, in fact, characterized the antireceptor gene (orf18) of the tail morphogenesis module of the phages MD4 and DT1, finding the variable region VR2 responsible for the host specificity. The VR2 sequence was also used to classify S. thermophilus phages and verify the correlation between typing profile and host range (Binetti et al., 2005). The aim of this study was to define some specific features of 26 S. thermophilus bacteriophages for their following use in the selection of starter cultures.
138
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
borate, 1 mM EDTA pH 8.0) in 1.1% agarose gels. Running conditions: switch times 1–30 s linearly ramped over 24 h at 5.5 V/cm, 14 °C.
2. Materials and methods 2.1. Bacterial strains, bacteriophages and culture conditions
2.3. Phage propagation Bacterial strains and bacteriophages used in this study are reported in Table 1 and were from the Chr. Hansen culture collection. The origin and isolation period of each bacteriophage and the bacterial strain from which each phage was isolated, are indicated in Table 1. S. thermophilus AT1 was isolated from a natural whey culture used for traditional mozzarella cheese manufacture and belong to the culture collection of the Department of Food Science, University of Naples Federico II. Bacterial strains were identified by sequence analysis of the 16S rRNA gene and characterized at strain level by PFGE-SmaI analysis. Phages were isolated from abnormal mozzarella cheese manufactures. Host strains were stored at −80 °C in M17 (Oxoid) with 2% lactose, supplemented with 15% glycerol, and routinely cultured overnight in M17 broth at 42 °C. Phage stocks were prepared by addition of phages to an actively growing M17-Ca broth (M17 supplemented with 10 mM CaCl2) culture of the appropriate host. Host cultures were incubated at 42 °C until lysis was complete. Unlysed cells were removed by centrifugation at 8000 g for 10 min and the supernatants were filtered through 0.45 μm pore size filters (Minisart® plus, Sartorius AG, Goettingen, Germany). These phage preparations were then stored at − 80 °C with 15% glycerol. Phage enumeration (pfu/ml) was performed by the double-layer plaque titration method (Svensson and Christiansson, 1991), using M17-Ca agar and incubated at 42 °C.
Overnight S. thermophilus host bacteria culture was inoculated (1%) in 10 ml of M17-Ca broth, infected with its virulent phage suspension at a multiplicity of infection from 0.1 to 1 and incubated at 42 °C until complete lysis occurred. Then, the incubation was prolonged and 1 ml of bacterial culture was added at 1 h intervals for 4–5 times, in order to obtain a further amplification of the phage population. 2.4. Host range determination The sensitivity of S. thermophilus strains to 26 phages was determined. Phage DT1 and its host S. thermophilus SMQ-301 (Tremblay and Moineau, 1999) were used as control. Briefly, 0.1 ml of the log phase of each culture was mixed with M17 soft agar (0.5 % w/v) and plated as a thin top layer on M17-Ca/Mg (10 mM CaCl2, 10 mM MgCl2) agar (1% w/v) plates. Aliquots of 10 μl of lysates were spotted on the plates. After incubation at the conditions of growth, the presence or absence of lysis zones was recorded. The phage turbidity test was also carried out by inoculating 10 ml of a M17-Ca/Mg broth with 0.2 ml of an overnight culture of S. thermophilus strains and infecting with aliquots of phage suspension at multiplicity of infection of 0.1. The mixtures were incubated at 42 °C and observed periodically. The control tests were prepared with non infected strains to verify bacterial lysis. A total of 3 subcultures were made to increase the concentration of phages.
2.2. Strain typing with pulsed field gel electrophoresis 2.5. Phage DNA isolation The bacterial strains were typed using pulsed field gel electrophoresis (PFGE) using a BioRad CHEF Mapper XA. Harvested bacteria were cast into agarose blocks and treated subsequently with lysozyme and proteinase K. DNA was digested with SmaI restriction enzyme and electrophoresis was performed in 0.5 × TBE buffer (45 mM Tris-
Table 1 Relevant characteristics of bacteriophages used in this study. Bacteriophage
Origina
574 575 576 577 591 596 603 604 605 607 611 616 620 641 642 654 671 1027 1028 1032 1033 1034 1036 1040 1041 1042
Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella Italy, Mozzarella
a b
whey A whey A whey A whey B whey C whey D whey B whey E whey F whey G whey H whey I whey L whey M whey N whey O whey P whey Q whey Q whey Q whey R whey R whey R whey S whey S whey S
Isolation period
Strain of isolationb
April 1994 April 1994 April 1994 April 1994 April 1994 June 1994 August 1994 June 1994 June 1994 August 1994 September 1994 September 1994 September 1994 December 1994 September 1994 September 1994 November 1995 July 2004 July 2004 July 2004 July 2004 July 2004 July 2004 June 2005 June 2005 June 2005
CHCC2134 CHCC2070 CHCC2134 CHCC2389 CHCC2130 CHCC2134 CHCC2133 CHCC2134 CHCC2134 CHCC2130 CHCC3063 CHCC2134 CHCC2134 CHCC3049 CHCC3049 CHCC3063 CHCC3046 CHCC4323 CHCC4325 CHCC3048 CHCC4323 CHCC4327 CHCC3050 CHCC4327 CHCC4895 CHCC6592
Each different letter indicates a different dairy factory. These strains were used as starter cultures.
The DNA isolation was carried out by centrifugation of 1 ml of fresh phage lysate at 10,000 g for 10 min. RNase/DNase (1 mg/ml) was added and the preparation was incubated at 37 °C for 30 min. The supernatant was transferred to another tube and 100 μl of an SDS mixture (0.5 M Tris– HCl, 0.25 M EDTA, 2.5% SDS) were added. The solution was mixed for few seconds and was then incubated at 65 °C for 30 min. Then 125 μl of 8 M potassium acetate were added, and the preparation was mixed and placed on ice for 30 min. After centrifugation at 16,100 g for 30 min each sample was extracted twice with an equal volume of phenol–chloroform (1:1). The DNA was precipitated with an equal volume of isopropanol and each pellet was resuspended in 20 μl of water. The visualization by ethidium bromide staining was performed according to standard protocols (Sambrook et al., 1989). 2.6. Restriction analysis Purified phage DNA was digested by using three endonucleases (HindIII, PstI, EcoRV) (FastDigest™, Fermentas) according to the manufacturer's instructions. Restricted phage DNA was separated by electrophoresis in a 0.8% agarose gel in TAE buffer (40 mM Trisacetate, 1 mM EDTA), stained with ethidium bromide and visualized under UV illumination. 2.7. Determination of DNA packaging mechanism To rapidly classify S. thermophilus phages within one of the two main groups (cos- and pac-type) Quiberoni et al. (2006) developed a multiplex PCR method by using two pairs of primers (one per phage group, Table 2), designed from the conserved regions of the genes coding for the major capsid proteins of phages for which the complete genome sequence was available. The PCR reactions were performed in a total volume of 50 µl containing 125 µM deoxynucleotide triphosphate, 5 µM concentrations of the 4 primers, 2.5 U of Taq DNA
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144 Table 2 List of primers used in this study. Primer
Sequence, 5′–3′
Reference
cos FOR cos REV pac FOR pac REV HOST1 HOST5
GGTTCACGTGTTTATGAAAAATGG AGCAGAATCAGCAAGCAAGCTGTT GAAGCTATGCGTATGCAAGT TTAGGGATAAGAGTCAAGTG GAATGATACTGCTGGCAGTATTTCGGTTGG CAGTCATGTAGCTATCGATGAAATTCCAACG
Quiberoni et al. (2006) Quiberoni et al. (2006) Quiberoni et al. (2006) Quiberoni et al. (2006) Binetti et al. (2005) Binetti et al. (2005)
polymerase (Invitrogen, Milano, Italy), Taq buffer (20 mM Tris–HCl pH 8.4, 1.5 mM magnesium chloride, 50 mM potassium chloride), and 1 µl of the phage lysate. Phage DT1 (Tremblay and Moineau, 1999) was used as cos-type positive control. Phage DT1 was propagated on S. thermophilus SMQ-301. A negative control (without the template) was included for all PCR assays to control the possibility of contamination. The conditions of PCR amplifications were set as follows, 5 min at 94 °C, followed by 35 cycles (45 s at 94 °C, 45 s at 53 °C, 1 min at 73 °C), and a final step of 5 min at 73 °C. The PCR products were separated on a 2% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA), stained with ethidium bromide, and visualized under UV light. The fragments of 170 bp and 427 bp were distinctive of the cos-type and pac-type group, respectively. 2.8. Amplification and sequencing of the antireceptor gene variable region The amplification of the variable region (VR2) of the gene involved in host recognition was performed as suggested by Binetti et al. (2005). The PCR reactions were performed in a total volume of 100 µl containing 125 µM deoxynucleoside triphosphate, 5 µM concentrations of the primers HOST1 and HOST5 (Table 2), 2.5 U of Taq DNA polymerase, Taq buffer (20 mM Tris–HCl pH 8.4, 1.5 mM magnesium chloride, 50 mM potassium chloride), and 2 µl of the phage lysate. The PCR products were separated on a 1% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA), stained with ethidium bromide, and visualized under UV light. The fragments, whose sizes were
139
between 700 and 800 bp, were purified by using QIAquick PCR purification kit (QIagen, Milan, Italy) and sequencing was performed by Deoxy terminator cycle sequencing kit (Perkin-Elmer Applied Biosystems).
2.9. Induction of temperate bacteriophages Induction of temperate phages was performed by addition of mitomycin C at a final concentration of 0.2 µg/ml when the cultures had an OD600nm = 0.2. The presence of temperate phages was indicated by decrease of culture turbidity up to total clarification of the broth monitored by spectrophotometer measures at 600 nm. The lysates obtained were centrifuged at 8000 g for 10 min to remove bacterial cell debris, and the supernatants were filtered through 0.45 µm membrane and stored at 4 °C.
2.10. Data analysis The DNA restriction patterns of S. thermophilus strains and bacteriophages were captured using QuantityOne electrophoresis analysis system (Bio-Rad Laboratories). The cluster analysis was performed by the programme after band matching; the method described by Saitou and Nei (1987) was used to obtain the correlation matrix of the patterns. In the case of phages, for each enzyme a similarity matrix was created, and then joined into a single matrix. The resulting matrix was used in the average linkage method by the Cluster procedure of Systat 5.2.1 in order to estimate the percentage of similarity in the restriction profiles into phage and bacterial populations. Research for antireceptor gene variable region VR2 similarity was performed using BLAST at National Centre of Biotechnology Information GenBank (http://www.ncbi.nlm.nih.gov, Altschul et al., 1997). Phylogenetic analysis was performed using MEGA version 4.0 (Tamura et al., 2007) after multiple alignment by the ClustalW 1.8 programme (Thompson et al., 1994). Distance matrix and neighborjoining methods (Saitou and Nei, 1987) were applied for a dendrogram construction.
Fig. 1. Similarity dendrogram of Streptococcus thermophilus strains used in this study on the basis of pulsed field gel electrophoresis SmaI patterns, in parenthesis the bacteriophages to which the strains showed sensitivity.
− − − − − − − − − − − − − − − + − − − + − − − − − − − − − − − − − − − −
+ plaque formation, − no plaque formation. Identical host range is indicated by the same superscript. In the case of host range with two or more sensitive strains the asterisk indicates the microorganism used for the phage propagation.
DT1 1042 1041
− + − − − − − − − − − − + − +⁎ − − − − − − − − − − − − − − − + − − − − − + − − − − − − − + − − − − +⁎ − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − − − + − − − − − − − − − − − − + +⁎ + − − + − − − − − − − − − − − − + − − − − + +⁎ − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − − − − + − − − − − − − − + − − − − − − − − − − − − − − − − − + − − − − − − +⁎ + − − − − + − − − − − − − − − − − + − − − − − − − − − − − − − − + − − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − +* − − − − − − − − − − − − + − − − − − − + − − − − − − − − − − − − − − − − − − + +⁎ − − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − − − − + − − − − − − − − − − − − − −
620a 616a 611 607 605 604a 603 596 591 577 576a
− − − − + − − − − − − − − − − − − −
The PCR analysis of the antireceptor gene variable region VR2 gave an amplification fragment (700–800 bp) for all bacteriophages except 577, 607, 642, and 1028. All DNA sequences obtained (accession numbers FJ849032 to FJ849053) appeared to be homologous to the VR2 region of S. thermophilus bacteriophages, whose sequences are available in GenBank database (i.e. AF145054, AF348737, AF348738, AY699705 and EF529515). The cluster analysis of VR2 sequences from
575
3.5. Bacteriophage clustering based on VR2 sequences
Phages
All bacteriophages, with the exception of 1042 and 575, showed an amplification fragment of 170 bp (Fig. 3), indicating to belong to the cos-type group. On the other hand only bacteriophage 1042 resulted in a PCR fragment of 427 bp, distinctive of the pac-type phage group. Surprisingly, the lysate of phage 575 able to infect strain S. thermophilus CHCC2070 (Table 3), showed both 170 bp and 427 bp amplification fragments (Fig. 3).
Strains
3.4. Determination of DNA packaging mechanism
Table 3 Host range of 27 bacteriophages against 18 Streptococcus thermophilus strains.
The DNA restriction analysis showed only HindIII and EcoRV as capable to give a pattern with 8–12 bands, suitable for the differentiation of the 26 bacteriophages, while the enzyme PstI gave patterns with less than 3 bands (data not shown). Most phages had a unique profile, with the exception of phages 604, 620 and 654, which showed identical patterns when their DNA was digested by HindIII and EcoRV, respectively (Fig. 2). Combined cluster analysis of HindIII and EcoRV DNA fingerprints showed a high genetic diversity of the phages considered in this study. As shown in Fig. 2, except for phages 604, 620 and 654, which showed 100% of similarity, the cluster analysis allowed to distinguish each bacteriophage on the basis of restriction profiles and the highest similarity (85%) was shown between phages 603 and 1033.
641
3.3. Bacteriophage DNA restriction analysis
− + − − +⁎ − − − − − − − − − + − − −
642
654
671
1027b
1028
1032
1033b
The host range of 26 lytic phages from Chr. Hansen's as well as phage DT1 on 18 S. thermophilus strains is reported in Table 3. Phages 574, 576, 604, 616, and 620 were capable to infect only the strain S. thermophilus CHCC2134. Also the phage couples 1027–1033 and 1034–1040 infected only one strain: CHCC4323 and CHCC4327, respectively. As reported in Table 3, the other phages showed unique host ranges where the number of host strains ranged between 1 and 4. Out of the 9 above reported, 8 other bacteriophages showed to be virulent against only 1 strain, 3 against 2 strains, 4 against 3 strains and 2 against 4 strains. Furthermore, phage DT1 showed to be virulent against 6 strains. On the other hand, all S. thermophilus strains except AT1 were infected by at least one bacteriophage. S. thermophilus CHCC2134 showed to be very sensitive to phage infection, being a host for 8 different bacteriophages. In contrast, the strains CHCC3046, CHCC4325, CHCC3048 and CHCC6592, were susceptible only to the phages 671, 1028, 1032, and 1042, respectively. All the other strains were sensitive to 2, 3, or 4 bacteriophages.
− − +⁎ + − − − − − − − − − − − − − −
1040c 1036 1034c
3.2. Host range
− − − − − + − − − − − − − − − − − −
The DNA restriction patterns of S. thermophilus strains and relative similarity dendrogram are reported in Fig. 1. The similarity level ranged between 75% and 100%. The 18 host strains can be distinguished into 15 DNA fingerprinting groups. Identical fingerprints (100% of similarity) were only found for the couples CHCC3046/ CHCC3048, CHCC2389/CHCC2133 and CHCC3063/CHCC4460.
− − − − + − − − − − − − − − − − − −
3.1. Strain typing with pulse field gel electrophoresis
CHCC3063 CHCC2070 CHCC2130 CHCC2133 CHCC2134 CHCC2389 CHCC3048 CHCC3049 CHCC3050 CHCC3046 CHCC4323 CHCC4325 CHCC4327 CHCC4460 CHCC4895 CHCC6592 SMQ-301 AT1
3. Results
− + − + + + − − − − − − − − + − +⁎ −
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
574a
140
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
141
Fig. 2. Restriction profiles of 26 Streptococcus thermophilus bacteriophage DNA digested by HindIII and EcoRV and their cluster analysis.
bacteriophages used in this study and S. thermophilus phages DNA sequences available in GenBank database resulted in a dendrogram where the similarity among the bacteriophages of this study ranged from 38% to 100% (Fig. 4). Only two clusters showed a similarity level of 100% including 3 (cluster A) and 9 (cluster B) bacteriophages. At 90% similarity level the dendrogram showed 9 single-phage clusters and 1 (cluster D) and 2 (clusters C and E) clusters including 3 and 2 bacteriophages, respectively. The phage DT1 showed the lowest similarity level. 3.6. Evidence of temperate bacteriophages All the bacterial strains were tested for the presence of temperate phages but only S. thermophilus CHCC2070 exhibited cell lysis after addition of mitomycin C suggesting the induction of temperate bacteriophages from this microorganism. All S. thermophilus strains from this study were tested as possible hosts for this potential temperate phage, but none of the bacterial strains appeared to be a host for the phage. 4. Discussion
Fig. 3. Multiplex PCR for the detection of the cos- and pac-type groups of Streptococcus thermophilus phages. Lane 1, representative cos-type phage 574; lane 2, negative control; lane 3, bacteriophage 575 showing both amplification products; lane 4, pactype phage 1042; lane M, 1 kb ladder.
The increasing demand for dairy products in recent years has required increase in both production capacity and process efficiency. In this optic the use of starter cultures properly meets these dairy industry needs. However, the repeated use of defined starter cultures
142
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
Fig. 4. Dendrogram showing the % of similarity of 28 Streptococcus thermophilus bacteriophages on the basis of antireceptor VR2 gene sequences. GenBank accession numbers are reported in parenthesis.
under non-aseptic processing conditions amplifies the risk of proliferation and the infection ability of phages in dairy environments. The characterization of S. thermophilus phages is an important step for the selection of phage-resistant dairy starter cultures. In this study, 26 phages isolated from mozzarella cheese whey samples were analyzed on the basis of their host range, DNA packaging mechanism, and DNA restriction profile. Furthermore, 22 of them were clustered considering the variable region VR2 sequences of the antireceptor gene and a correlation with host range was examined. The phage population assayed showed 20 different host ranges (Table 3) suggesting a high variability level in terms of infection capability. Interestingly, AT1 appeared resistant to all the bacteriophages assayed, and is the sole strain isolated from a natural whey culture used for the production of traditional mozzarella cheese (data not shown). This environment is characterized by a very high microbial diversity, which probably represents a natural barrier against phage infection (Carminati et al., 1997). This strain could be taken into account for the assessment of other industrial performances such as acidifying and proteolytic activity. On the contrary, strain CHCC2134, as well as other multi-sensitive strains, is likely not
to be considered as starter culture because of the high risk of phage infection. In fact, this strain was infected in six different dairy factories when employed as starter culture. Furthermore, it was used two times in the same dairy factory and infected by two different bacteriophages, i.e. 574 and 576 (Table 1). Our results, showing a narrow host range, were generally in agreement with Binetti et al. (2005) who described the host ranges of 15 bacteriophages against 14 S. thermophilus strains, all from dairy environment. They reported that the phages had very diverse host ranges, the number of hosts ranging from just 1 to 4 strains. By contrast, only 16 S. thermophilus strains out of 36 were found sensitive to a number of bacteriophages ranging from 1 to 4, and as many as 9 strains were sensitive to more than 11 among 27 bacteriophages tested (Le Marrec et al., 1997). Interestingly, S. thermophilus strains showing 100% similarity by SmaI PFGE were not sensitive to the same bacteriophages. In fact, three couples of strains showing identical fingerprints had different phage sensitivity. The strains CHCC3046 and CHCC3048 showed to be sensitive towards two different bacteriophages, 671 and 1032, respectively. The strains CHCC2389 and CHCC2133, both sensitive to four phages, shared sensitivity to DT1 phage. Finally, the couple CHCC4895/CHCC2070 showed to share 3 phage sensitivity (i.e. 596, 1041 and DT1).
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
Therefore, the strains within the couples were probably different, as demonstrated by phage typing. Our results suggest that the phage typing, coupled with PFGE, is a suitable tool for bacterial strain typing, previously used for strain typing in staphylococci (Murchan et al., 2004). The variability within the phage population was confirmed by restriction profile analysis. In fact, most phages showed a unique pattern, as obtained by using HindIII and EcoRV enzymes (Fig. 2). The phages 604, 620 and 654 showed the same fingerprint after DNA digestion by both restriction enzymes, but only 604 and 620 shared the same infectivity pattern. Similarly, Guglielmotti et al. (2009) reported three bacteriophages showing different host ranges but identical restriction profiles and described different possible causes to explain an analogous result. The result on genetic diversity, combined to VR2 sequence and host range results, led us to hypothesize the high correlation between the phages 604 and 620. In fact, on the basis of VR2 sequencing, the phages 574, 575, 576, 604, 605, 620 and 654 (Fig. 4, cluster B) showed 100% similarity. They also showed 100% similarity with the bacteriophages MD1 and DT4, which are known to be infective towards the strain S. thermophilus SMQ-301 (Duplessis and Moineau, 2001). However, only the phages 574, 576, 604 and 620 showed the same host range, infecting S. thermophilus CHCC2134. Furthermore, the strain S. thermophilus SMQ-301 showed to be sensitive only to DT1 (Table 3), which does not belong to the cluster B of Fig. 4 and showed a very low similarity level with all other phages. However, the phages 604 and 620 were from different dairy factories and isolated in two different periods but both infected the same strain starter (Table 1). Also the phages 1034 and 1040, strictly related after VR2 sequencing (Fig. 4, cluster E), showed the same host range (Table 3). Therefore, a high correlation between host range and VR2 sequence were shown only in phages 574, 576, 604, 620, 1034 and 1040. Among them only the phages 574 and 576 were from the same factory (Table 1). Finally, four of our phages did not give amplification of VR2 region. As a matter of fact, only few S. thermophilus phage showed 100% homology of VR2 sequence with the HOST1 and none with HOST5 primer. This result confirmed the variability of the VR2 region of antireceptor gene; a low homology of these primers with the VR2 sequences of the phages 577, 607, 642 and 1028 could justify the amplification failure. Therefore, our results might indicate that further phage factors are involved in host specificity, as previously hypothesized by other authors (Binetti et al., 2005; Duplessis et al. 2006; Guglielmotti et al., 2009). Moreover, it could be interesting to note that the phages 604, 620 and 654 shared identical fingerprint and VR2 sequence, even though similar restriction profiles do not necessarily imply identical VR2 sequences (Guglielmotti et al., 2009). Our results showed that the multiplex PCR allowed distinguishing the cos-type and the pac-type phages. In this study only the bacteriophage 1042 and the temperate phage from S. thermophilus CHCC2070 gave an amplification fragment distinctive of pac-type group. All the other bacteriophages belong to the cos-type. As reported by Quiberoni et al. (2006), discriminating the pac-type and cos-type phages could be interesting to remove S. thermophilus strains sensitive to both phages group. In this study the unique pac-type phage 1042 infected only S. thermophilus strain CHCC6592, whereas all the other strains were sensitive to cos-type phages, confirming previous study demonstrating that rarely S. thermophilus strains were infected by members of both phage groups (Lévesque et al., 2005). The high preponderance of cos-type phages in dairy environments is also reported in several studies based on S. thermophilus phage diversity (Le Marrec et al., 1997; Quiberoni et al., 2003; Guglielmotti et al., 2009). Surprisingly, the bacteriophage 575 that infected only S. thermophilus strain CHCC2070 was shown to provide both PCR products for cos-type and pac-type group. When S. thermophilus CHCC2070 was treated by mitomycin C, it showed to be lysogenic and the PCR performed with its lysate yielded an amplification fragment distinctive of the pac-type group. Therefore, the results suggested that
143
the bacteriophage 575 lysate contained both its DNA (providing the cos-type fragment) and CHCC2070 prophage (providing the pactype fragment). Since lysogenic starter strains are considered as a possible source of bacteriophages in cheese plants, the induction of all bacterial strains used in this study was carried out to evidence the presence of temperate phages and only S. thermophilus CHCC2070 appeared to be lysogenic. The high diversity within the bacteriophage population used in this study could be justified by their isolation in different dairy factories using different starter cultures and by the different isolation period. It could be interesting to notice again that different phages (574 and 576) were isolated in the same dairy factory using the same starter strain in the same period, while two similar phages (604 and 620) were isolated in two different dairy factories, in two different periods, using the same strain starter. The high diversity among bacteriophages highlights the serious risk of phage infection during fermented food processing, even though we registered the presence of a high percentage of low sensitive S. thermophilus strains. In conclusion, testing a hypothetic starter culture against a phage population, characterized by a well determined high variability, is an efficient tool to exclude bacterial strains bringing on possible fermentation failure. Acknowledgement P. Zinno thanks Dr. Giorgio Giraffa of CRA Lodi, Italy, for basic training to acquire the fundamental techniques about bacteriophage manipulation. References Altschul, S., Madden, T., Schäffer, A., Zhang, J., Zhang, Z., Miller, W., Lipman, D., 1997. Gapped BLAST and PSI-BLAST, a new generation of protein database search programs. Nucleic Acids Research 25, 3389–3402. Binetti, A.G., Del Rio, B., Martin, M.C., Alvarez, M.A., 2005. Detection and characterization of Streptococcus thermophilus bacteriophages by use of the antireceptor gene sequence. Applied Environmental Microbiology 71, 6096–6103. Carminati, D., Mazzuccotelli, L., Giraffa, G., Neviani, E., 1997. Incidence of inducible bacteriophage in Lactobacillus heleveticus strain isolated from natural whey starter cultures. Journal of Dairy Science. 80, 1505–1511. Duplessis, M., Moineau, S., 2001. Identification of a genetic determinant responsible for host specificity in Streptococcus thermophilus bacteriophages. Molecular Microbiology 41, 325–336. Duplessis, M., Lévesque, C.M., Moineau, S., 2006. Characterization of Streptococcus thermophilus host range phage mutans. Applied Environmental Microbiology 72, 3036–3041. Everson, T.C., 1991. Control of phage in the dairy plant. Practical phage control. International Dairy Federation Bulletin 263, 16–23. Guglielmotti, D.M., Binetti, A.G., Rheinhamer, J.A., Quiberoni, A., 2009. Streptococcus thermophilus phage monitoring in a cheese factory: phage characteristics and their starter sensitivity. International Dairy Journal 19, 476–480. Klaenhammer, T. R., Fitzgerald, G.F., 1994. Bacteriophage and bacteriophage resistance in Genetics and Biotechnology of Lactic Acid Bacteria, eds M.J Gasson and W.M.de Vos. Blackie Academic and Professional, Chapmanand Hall, Glasgow, pp 106–168. Le Marrec, C., van Sinderen, D., Walsh, L., Stanley, E., Vlegels, E., Moineau, S., Heinze, P., Fitzgerald, G., Fayard, B., 1997. Two groups of bacteriophages infecting Streptococcus thermophilus can be distinguished on the basis of mode of packaging and genetic determinants for major structural protein. Applied Environmental Microbiology 63, 3246–3253. Lévesque, C., Duplessis, M., Labonté, J., Labrie, S., Fremaux, C., Tremblay, D., Moineau, S., 2005. Genomic organization and molecular analysis of the virulent bacteriophage 2972 infecting an exopolysaccaride-producing Streptococcus thermophilus strain. Applied Environmental Microbiology 71, 4057–4068. Mills, S., Coffey, A., McAuliffe, O.E., Mejer, W.C., Hafkamp, B., Ross, R.P., 2007. Efficient method for generation of bacteriophage insensitive mutants of Streptococcus thermophilus yoghurt and mozzarella strains. Journal of Microbiological Methods 70, 159–164. Moineau, S., Pandian, S., Klaenhammer, T.R., 1986. Restriction/modification systems and restriction endonuclease are more effective on lactococcal bacteriophages that have emerged presently in the industry. Applied and Environmental Microbiology 59, 197–202. Murchan, S., Aucken, H.A., O'Neill, G.L., Ganner, M., Cookson, B.D., 2004. Emergence, spread, and characterization of phage variants of epidemic methicillin-resistant Staphylococcus aureus 16 in England and Wales. Journal of Clinical Microbiology 42, 5154–5160.
144
P. Zinno et al. / International Journal of Food Microbiology 138 (2010) 137–144
Neve, H., Berger, A., Heller, K.J., 1995. A method for detecting and enumerating airborne virulent bacteriophage of dairy starter cultures. Kieler Milchwirtschaftliche Forschungsberichte 47, 193–207. Quiberoni, A., Auad, L., Binetti, A., Suarez, V., Rheinheimer, J.A., Raya, R.R., 2003. Comparative analysis of Streptococcus thermophilus bacteriophage isolated from a yogurt industrial plant. Food Microbiology 20, 461–469. Quiberoni, A., Tremblay, D., Ackermann, W., Moineau, S., Reinheimer, J.A., 2006. Diversity of Streptococcus thermophilus phages in a large-production cheese factory in Argentina. Journal of Dairy Science 89, 3791–3799. Relano, P., Mata, M., Bonneau, M., Rizenthaler, P., 1987. Molecular characterization and comparison of 38 virulent and temperate bacteriophages of Streptococcus lactis. Journal of General Microbiology 133, 3053–3063. Saitou, N., Nei, M., 1987. The neighbor-joining method, new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 12, 823–833. Sambrook, J., Fritsch, E.F., Maniatas, T., 1989. Molecular Cloning, a Laboratory Manual Cold Spring Harbor Laboratory.
Shimuzu-Kadota, M., Sakurai, T., Tsuchida, N., 1983. Prophage origin of a virulent phage appearing on fermentation of L. casei S-1. Applied and Environmental Microbiology 45, 669–674. Svensson, U., Christiansson, A., 1991. Methods for phage monitoring. International Dairy Federation Bulletin 263, 29–39. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4, Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal W, improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Tremblay, D.M., Moineau, S., 1999. Complete genomic sequence of the lytic bacteriophage DT1 of Streptococcus thermophilus. Virology 255, 63–76.