- Email: [email protected]
Characterization of the 5′-flanking region of the gene encoding the 50 kDa subunit of human DNA polymerase δ
Biochimica et Biophysica Acta 1493 (2000) 231^236
www.elsevier.com/locate/bba
Short sequence-paper
Characterization of the 5P-£anking region of the gene encoding the 50 kDa subunit of human DNA polymerase N Aymee Perez 1 , Argentina Leon, Marietta Y.W.T. Lee * Department of Biochemistry and Molecular Biology, New York Medical College, Valhalla, NY 10595, USA Received 10 March 2000; received in revised form 29 May 2000; accepted 31 May 2000
Abstract DNA polymerase N consists of at least four subunits: p125, p68, p50, and p12 [Liu et al., J. Biol. Chem. 275 (2000) 18739^18744]. We have isolated genomic DNA clones covering the gene for the human DNA polymerase N 50 kDa subunit (POLD2) and its 5P-flanking sequence. The POLD2 gene is composed of 11 exons and is distributed over 10 kb of genomic DNA. All exon^intron splice junctions conformed to the GT/AG consensus sequence. The 5P-flanking region of human POLD2 is G+C-rich and does not have a typical TATA box. A computer-based search for potential transcription factor binding sites revealed the existence of a number of motifs including those for AP1, AP2, Sp1, NF-1 and CREB. The functional activity of the regulatory region of the human POLD2 gene was demonstrated by its ability to drive the expression of a chloramphenicol acetyltransferase reporter gene in COS-7 cells. ß 2000 Elsevier Science B.V. All rights reserved. Keywords : DNA polymerase N; POLD2 promoter
DNA polymerases (Pols) are enzymes of central importance in DNA replication and repair [2^4]. In eukaryotic cells, at least eight Pols, K, L, Q, N, O, j, R and a, have been identi¢ed [3^5], three of which, namely Pol K, Pol N and Pol O, are essential for DNA replication [6]. Genetic studies in the yeast Saccharomyces cerevisiae indicated that these three DNA polymerases are encoded by essential genes [7]. In addition, at least three polymerase accessory proteins, proliferating cell nuclear antigen (PCNA), replication factor C, and replication protein A, are involved in DNA replication at the replication fork [8]. Pol N was originally discovered as a new type of DNA polymerase that possessed an intrinsic 3P to 5P exonuclease activity [9]. Pol N is the major replicative DNA polymerase in the eukaryotic cell. Evidence for this is based on extensive in vitro studies using simian virus 40 (SV40) as a model system, and genetic and biochemical studies in the yeast S. cerevisiae and Schizosaccharomyces pombe [6^8]. The best characterized Pol N from mammalian cells is the enzyme puri¢ed from fetal calf thymus tissue. This is a heterodimer with a catalytic subunit of 125 kDa encoded * Corresponding author. Fax: +1-914-594-4058; E-mail : [email protected] 1 Present address: Department of Cell Biology and Anatomy, University of Miami School of Medicine, Miami, FL 33101, USA.
by the POLD1 gene, and a second subunit of 50 kDa, encoded by the POLD2 gene [10]. The p50 subunit is required for e¤cient stimulation of the polymerase processivity by PCNA [11,12], and is thus indispensable for pol N function. In addition to its role in DNA replication, Pol N has also been shown to play an important role in DNA repair [2,13^17]. The subunit structure of Pol N has been the focus of recent investigations in yeast, and these have led to the identi¢cation of additional subunits. In S. pombe, Pol N is believed to consist of at least four subunits: a large catalytic subunit (Pol3) and three smaller subunits (Cdc1, Cdc27 and Cdm1) [18,19]. The mammalian Pol N also contains additional subunits. It was recently shown that a 68 kDa and a 12 kDa polypeptide are associated with the Pol N core [1,20]. In this study we report the cloning of the human genomic DNA upstream of the coding region of POLD2, the determination of the organization of the gene, as well as preliminary analysis of its promoter sequence. A human placenta genomic library in VFix II (Stratagene) was screened with a randomly primed 32 P-labeled cDNA probe of the full length human p50 cDNA [11,21] by a standard plaque hybridization method. Eight discrete clones with overlapping genomic DNA inserts were isolated. One of these, VF4 (Fig. 1A), contained the 5P-end and all the exon^intron sequences of the POLD2
0167-4781 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 0 0 ) 0 0 1 5 3 - 6
BBAEXP 91442 28-8-00
232
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
Fig. 1. (A) Structure of the POLD2 gene. The clone VF4 is represented as horizontal line at the bottom. The 11 exons (1^11), 10 introns and 5P-£anking region of the POLD2 gene are shown to scale at the top. The closed boxes represent the coding exons and the open boxes 5P- and 3P-UTRs. The initiation (ATG) and stop (TGA) codons are indicated. The positions of some restriction sites are shown: Bg, BglII; E, EcoRI; B, BamHI ; N, NotI. (B) Sequence of the 5P-upstream region of the POLD2 gene. The ATG translation start codon is boxed. The transcription start site is shown and denoted `+1'. The putative binding sites for regulatory elements are boxed with the site or factor symbols above the sequence. The sequences of the 5P-upstream region and the ¢rst exon are shown in capital letters, and the sequence of the ¢rst intron is shown in lower case letters. The cDNA sequence corresponding to the ¢rst exon and part of the second exon is underlined. The GenBank accession number is AF185279.
gene. The rest of the clones overlapped each other and contain sequences from exon 2 to the 3P-end of the POLD2 gene. The clone VF4 (Fig. 1A) was subjected to restriction digestion with BglII and EcoRI and the fragments were subcloned into pBluescript II KS (Stratagene) for DNA sequence analysis. A 3.2 kb BglII fragment that comprised about 2.4 kb of the promoter plus exon 1, as well as 0.8 kb of the ¢rst intron was isolated. This 3.2 kb fragment was completely sequenced in both orientations. The transcription initiation site of the human POLD2 gene was determined by both primer extension and 5P-RACE studies using total RNA from HeLa cells. Prim-
er extension analysis was performed with the antisense primer GSP3 (Table 1). Several elongation products were detected (Fig. 2A), possibly due to premature termination of transcription because of the secondary structure of mRNA. The sizes of the major extension products were 139 and 110 nucleotides long. The size of the longest extension product (139 nt) indicated that transcription is initiated from 93 bp upstream of the translation start site. The results from the primer extension experiments were con¢rmed by 5P-RACE studies using the gene-speci¢c primers GSP1, GSP2, GSP3 and the anchor primers AP,
Table 1 Oligonucleotide primers Primer
Sequence
Strand
Assay
GSP1 GSP2 GSP3 PD50 F1 R2 F2 F3 R3 F4 R4 3PP50 AP AUAP
5P-ACACAGCACTTCTCCTCAGGC-3P 5P-GTTGGCTGATGGTGGGGACA-3P 5P-GGACAGTAGAGTGTGGGCCC-3P 5P-CAGGAGTGTGGCCATGTTTTCTGAG-3P 5P-TGTGTGGTGGGCACTCTGTTC-3P 5P-GGGAGCAAGGTCAGCAAAGC-3P 5P-GCTTTGCTGACCTTGCTCC-3P 5P-TGATGCCAGGCGAGTTTG-3P 5P-AACTCGCCTGGCATCACGTC-3P 5P-CCCGGACACTCTAGGTTGTTAC-3P 5P-GGTCCACTCCAGGATCTCCAA-3P 5P-CGCATCAGCAAGTGCCAGGCTTTA-3P 5P-ACTAGCGGCCGCGTCGACTAGTG-3P 5P-ACTAGCGGCCGCGTCGACTAGT-3P
Antisense Antisense Antisense Sense Sense Antisense Sense Sense Antisense Sense Antisense Antisense Sense Sense
RC, Ex-Int RC RC, PE Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Ex-Int 10 RC RC
3, Seq
2 4 5, 5, 8, 6, 9, 8,
6 6 9 7 10 9
Ex-Int, primers for exon^intron splicing junction ; PE, primer extension ; Seq, sequencing of POLD2 subclones ; RC, rapid ampli¢cation of cDNA 5P-ends (5P-RACE).
BBAEXP 91442 28-8-00
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
233
Fig. 2. Mapping of exon 1 and determination of transcription initiation site. (A) Mapping of the transcription start site by primer extension analysis. Primer extension was performed by standard methods [33]. Primer GSP3 (Table 1) complementary to the POLD2 mRNA was end-labeled with [Q-32 P]ATP and then annealed to 10 Wg of total HeLa cell RNA at 55³C for 90 min. Yeast tRNA was used as control for extension speci¢city. Reverse transcription was performed with SuperScript reverse transcriptase (Life Technologies, Inc.) at 42³C for 60 min. The extension products were run on 7% sequencing gels along with 32 P-labeled HaeIII-digested PX174 DNA. Lane 1, primer extension with yeast tRNA as control ; lane 2, with total RNA from HeLa cells. The position of the transcription start site (+1) is indicated by the arrow. (B) Determination of the POLD2 transcription initiation site by the 5P-RACE method. The positions of the ¢ve primers and the PCR fragment obtained in this experiment are as shown. Total HeLa cell RNA (1 Wg) was annealed with a gene-speci¢c oligonucleotide (GSP1, Table 1) corresponding to the 3P-end of the third exon. Sequential PCR ampli¢cation was performed using primers AP, GSP2, AUAP, and GSP3 (Table 1). The ¢rst PCR ampli¢cation, using the pair of primers AP and GSP2, was performed under the following conditions: 94³C for 1 min, 55³C for 30 s, and 72³C for 1 min, for a total of 35 cycles. The ¢rst PCR product was diluted 1:100 and was then subjected to a second PCR ampli¢cation with the primers AUAP and GSP3 under the same PCR conditions. The ¢nal PCR product was directly cloned into the PCR-II vector using a TA cloning kit (Invitrogen) for sequence analysis. M, molecular size markers in bp; lane 1 and lane 2, 5P-RACE product from HeLa RNA.
exon^intron boundary, so that the ¢rst intron is located 56 bp upstream of the translation start site. The structural map of the POLD2 gene for the small subunit of Pol N was determined by a combination of restriction enzyme digestion, Southern blot hybridization, PCR analysis and DNA sequencing. The POLD2 gene is
and AUAP (Table 1, Fig. 2B). A single transcript of 167 bp was obtained. This result indicates that transcription is initiated from 93 bp upstream of the translation start site, in complete agreement with the results of the primer extension analysis. This position of the transcription start site gives it a location 37 bp upstream of the ¢rst Table 2 Analysis of exon^intron splice junctions of the POLD2 gene . No. 1 2 3 4 5 6 7 8 9 10 11
Intron
Exon
Intron
Position
Exon size (bp)
Intron size
gttttcgcag cgtgtcccag tgcattccag tgctccccag tctcccgcag tctattccag tgccttccag tgccttgcag tctcctccag ttctttgcag
GGCGCGCGGGTGCGCCGCGGG TGAACCTCCTTCAGCACTGGG GCAGTGGAGTTCAGCGAGGAG CACAACCTGCTCTGGTTACGG GGACTGTCCTTACACAGATAG GTTTGTGCTATTATCAATAAG GCCAAATACCTGCAGCTGAGC GCCTCAGTGCTATGGAGTCAG ATTTTTGGGGTGACACTCTAG GTTGTTACCCTATCATCCGAG GTCCTGAGGATTGCTGATGCG
gtgagtgggg gtaagtgaga gtgaggcagg gtagggagcc gtgagcagca gtatggagcc gtgagcgagc gtagctggca gtaacaggct gtaatttttg
394^357 356^210 211^332 333^456 457^571 572^770 771^851 852^1009 1010^1137 1138^1239 1240^1497
37 276 122 124 115 199 81 158 128 102 258
1.4 kb 3.8 kb 200 kb 370 bp 117 bp 306 bp 157 bp 221 bp 369 bp 349 bp
Exon and intron sequences were determined by sequence analysis. Intron 1 interrupts the 5P-UTR of the gene 56 bp upstream of the ATG start codon. Intron sizes were determined by a combination of sequencing (intron 1), PCR ampli¢cation of genomic clones using cDNA primers, and restriction digest analysis of genomic clones. The complete coding sequence of human POLD2 cDNA has been published previously [21]. The exon^intron boundaries for exon 1 were sequenced from the VF4 clone. The remaining exons were sequenced after PCR ampli¢cation, using di¡erent primer combinations (Table 1), of the VF4 clone and the mRNA for POLD2. The sizes of the introns were determined by sequencing, PCR ampli¢cation and/or restriction mapping. The GenBank accession number for the complete POLD2 gene sequence is AF239710. Nucleotide position +1 is assigned to the A residue of the ATG translation start site.
BBAEXP 91442 28-8-00
234
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
approximately 10 kb in length and consists of 11 exons interrupted by 10 introns. The exon sequences closely match the published cDNA sequence [21], and all splice acceptor and donor sequences match the 5P-AG/GT-3P splicing junction consensus sequence (Table 2) [22,23]. The ¢rst exon, with a length of 37 bp, contains only the 5P-untranslated region (UTR) of the mRNA. The ATG start codon is found 56 bp downstream from the intron 1^exon 2 boundary (Fig. 1B). Therefore, exons 2^11 provide the coding information for this gene. Introns 1 and 2 of POLD2 were the longest of the 10 introns present, with estimated lengths of approximately 1.4 and 3.7 kb, respectively (Table 2). The sequences of the coding regions are identical to those reported for the human POLD2 cDNA [21]. The only di¡erence is in the length of the 5P-UTR. As shown below, the 5P-end of human POLD2 cDNA is 16 bp longer (Fig. 1B) than that reported for the cDNA [21]. The entire 3.2 kb BglII genomic fragment of DNA inserted into pBluescript II KS plasmid was sequenced to obtain the 5P-£anking sequence of the POLD2 gene (Fig. 1B). This clone contains exon 1, part of intron 1, and about 2.4 kb of 5P-£anking sequence. Analysis of the sequence immediately upstream of the transcription start site showed that it lacks a consensus TATA box, as has been observed for the promoters of many mammalian housekeeping genes [24]. However, the absence of a TATA box in this promoter is typical of genes encoding several other S-phase-speci¢c enzymes, including those for Pols K, N and O [25^28]. The TRANSFAC [29] program (http://transfac.gbf.de/ TRANSFAC) was used for the identi¢cation of putative consensus elements and potential transcription factor binding sites in the 5P-regulatory region of POLD2. Several binding motifs for transcription factors were observed in this promoter region. These motifs include binding sites for the transcription factors Sp1 (GC box), activator protein 1 and 2 (AP1 and AP2), nuclear factor-1 (NF-1), cAMP response element binding protein (CREB) and NF-Y (CCAAT box) (Fig. 1B, Table 3). Their possible
functions remain to be tested. However, the presence of consensus binding sites for transcription factors Sp1, NFY and AP-1 in the putative promoter of POLD2 is consistent with S-phase-speci¢c expression, and suggests similar transcriptional regulation as the genes for the replicative Pols K, N and O. The transcription factors Sp1 and E2F have been found to play central roles in the modulation of such genes [30], as appears to be the case for Pols K, O and N (POLD1) [26,28,31]. In this regard, it may be noted that cotransfection studies in Drosophila SL2 cells showed that both Sp1 and Sp3 but not Sp2 could activate the POLD1 promoter [31]. Of special interest is the observation that the POLD2 promoter has three Sp1 consensus sites near the transcription start site. This makes sense as the expression of both the catalytic and small subunit of polymerase N has to be coordinately regulated. A 2.4 kb fragment of the POLD2 gene that included 2.2 kb of the promoter region, exon 1 and 800 bp of intron 1 was excised from the 3.2 kb plasmid using KpnI and SacI restriction sites and inserted 5P to the pCATBasic reporter plasmid (Promega). This construct, (pCAT2.2) along with its deletion mutant pCAT800 (Fig. 3), which contains an 800 bp fragment upstream of the ¢rst exon, and pCATBasic (with no insert as a negative control) were transfected into COS-7 cells. The transfection e¤ciency was normalized by co-transfection of a L-galactosidase plasmid driven by the SV40 promoter. Fig. 3A shows that the 2.2 kb POLD2 DNA could promote the expression of the chloramphenicol acetyltransferase (CAT) gene. The expression driven by the POLD2 fragment was about 60% of the SV40 early promoter. The low level of CAT conversion detected in the lysates of cells transfected with the pCATBasic plasmid is most likely due to an enhancer element present in this vector. Deletion of the promoter region to 800 bp upstream of the ¢rst exon resulted in a dramatic loss of promoter activity in COS-7 cells as shown by comparison of the construct pCAT2.2 with the pCAT800 construct (Fig. 3B). These results demonstrate that this region of the POLD2 gene could act as a functional regulatory
Table 3 Putative regulatory elements found in the 5P £anking region of POLD2 Element
Position
Sequence
Reference
NF-1 CREB
3337 to 3320 3330 to 3319 3256 to 3247 398 to 377 3328 to 3318 3298 to 3287 396 to 376 3117 to 3106 3195 to 3182 352 to 340 312 to +1 380 to 363
gtcTGGCggggtgacgac ggggTGACgacc gggcTGACgggg (3) ctggTGACggac ggTGACgacca ccTGACggggt ggTGACggacg atCCCGccgacc (3) gcggGGCGggggc (3) gatgGGCGgggaa gatgGGCGgggcag acCAATcgctgccctcct
[36] [37]
AP-1
AP-2 Sp1
CAAT
[38]
[39] [30]
[40]
A region of 340 bp upstream from the transcription initiation site (GenBank accession number is AF185279) was analyzed for potential transcription factor binding sites using the TRANSFAC [29] program. Only core sequences showing perfect matches to consensus transcription factor binding sites are listed (upper-case letters). (3) denotes the presence of the element on the cDNA strand.
BBAEXP 91442 28-8-00
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
235
POLD2 promoter that enhance the expression of this gene. Studies of the expression of genes involved in nucleotide metabolism and DNA synthesis have revealed the presence of multiple regulatory elements including GC boxes, which are required for maximal promoter activity [30,32]. Several potential transcription factor binding sites were found upstream of the region used to create the pCAT800 deletion construct (Fig. 1B). These include two Sp1 binding sites and three AP1 binding sites. Further analysis is needed for identi¢cation of the sequences in this region of the promoter that might in£uence the expression of the POLD2 gene in COS-7 cells. Taken together, these data indicate that the 2.2 kb 5P-£anking DNA of POLD2 contains a functional promoter. The authors wish to thank Drs. Heng Xu and Li Liu for help with the sequence analysis and Dr. Baoqing Li for critical reading of the manuscript. This work was supported by a National Institutes of Health Grant GM31973 and a grant from the National Institute of Environmental Health Sciences, ES07634. A preliminary account of this work was presented at the Eukaryotic DNA Replication Meeting in Cold Spring Harbor, NY, 1997.
Fig. 3. Functional activity of the POLD2 regulatory regions. pSV40 plasmid contains the SV40 early promoter and was used as a positive control. pCAT3Basic (Promega) contains no promoter and was used as the background control and to generate CAT reporter gene constructs. p3Kb was generated by cloning a 3.2 kb BglII fragment from phage clone VF4 into pBluescript II KS (Stratagene) digested with BamHI and dephosphorylated with CIP. pCAT2.2 was generated by cloning a 3.2 kb KpnI^SacI fragment from p3Kb into the KpnI^SacI cloning site of pCAT3Basic, such that POLD2 promoter directs transcription from the CAT gene. pCAT2.2 contained 2.2 kb of the promoter region, exon 1 and 800 bp of intron 1. A 5P deletion mutant of the POLD2 regulatory region (pCAT800) was made by excision of the 800 bp BssHII fragment (nucleotides 3809 to +2) from plasmid pCAT2.2 and insertion into the pCATBasic plasmid. COS-7 cells maintained in Dulbecco's modi¢ed Eagle's medium (Life Technologies, Inc.) plus 10% fetal bovine serum were plated at 40^50% con£uence for transfection using the calcium phosphate procedure [34]. The amounts of reporter constructs used in transfection experiments are as indicated. All the assays were performed in the presence of 2 Wg of a L-galactosidase expression plasmid (pSV L-gal, Promega). This was used as an internal control to normalize for variations in transfection e¤ciency. The total amount of DNA in each transfection was standardized to 20 Wg using carrier DNA (pBluescript). After 20 h incubation with calcium phosphate-precipitated DNA, the cells were washed with medium before incubation for an additional 20^ 24 h. Cellular extracts were prepared and normalized for L-galactosidase activity as previously described [35]. Generally, CAT assays contained extracts corresponding to 10 U of L-galactosidase. The CAT activity was quanti¢ed by scintillation counting. All results were statistically signi¢cant at P 6 0.01 using Student's unpaired t-test.
region that contains the necessary cis-acting elements for driving the expression of this gene in COS-7 cells. At the same time, these results clearly indicate the existence of regulatory element(s) within the distal region of the
References [1] L. Liu, J. Mo, E. Rodriguez-Belmonte, M.Y.W.T. Lee, J. Biol. Chem. 275 (2000) 18739^18744. [2] X.R. Zeng, Y. Jiang, S.J. Zhang, H. Hao, M.Y.W.T. Lee, J. Biol. Chem. 269 (1994) 13748^13751. [3] P.E. Gibbs, W.G. McGregor, V.M. Maher, P. Nisson, C.W. Lawrence, Proc. Natl. Acad. Sci. USA 95 (1998) 6876^6880. [4] R.E. Johnson, S. Prakash, L. Prakash, J. Biol. Chem. 274 (1999) 15975^15977. [5] F.S. Sharief, P.J. Vojta, P.A. Ropp, W.C. Copeland, Genomics 59 (1999) 90^96. [6] S. Waga, B. Stillman, Nature 369 (1994) 207^212. [7] A. Sugino, Trends Biochem. Sci. 20 (1995) 319^323. [8] R. Hindges, U. Hu«bscher, Biol. Chem. 378 (1997) 345^362. [9] J.J. Byrnes, K.M. Downey, V.L. Black, A.G. So, Biochemistry 15 (1976) 2817^2823. [10] M.Y.W.T. Lee, C.K. Tan, K.M. Downey, A.G. So, Biochemistry 23 (1984) 1906^1913. [11] J.Q. Zhou, H. He, C.K. Tan, K.M. Downey, A.G. So, Nucleic Acids Res. 25 (1997) 1094^1099. [12] Y. Sun, Y. Jiang, P. Zhang, S.J. Zhang, Y. Zhou, B.Q. Li, N.L. Toomey, M.Y.W.T. Lee, J. Biol. Chem. 272 (1997) 13013^13018. [13] S.L. Dresler, K.S. Kimbro, Biochemistry 26 (1987) 2664^2668. [14] C. Nishida, P. Reinhard, S. Linn, J. Biol. Chem. 263 (1998) 501^510. [15] R.A. Hammond, J.K. McClung, M.R. Miller, Biochemistry 29 (1990) 286^291. [16] K.K. Shivji, M.K. Kenny, R.D. Wood, Cell 69 (1992) 367^374. [17] A. Morrison, A.L. Johnson, L.H. Johnston, A. Sugino, EMBO J. 12 (1993) 1467^1473. [18] S.A. MacNeill, S. Moreno, N. Reynolds, P. Nurse, P.A. Fantes, EMBO J. 15 (1996) 4613^4628. [19] S. Zuo, E. Gibbs, Z. Kelven, T.S.-F. Wang, M. O'Donnell, M. MacNeill, J. Hurwitz, Proc. Natl. Acad. Sci. USA 94 (1997) 11244^11249. [20] P. Zhang, J. Mo, A. Perez, A. Leon, L. Liu, N. Mazloum, H. Xu, M.Y.W.T. Lee, J. Biol. Chem. 274 (1999) 26647^26653.
BBAEXP 91442 28-8-00
236
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
[21] J. Zhang, C.K. Tan, B. McMullin, K.M. Downey, A.G. So, Genomics 29 (1995) 179^186. [22] S.M. Mount, Nucleic Acids Res. 10 (1982) 459^472. [23] Y. Oshima, Y. Gotoh, J. Mol. Biol. 186 (1987) 43^51. [24] J.C. Azizkhan, D.E. Jenson, A.J. Pierce, M. Wade, Crit. Rev. Eukaryotic Gene Expr. 3 (1993) 229^254. [25] L.F. Johnson, Curr. Opin. Cell Biol. 4 (1992) 149^154. [26] B.E. Pearson, H.P. Nasheuer, T.S.F. Wang, Mol. Cell. Biol. 11 (1991) 2081^2095. [27] L.S. Chang, L. Zhao, L. Zhu, M.L. Chen, M.Y.W.T. Lee, Genomics 28 (1995) 411^419. [28] D. Huang, H. Pospiech, T. Kesti, J. Syva«oja, Biochem. J. 339 (1999) 657^665. [29] T. Heinemeyer, E. Wingender, I. Reuter, H. Hermjakob, A.E. Kel, O.V. Kel, E.V. Ignatieva, E.A. Aranko, O.A. Podkolodnaya, F.A. Kolpakov, N.L. Podkolodny, N.A. Kolchanov, Nucleic Acids Res. 26 (1998) 362^367. [30] J.E. Slansky, P.J. Farnham, BioEssays 18 (1996) 55^62.
[31] L. Zhao, L.S. Chang, J. Biol. Chem. 272 (1997) 4869^4882. [32] S. Delgado, M. Gomez, A. Bird, F. Anteqera, EMBO J. 17 (1998) 2426^2435. [33] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning : A Laboratory Manual, 2nd edn., Cold Spring Harbor Press, Cold Spring Harbor, NY, 1989, pp. 7.79^7.83. [34] V. Kumar, S. Green, A. Staub, P. Chambon, Proc. Natl. Acad. Sci. USA 86 (1986) 5310^5314. [35] M. Petkovich, N.J. Brand, A. Krust, P. Chambon, Nature 330 (1987) 444^450. [36] R.M. Gronostajski, S. Adhya, K. Nagata, R.A. Guggenheimer, J. Hurwitz, Mol. Cell. Biol. 5 (1985) 964^971. [37] M.R. Montminy, L.M. Bilezikjian, Nature 328 (1987) 175^178. [38] V.J. Foletta, Immunol. Cell Biol. 74 (1996) 121^133. [39] Y.X. Zeng, K. Somasundaram, W.S. el-Deiry, Nature Genet. 15 (1997) 78^82. [40] N.C. Jones, P.W.J. Rigby, E.B. Zi¡, Genes Dev. 2 (1988) 267^281.
BBAEXP 91442 28-8-00
www.elsevier.com/locate/bba
Short sequence-paper
Characterization of the 5P-£anking region of the gene encoding the 50 kDa subunit of human DNA polymerase N Aymee Perez 1 , Argentina Leon, Marietta Y.W.T. Lee * Department of Biochemistry and Molecular Biology, New York Medical College, Valhalla, NY 10595, USA Received 10 March 2000; received in revised form 29 May 2000; accepted 31 May 2000
Abstract DNA polymerase N consists of at least four subunits: p125, p68, p50, and p12 [Liu et al., J. Biol. Chem. 275 (2000) 18739^18744]. We have isolated genomic DNA clones covering the gene for the human DNA polymerase N 50 kDa subunit (POLD2) and its 5P-flanking sequence. The POLD2 gene is composed of 11 exons and is distributed over 10 kb of genomic DNA. All exon^intron splice junctions conformed to the GT/AG consensus sequence. The 5P-flanking region of human POLD2 is G+C-rich and does not have a typical TATA box. A computer-based search for potential transcription factor binding sites revealed the existence of a number of motifs including those for AP1, AP2, Sp1, NF-1 and CREB. The functional activity of the regulatory region of the human POLD2 gene was demonstrated by its ability to drive the expression of a chloramphenicol acetyltransferase reporter gene in COS-7 cells. ß 2000 Elsevier Science B.V. All rights reserved. Keywords : DNA polymerase N; POLD2 promoter
DNA polymerases (Pols) are enzymes of central importance in DNA replication and repair [2^4]. In eukaryotic cells, at least eight Pols, K, L, Q, N, O, j, R and a, have been identi¢ed [3^5], three of which, namely Pol K, Pol N and Pol O, are essential for DNA replication [6]. Genetic studies in the yeast Saccharomyces cerevisiae indicated that these three DNA polymerases are encoded by essential genes [7]. In addition, at least three polymerase accessory proteins, proliferating cell nuclear antigen (PCNA), replication factor C, and replication protein A, are involved in DNA replication at the replication fork [8]. Pol N was originally discovered as a new type of DNA polymerase that possessed an intrinsic 3P to 5P exonuclease activity [9]. Pol N is the major replicative DNA polymerase in the eukaryotic cell. Evidence for this is based on extensive in vitro studies using simian virus 40 (SV40) as a model system, and genetic and biochemical studies in the yeast S. cerevisiae and Schizosaccharomyces pombe [6^8]. The best characterized Pol N from mammalian cells is the enzyme puri¢ed from fetal calf thymus tissue. This is a heterodimer with a catalytic subunit of 125 kDa encoded * Corresponding author. Fax: +1-914-594-4058; E-mail : [email protected] 1 Present address: Department of Cell Biology and Anatomy, University of Miami School of Medicine, Miami, FL 33101, USA.
by the POLD1 gene, and a second subunit of 50 kDa, encoded by the POLD2 gene [10]. The p50 subunit is required for e¤cient stimulation of the polymerase processivity by PCNA [11,12], and is thus indispensable for pol N function. In addition to its role in DNA replication, Pol N has also been shown to play an important role in DNA repair [2,13^17]. The subunit structure of Pol N has been the focus of recent investigations in yeast, and these have led to the identi¢cation of additional subunits. In S. pombe, Pol N is believed to consist of at least four subunits: a large catalytic subunit (Pol3) and three smaller subunits (Cdc1, Cdc27 and Cdm1) [18,19]. The mammalian Pol N also contains additional subunits. It was recently shown that a 68 kDa and a 12 kDa polypeptide are associated with the Pol N core [1,20]. In this study we report the cloning of the human genomic DNA upstream of the coding region of POLD2, the determination of the organization of the gene, as well as preliminary analysis of its promoter sequence. A human placenta genomic library in VFix II (Stratagene) was screened with a randomly primed 32 P-labeled cDNA probe of the full length human p50 cDNA [11,21] by a standard plaque hybridization method. Eight discrete clones with overlapping genomic DNA inserts were isolated. One of these, VF4 (Fig. 1A), contained the 5P-end and all the exon^intron sequences of the POLD2
0167-4781 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 0 0 ) 0 0 1 5 3 - 6
BBAEXP 91442 28-8-00
232
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
Fig. 1. (A) Structure of the POLD2 gene. The clone VF4 is represented as horizontal line at the bottom. The 11 exons (1^11), 10 introns and 5P-£anking region of the POLD2 gene are shown to scale at the top. The closed boxes represent the coding exons and the open boxes 5P- and 3P-UTRs. The initiation (ATG) and stop (TGA) codons are indicated. The positions of some restriction sites are shown: Bg, BglII; E, EcoRI; B, BamHI ; N, NotI. (B) Sequence of the 5P-upstream region of the POLD2 gene. The ATG translation start codon is boxed. The transcription start site is shown and denoted `+1'. The putative binding sites for regulatory elements are boxed with the site or factor symbols above the sequence. The sequences of the 5P-upstream region and the ¢rst exon are shown in capital letters, and the sequence of the ¢rst intron is shown in lower case letters. The cDNA sequence corresponding to the ¢rst exon and part of the second exon is underlined. The GenBank accession number is AF185279.
gene. The rest of the clones overlapped each other and contain sequences from exon 2 to the 3P-end of the POLD2 gene. The clone VF4 (Fig. 1A) was subjected to restriction digestion with BglII and EcoRI and the fragments were subcloned into pBluescript II KS (Stratagene) for DNA sequence analysis. A 3.2 kb BglII fragment that comprised about 2.4 kb of the promoter plus exon 1, as well as 0.8 kb of the ¢rst intron was isolated. This 3.2 kb fragment was completely sequenced in both orientations. The transcription initiation site of the human POLD2 gene was determined by both primer extension and 5P-RACE studies using total RNA from HeLa cells. Prim-
er extension analysis was performed with the antisense primer GSP3 (Table 1). Several elongation products were detected (Fig. 2A), possibly due to premature termination of transcription because of the secondary structure of mRNA. The sizes of the major extension products were 139 and 110 nucleotides long. The size of the longest extension product (139 nt) indicated that transcription is initiated from 93 bp upstream of the translation start site. The results from the primer extension experiments were con¢rmed by 5P-RACE studies using the gene-speci¢c primers GSP1, GSP2, GSP3 and the anchor primers AP,
Table 1 Oligonucleotide primers Primer
Sequence
Strand
Assay
GSP1 GSP2 GSP3 PD50 F1 R2 F2 F3 R3 F4 R4 3PP50 AP AUAP
5P-ACACAGCACTTCTCCTCAGGC-3P 5P-GTTGGCTGATGGTGGGGACA-3P 5P-GGACAGTAGAGTGTGGGCCC-3P 5P-CAGGAGTGTGGCCATGTTTTCTGAG-3P 5P-TGTGTGGTGGGCACTCTGTTC-3P 5P-GGGAGCAAGGTCAGCAAAGC-3P 5P-GCTTTGCTGACCTTGCTCC-3P 5P-TGATGCCAGGCGAGTTTG-3P 5P-AACTCGCCTGGCATCACGTC-3P 5P-CCCGGACACTCTAGGTTGTTAC-3P 5P-GGTCCACTCCAGGATCTCCAA-3P 5P-CGCATCAGCAAGTGCCAGGCTTTA-3P 5P-ACTAGCGGCCGCGTCGACTAGTG-3P 5P-ACTAGCGGCCGCGTCGACTAGT-3P
Antisense Antisense Antisense Sense Sense Antisense Sense Sense Antisense Sense Antisense Antisense Sense Sense
RC, Ex-Int RC RC, PE Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Seq, Ex-Int Ex-Int 10 RC RC
3, Seq
2 4 5, 5, 8, 6, 9, 8,
6 6 9 7 10 9
Ex-Int, primers for exon^intron splicing junction ; PE, primer extension ; Seq, sequencing of POLD2 subclones ; RC, rapid ampli¢cation of cDNA 5P-ends (5P-RACE).
BBAEXP 91442 28-8-00
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
233
Fig. 2. Mapping of exon 1 and determination of transcription initiation site. (A) Mapping of the transcription start site by primer extension analysis. Primer extension was performed by standard methods [33]. Primer GSP3 (Table 1) complementary to the POLD2 mRNA was end-labeled with [Q-32 P]ATP and then annealed to 10 Wg of total HeLa cell RNA at 55³C for 90 min. Yeast tRNA was used as control for extension speci¢city. Reverse transcription was performed with SuperScript reverse transcriptase (Life Technologies, Inc.) at 42³C for 60 min. The extension products were run on 7% sequencing gels along with 32 P-labeled HaeIII-digested PX174 DNA. Lane 1, primer extension with yeast tRNA as control ; lane 2, with total RNA from HeLa cells. The position of the transcription start site (+1) is indicated by the arrow. (B) Determination of the POLD2 transcription initiation site by the 5P-RACE method. The positions of the ¢ve primers and the PCR fragment obtained in this experiment are as shown. Total HeLa cell RNA (1 Wg) was annealed with a gene-speci¢c oligonucleotide (GSP1, Table 1) corresponding to the 3P-end of the third exon. Sequential PCR ampli¢cation was performed using primers AP, GSP2, AUAP, and GSP3 (Table 1). The ¢rst PCR ampli¢cation, using the pair of primers AP and GSP2, was performed under the following conditions: 94³C for 1 min, 55³C for 30 s, and 72³C for 1 min, for a total of 35 cycles. The ¢rst PCR product was diluted 1:100 and was then subjected to a second PCR ampli¢cation with the primers AUAP and GSP3 under the same PCR conditions. The ¢nal PCR product was directly cloned into the PCR-II vector using a TA cloning kit (Invitrogen) for sequence analysis. M, molecular size markers in bp; lane 1 and lane 2, 5P-RACE product from HeLa RNA.
exon^intron boundary, so that the ¢rst intron is located 56 bp upstream of the translation start site. The structural map of the POLD2 gene for the small subunit of Pol N was determined by a combination of restriction enzyme digestion, Southern blot hybridization, PCR analysis and DNA sequencing. The POLD2 gene is
and AUAP (Table 1, Fig. 2B). A single transcript of 167 bp was obtained. This result indicates that transcription is initiated from 93 bp upstream of the translation start site, in complete agreement with the results of the primer extension analysis. This position of the transcription start site gives it a location 37 bp upstream of the ¢rst Table 2 Analysis of exon^intron splice junctions of the POLD2 gene . No. 1 2 3 4 5 6 7 8 9 10 11
Intron
Exon
Intron
Position
Exon size (bp)
Intron size
gttttcgcag cgtgtcccag tgcattccag tgctccccag tctcccgcag tctattccag tgccttccag tgccttgcag tctcctccag ttctttgcag
GGCGCGCGGGTGCGCCGCGGG TGAACCTCCTTCAGCACTGGG GCAGTGGAGTTCAGCGAGGAG CACAACCTGCTCTGGTTACGG GGACTGTCCTTACACAGATAG GTTTGTGCTATTATCAATAAG GCCAAATACCTGCAGCTGAGC GCCTCAGTGCTATGGAGTCAG ATTTTTGGGGTGACACTCTAG GTTGTTACCCTATCATCCGAG GTCCTGAGGATTGCTGATGCG
gtgagtgggg gtaagtgaga gtgaggcagg gtagggagcc gtgagcagca gtatggagcc gtgagcgagc gtagctggca gtaacaggct gtaatttttg
394^357 356^210 211^332 333^456 457^571 572^770 771^851 852^1009 1010^1137 1138^1239 1240^1497
37 276 122 124 115 199 81 158 128 102 258
1.4 kb 3.8 kb 200 kb 370 bp 117 bp 306 bp 157 bp 221 bp 369 bp 349 bp
Exon and intron sequences were determined by sequence analysis. Intron 1 interrupts the 5P-UTR of the gene 56 bp upstream of the ATG start codon. Intron sizes were determined by a combination of sequencing (intron 1), PCR ampli¢cation of genomic clones using cDNA primers, and restriction digest analysis of genomic clones. The complete coding sequence of human POLD2 cDNA has been published previously [21]. The exon^intron boundaries for exon 1 were sequenced from the VF4 clone. The remaining exons were sequenced after PCR ampli¢cation, using di¡erent primer combinations (Table 1), of the VF4 clone and the mRNA for POLD2. The sizes of the introns were determined by sequencing, PCR ampli¢cation and/or restriction mapping. The GenBank accession number for the complete POLD2 gene sequence is AF239710. Nucleotide position +1 is assigned to the A residue of the ATG translation start site.
BBAEXP 91442 28-8-00
234
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
approximately 10 kb in length and consists of 11 exons interrupted by 10 introns. The exon sequences closely match the published cDNA sequence [21], and all splice acceptor and donor sequences match the 5P-AG/GT-3P splicing junction consensus sequence (Table 2) [22,23]. The ¢rst exon, with a length of 37 bp, contains only the 5P-untranslated region (UTR) of the mRNA. The ATG start codon is found 56 bp downstream from the intron 1^exon 2 boundary (Fig. 1B). Therefore, exons 2^11 provide the coding information for this gene. Introns 1 and 2 of POLD2 were the longest of the 10 introns present, with estimated lengths of approximately 1.4 and 3.7 kb, respectively (Table 2). The sequences of the coding regions are identical to those reported for the human POLD2 cDNA [21]. The only di¡erence is in the length of the 5P-UTR. As shown below, the 5P-end of human POLD2 cDNA is 16 bp longer (Fig. 1B) than that reported for the cDNA [21]. The entire 3.2 kb BglII genomic fragment of DNA inserted into pBluescript II KS plasmid was sequenced to obtain the 5P-£anking sequence of the POLD2 gene (Fig. 1B). This clone contains exon 1, part of intron 1, and about 2.4 kb of 5P-£anking sequence. Analysis of the sequence immediately upstream of the transcription start site showed that it lacks a consensus TATA box, as has been observed for the promoters of many mammalian housekeeping genes [24]. However, the absence of a TATA box in this promoter is typical of genes encoding several other S-phase-speci¢c enzymes, including those for Pols K, N and O [25^28]. The TRANSFAC [29] program (http://transfac.gbf.de/ TRANSFAC) was used for the identi¢cation of putative consensus elements and potential transcription factor binding sites in the 5P-regulatory region of POLD2. Several binding motifs for transcription factors were observed in this promoter region. These motifs include binding sites for the transcription factors Sp1 (GC box), activator protein 1 and 2 (AP1 and AP2), nuclear factor-1 (NF-1), cAMP response element binding protein (CREB) and NF-Y (CCAAT box) (Fig. 1B, Table 3). Their possible
functions remain to be tested. However, the presence of consensus binding sites for transcription factors Sp1, NFY and AP-1 in the putative promoter of POLD2 is consistent with S-phase-speci¢c expression, and suggests similar transcriptional regulation as the genes for the replicative Pols K, N and O. The transcription factors Sp1 and E2F have been found to play central roles in the modulation of such genes [30], as appears to be the case for Pols K, O and N (POLD1) [26,28,31]. In this regard, it may be noted that cotransfection studies in Drosophila SL2 cells showed that both Sp1 and Sp3 but not Sp2 could activate the POLD1 promoter [31]. Of special interest is the observation that the POLD2 promoter has three Sp1 consensus sites near the transcription start site. This makes sense as the expression of both the catalytic and small subunit of polymerase N has to be coordinately regulated. A 2.4 kb fragment of the POLD2 gene that included 2.2 kb of the promoter region, exon 1 and 800 bp of intron 1 was excised from the 3.2 kb plasmid using KpnI and SacI restriction sites and inserted 5P to the pCATBasic reporter plasmid (Promega). This construct, (pCAT2.2) along with its deletion mutant pCAT800 (Fig. 3), which contains an 800 bp fragment upstream of the ¢rst exon, and pCATBasic (with no insert as a negative control) were transfected into COS-7 cells. The transfection e¤ciency was normalized by co-transfection of a L-galactosidase plasmid driven by the SV40 promoter. Fig. 3A shows that the 2.2 kb POLD2 DNA could promote the expression of the chloramphenicol acetyltransferase (CAT) gene. The expression driven by the POLD2 fragment was about 60% of the SV40 early promoter. The low level of CAT conversion detected in the lysates of cells transfected with the pCATBasic plasmid is most likely due to an enhancer element present in this vector. Deletion of the promoter region to 800 bp upstream of the ¢rst exon resulted in a dramatic loss of promoter activity in COS-7 cells as shown by comparison of the construct pCAT2.2 with the pCAT800 construct (Fig. 3B). These results demonstrate that this region of the POLD2 gene could act as a functional regulatory
Table 3 Putative regulatory elements found in the 5P £anking region of POLD2 Element
Position
Sequence
Reference
NF-1 CREB
3337 to 3320 3330 to 3319 3256 to 3247 398 to 377 3328 to 3318 3298 to 3287 396 to 376 3117 to 3106 3195 to 3182 352 to 340 312 to +1 380 to 363
gtcTGGCggggtgacgac ggggTGACgacc gggcTGACgggg (3) ctggTGACggac ggTGACgacca ccTGACggggt ggTGACggacg atCCCGccgacc (3) gcggGGCGggggc (3) gatgGGCGgggaa gatgGGCGgggcag acCAATcgctgccctcct
[36] [37]
AP-1
AP-2 Sp1
CAAT
[38]
[39] [30]
[40]
A region of 340 bp upstream from the transcription initiation site (GenBank accession number is AF185279) was analyzed for potential transcription factor binding sites using the TRANSFAC [29] program. Only core sequences showing perfect matches to consensus transcription factor binding sites are listed (upper-case letters). (3) denotes the presence of the element on the cDNA strand.
BBAEXP 91442 28-8-00
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
235
POLD2 promoter that enhance the expression of this gene. Studies of the expression of genes involved in nucleotide metabolism and DNA synthesis have revealed the presence of multiple regulatory elements including GC boxes, which are required for maximal promoter activity [30,32]. Several potential transcription factor binding sites were found upstream of the region used to create the pCAT800 deletion construct (Fig. 1B). These include two Sp1 binding sites and three AP1 binding sites. Further analysis is needed for identi¢cation of the sequences in this region of the promoter that might in£uence the expression of the POLD2 gene in COS-7 cells. Taken together, these data indicate that the 2.2 kb 5P-£anking DNA of POLD2 contains a functional promoter. The authors wish to thank Drs. Heng Xu and Li Liu for help with the sequence analysis and Dr. Baoqing Li for critical reading of the manuscript. This work was supported by a National Institutes of Health Grant GM31973 and a grant from the National Institute of Environmental Health Sciences, ES07634. A preliminary account of this work was presented at the Eukaryotic DNA Replication Meeting in Cold Spring Harbor, NY, 1997.
Fig. 3. Functional activity of the POLD2 regulatory regions. pSV40 plasmid contains the SV40 early promoter and was used as a positive control. pCAT3Basic (Promega) contains no promoter and was used as the background control and to generate CAT reporter gene constructs. p3Kb was generated by cloning a 3.2 kb BglII fragment from phage clone VF4 into pBluescript II KS (Stratagene) digested with BamHI and dephosphorylated with CIP. pCAT2.2 was generated by cloning a 3.2 kb KpnI^SacI fragment from p3Kb into the KpnI^SacI cloning site of pCAT3Basic, such that POLD2 promoter directs transcription from the CAT gene. pCAT2.2 contained 2.2 kb of the promoter region, exon 1 and 800 bp of intron 1. A 5P deletion mutant of the POLD2 regulatory region (pCAT800) was made by excision of the 800 bp BssHII fragment (nucleotides 3809 to +2) from plasmid pCAT2.2 and insertion into the pCATBasic plasmid. COS-7 cells maintained in Dulbecco's modi¢ed Eagle's medium (Life Technologies, Inc.) plus 10% fetal bovine serum were plated at 40^50% con£uence for transfection using the calcium phosphate procedure [34]. The amounts of reporter constructs used in transfection experiments are as indicated. All the assays were performed in the presence of 2 Wg of a L-galactosidase expression plasmid (pSV L-gal, Promega). This was used as an internal control to normalize for variations in transfection e¤ciency. The total amount of DNA in each transfection was standardized to 20 Wg using carrier DNA (pBluescript). After 20 h incubation with calcium phosphate-precipitated DNA, the cells were washed with medium before incubation for an additional 20^ 24 h. Cellular extracts were prepared and normalized for L-galactosidase activity as previously described [35]. Generally, CAT assays contained extracts corresponding to 10 U of L-galactosidase. The CAT activity was quanti¢ed by scintillation counting. All results were statistically signi¢cant at P 6 0.01 using Student's unpaired t-test.
region that contains the necessary cis-acting elements for driving the expression of this gene in COS-7 cells. At the same time, these results clearly indicate the existence of regulatory element(s) within the distal region of the
References [1] L. Liu, J. Mo, E. Rodriguez-Belmonte, M.Y.W.T. Lee, J. Biol. Chem. 275 (2000) 18739^18744. [2] X.R. Zeng, Y. Jiang, S.J. Zhang, H. Hao, M.Y.W.T. Lee, J. Biol. Chem. 269 (1994) 13748^13751. [3] P.E. Gibbs, W.G. McGregor, V.M. Maher, P. Nisson, C.W. Lawrence, Proc. Natl. Acad. Sci. USA 95 (1998) 6876^6880. [4] R.E. Johnson, S. Prakash, L. Prakash, J. Biol. Chem. 274 (1999) 15975^15977. [5] F.S. Sharief, P.J. Vojta, P.A. Ropp, W.C. Copeland, Genomics 59 (1999) 90^96. [6] S. Waga, B. Stillman, Nature 369 (1994) 207^212. [7] A. Sugino, Trends Biochem. Sci. 20 (1995) 319^323. [8] R. Hindges, U. Hu«bscher, Biol. Chem. 378 (1997) 345^362. [9] J.J. Byrnes, K.M. Downey, V.L. Black, A.G. So, Biochemistry 15 (1976) 2817^2823. [10] M.Y.W.T. Lee, C.K. Tan, K.M. Downey, A.G. So, Biochemistry 23 (1984) 1906^1913. [11] J.Q. Zhou, H. He, C.K. Tan, K.M. Downey, A.G. So, Nucleic Acids Res. 25 (1997) 1094^1099. [12] Y. Sun, Y. Jiang, P. Zhang, S.J. Zhang, Y. Zhou, B.Q. Li, N.L. Toomey, M.Y.W.T. Lee, J. Biol. Chem. 272 (1997) 13013^13018. [13] S.L. Dresler, K.S. Kimbro, Biochemistry 26 (1987) 2664^2668. [14] C. Nishida, P. Reinhard, S. Linn, J. Biol. Chem. 263 (1998) 501^510. [15] R.A. Hammond, J.K. McClung, M.R. Miller, Biochemistry 29 (1990) 286^291. [16] K.K. Shivji, M.K. Kenny, R.D. Wood, Cell 69 (1992) 367^374. [17] A. Morrison, A.L. Johnson, L.H. Johnston, A. Sugino, EMBO J. 12 (1993) 1467^1473. [18] S.A. MacNeill, S. Moreno, N. Reynolds, P. Nurse, P.A. Fantes, EMBO J. 15 (1996) 4613^4628. [19] S. Zuo, E. Gibbs, Z. Kelven, T.S.-F. Wang, M. O'Donnell, M. MacNeill, J. Hurwitz, Proc. Natl. Acad. Sci. USA 94 (1997) 11244^11249. [20] P. Zhang, J. Mo, A. Perez, A. Leon, L. Liu, N. Mazloum, H. Xu, M.Y.W.T. Lee, J. Biol. Chem. 274 (1999) 26647^26653.
BBAEXP 91442 28-8-00
236
A. Perez et al. / Biochimica et Biophysica Acta 1493 (2000) 231^236
[21] J. Zhang, C.K. Tan, B. McMullin, K.M. Downey, A.G. So, Genomics 29 (1995) 179^186. [22] S.M. Mount, Nucleic Acids Res. 10 (1982) 459^472. [23] Y. Oshima, Y. Gotoh, J. Mol. Biol. 186 (1987) 43^51. [24] J.C. Azizkhan, D.E. Jenson, A.J. Pierce, M. Wade, Crit. Rev. Eukaryotic Gene Expr. 3 (1993) 229^254. [25] L.F. Johnson, Curr. Opin. Cell Biol. 4 (1992) 149^154. [26] B.E. Pearson, H.P. Nasheuer, T.S.F. Wang, Mol. Cell. Biol. 11 (1991) 2081^2095. [27] L.S. Chang, L. Zhao, L. Zhu, M.L. Chen, M.Y.W.T. Lee, Genomics 28 (1995) 411^419. [28] D. Huang, H. Pospiech, T. Kesti, J. Syva«oja, Biochem. J. 339 (1999) 657^665. [29] T. Heinemeyer, E. Wingender, I. Reuter, H. Hermjakob, A.E. Kel, O.V. Kel, E.V. Ignatieva, E.A. Aranko, O.A. Podkolodnaya, F.A. Kolpakov, N.L. Podkolodny, N.A. Kolchanov, Nucleic Acids Res. 26 (1998) 362^367. [30] J.E. Slansky, P.J. Farnham, BioEssays 18 (1996) 55^62.
[31] L. Zhao, L.S. Chang, J. Biol. Chem. 272 (1997) 4869^4882. [32] S. Delgado, M. Gomez, A. Bird, F. Anteqera, EMBO J. 17 (1998) 2426^2435. [33] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning : A Laboratory Manual, 2nd edn., Cold Spring Harbor Press, Cold Spring Harbor, NY, 1989, pp. 7.79^7.83. [34] V. Kumar, S. Green, A. Staub, P. Chambon, Proc. Natl. Acad. Sci. USA 86 (1986) 5310^5314. [35] M. Petkovich, N.J. Brand, A. Krust, P. Chambon, Nature 330 (1987) 444^450. [36] R.M. Gronostajski, S. Adhya, K. Nagata, R.A. Guggenheimer, J. Hurwitz, Mol. Cell. Biol. 5 (1985) 964^971. [37] M.R. Montminy, L.M. Bilezikjian, Nature 328 (1987) 175^178. [38] V.J. Foletta, Immunol. Cell Biol. 74 (1996) 121^133. [39] Y.X. Zeng, K. Somasundaram, W.S. el-Deiry, Nature Genet. 15 (1997) 78^82. [40] N.C. Jones, P.W.J. Rigby, E.B. Zi¡, Genes Dev. 2 (1988) 267^281.
BBAEXP 91442 28-8-00