- Email: [email protected]
Characterization of the bombesin-like peptide receptor family in primates
Genomics 84 (2004) 139 – 146 www.elsevier.com/locate/ygeno
Characterization of the bombesin-like peptide receptor family in primates Hideki Sano, a,b Scott D. Feighner, a Donna L. Hreniuk, a Hisashi Iwaasa, b Andreas W. Sailer, a Jie Pan, a Marc L. Reitman, a Akio Kanatani, b Andrew D. Howard, a and Carina P. Tan a,* a
Department of Metabolic Disorders, Merck Research Laboratories, P.O. Box 2000, Rahway, NJ 07065, USA b Banyu-Tsukuba Research Institute, Okubo 3, Tsukuba, Ibaraki 300-2611, Japan Received 9 September 2003; accepted 23 January 2004 Available online 14 March 2004
Abstract In mammals, bombesin-like peptides mediate a broad range of physiological functions through binding to three highly conserved G-protein-coupled receptors: the neuromedin B-preferring, the gastrin-releasing peptide-preferring, and the bombesin-receptor subtype 3. Selective modulation of these receptors presents opportunities for the development of novel therapeutics. To ascertain if rhesus monkey could serve as a surrogate animal model for the development of modulators of bombesin-like receptor function, we undertook a search for additional receptor family members and studied the expression profiles of the three known bombesin-related receptors. We found no evidence for additional receptor family members in mammals, suggesting that the expression of the previously described bombesin-receptor subtype 4 is limited to amphibians. We studied the distribution of the three receptors in a broad array of human and rhesus monkey tissues. Based on the similarity between the human and the rhesus expression profiles, we conclude that the rhesus monkey may be a suitable animal model to evaluate the clinical efficacy and potential side effects of bombesin-like peptide ligands. D 2004 Elsevier Inc. All rights reserved.
Bombesin is a 14-amino-acid peptide first isolated from the skin of the European frog Bombina bombina in 1971 [1,2]. A large number of bombesin-like peptides have been found in amphibians and mammals and are grouped into three subfamilies based on the C-terminal tripeptide. The mammalian bombesin-like peptides are gastrin-releasing peptide (GRP), neuromedin C (GRP20-29) [3], and neuromedin B (NMB). The bombesin-like peptides have been shown to modulate smooth muscle contraction [4] as well as exocrine and endocrine secretions of gastrointestinal tissues, pancreas, and pituitary. In addition these peptides have a central effect on behavior, food intake, hyperglycemia [5], and hypothermia [6] and act as growth factors in vitro [7]. There are three known mammalian receptors activated by bombesin-like peptides: the NMB-preferring receptor (NMBR), the GRP-preferring receptor (GRPR), and bombesin-receptor subtype 3 (BRS3). The natural ligand for BRS3 is unknown. A fourth bombesin receptor, bomb* Corresponding author. Fax: (732) 594-6708. E-mail address: [email protected] (C.P. Tan). 0888-7543/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.ygeno.2004.01.008
esin-receptor subtype 4 (BB4R), has been cloned from amphibians [8,9]. In rhesus, a partial sequence has been reported [10], suggesting the possibility that a fourth functional receptor is present in mammals. Bombesin-like peptide receptors have attracted attention as targets of therapeutic drugs [11 –17]. Bombesin/ GRP receptor antagonists have been under clinical development as anti-cancer agents [18]. Bombesin and bombesin-like peptides have effects on energy homeostasis, reducing food intake in mammals, including humans [12 – 14]. BRS3-deficient mice exhibit a delayed-onset obese phenotype with increased food intake and decreased energy expenditure [19]. Therefore, endogenous or synthetic ligands for bombesin-like peptide receptors are potential therapeutic drugs for the treatment of obesity. In the process of drug development, the potency and clinical safety of potential human therapeutics are often profiled in rhesus monkey. Here we examine the distribution pattern of the three bombesin-like peptide receptors in human and rhesus tissues and describe our efforts to identify additional bombesin-receptor family members.
140
H. Sano et al. / Genomics 84 (2004) 139–146
Results and discussion Search for mammalian BB4R RT-PCR and genomic PCR were conducted on rhesus, Xenopus, and human brain cDNA or genomic DNA using primers for the reported rhesus BB4R DNA fragment [10]. The primers were almost perfectly conserved with the Bombina BB4R DNA sequence. Unexpectedly, an amplified fragment from Xenopus cDNA and genomic DNA that perfectly matched the partial rhesus BB4R sequence [10] was found. Attempts to detect the partial rhesus BB4R by RTPCR using human and rhesus mRNA samples were not successful. These results suggest that the partial rhesus BB4R sequence cited in [10] was incorrectly identified as a rhesus clone and may have originated from the frog Xenopus. To extend these results and determine if there were mammalian orthologs of the BB4R, we performed an interspecies Southern blot analysis representing the genomic DNA from multiple mammalian species (human, monkey, pig, cow, dog, ferret, rabbit, rat, mouse, guinea pig) and Xenopus (Fig. 1). This blot was hybridized with a Xenopus BB4R open-reading frame (ORF) probe at low stringency and washed at low stringency to identify any related DNA regions in the species represented. The Xenopus BB4R ORF cDNA was also cloned, expressed, and characterized by functional and binding assays. The Xenopus BB4R protein is 83% identical to the Bombina BB4R and has a similar pharmacological profile (data not shown). As shown in Fig. 1, Xenopus genomic DNA contained a strongly hybridizing fragment. DNA samples from other species had hybridizing bands at reduced intensity, which were all attributed to the detection of the most related
known gene (BRS3) through reprobing of the same blot. A search of the human and mouse genome database with the Xenopus BB4R sequence confirmed that BRS3 is the most related sequence in these mammalian species. Taken together, the above results suggest that there is no detectable mammalian ortholog for frog BB4. Identification and characterization of rhesus BRS3 To isolate rhesus BRS3 cDNA (GenBank AY350447), RT-PCR was carried out using human BRS3 primers. The 1.3-kb amplification product encoded a putative protein of 398 amino acids with a deduced amino acid sequence that was 95% identical to human BRS3 (Fig. 2). PCR amplification using rhesus genomic DNA produced a 4-kb fragment that was cloned and sequenced. The rhesus BRS3 gene is contained on three exons, as observed in other mammals (human, mouse, rat, guinea pig, sheep) [20 –25]. In addition, we isolated partial sequences of rhesus NMBR (GenBank AY350448) and GRPR (GenBank AY350449). Rhesus NMBR and GRPR exhibit strong sequence conservation with their human orthologs (protein sequence identities: 96 and 94%). In a previous report, a drastic difference in potency of the synthetic bombesin receptor panagonist [DTyr6, B-Ala11, Phe13, Nle14] Bombesin (6-14) (dY-bombesin) to rat and human BRS3 was attributed to sequence variation in the third extracellular loop [23]. The amino acid sequence of rhesus BRS3 corresponding to the predicted third extracellular loop domain is identical to that of human BRS3. Therefore dY-bombesin is expected to display a similar potency for both human and rhesus BRS3. To confirm that prediction, calcium mobilization was measured by an aequorin-based assay with HEK293 cells transiently expressing rhesus or human BRS3 cDNA (Fig. 3). dYbombesin stimulated calcium mobilization in a dose-dependent manner with similar EC50 values for rhesus BRS3 (5.6 nM) and human BRS3 (4.3 nM). In contrast, the EC50 value of rat BRS3 (2 AM) [23] was about 1000-fold weaker than those of human and rhesus BRS3. These results suggest that the pharmacological profile of the rhesus BRS3 is similar to that of human BRS3. Expression profile of human bombesin-like peptide receptors
Fig. 1. Multiple-species Southern zoo blot containing 10 Ag of EcoRIdigested genomic DNA samples from human, monkey, Xenopus, pig, cow, dog, ferret, rabbit, rat, mouse, and guinea pig was probed with Xenopus BB4 PCR-generated ORF probe.
Next we surveyed NMBR, GRPR, and BRS-3 in normal mammalian tissues to complement the receptor profiles in human cancer cell lines and tumor tissues [26 – 33]. Using real-time PCR (TaqMan), we found NMBR gene expression in a broad range of brain regions (amygdala, caudate nucleus, corpus callosum, hippocampus, hypothalamus, thalamus, brain stem, spinal cord), testis, and stomach (Fig. 4, top), similar to the mRNA receptor distribution reported in rats and mice [21,34 – 37]. We did not detect NMBR in human intestine or uterus, in contrast to a mouse study [21]. GRPR mRNA was preferentially expressed in
H. Sano et al. / Genomics 84 (2004) 139–146
141
Fig. 2. Alignment of amino acid sequences of BRS3 using the AlignX program of the Vector NTI Bioinformatics suite (Informax, Frederick, MD, USA). Predicted transmembrane domains are underlined. The predicted third extracellular loop is shaded gray.
142
H. Sano et al. / Genomics 84 (2004) 139–146
Fig. 3. Release of intracellular calcium measured by dose – response curves of aequorin bioluminescence induced in HEK293-AEQ17 cells by dYbombesin; n = 3.
pancreas, with weak expression detected in the stomach (Fig. 4, middle). Unlike NMBR and BRS3, GRPR was expressed in the brain at very weak or basal levels. These results are consistent with the previous two reports from Xiao et al. [38] and Spindel et al. [39]. TaqMan analysis revealed that BRS3 is preferentially expressed in human hypothalamus, which is in agreement with previous reports in rat, mouse, and sheep [21 – 23,25,40] (Fig. 4, bottom). This result suggests that BRS3 could be involved in the regulation of feeding behavior in several mammalian species. In addition to the hypothalamus, BRS3 expression was weakly detected in several other brain areas, including amygdala, caudate nucleus, corpus callosum, and hippocampus. BRS3 mRNA was also localized in the pituitary gland, one of the major sites where hormones regulating energy homeostasis are secreted. In sheep, BRS3 is also expressed in the pituitary gland [25]. In peripheral tissues, BRS3 was strongly expressed in human testis, and weaker expression was noted in fetal kidney, ovary, pancreas, and thyroid.
Fig. 4. Expression of bombesin-like peptide receptor mRNAs in various human tissues. mRNA profiles for NMBR, GRPR, and BRS3 in human are shown. Data were normalized to h-actin mRNA expression levels.
H. Sano et al. / Genomics 84 (2004) 139–146
Expression profile of rhesus bombesin-like peptide receptors We conducted a limited rhesus tissue survey to complement the human expression data. Rhesus NMBR was preferentially expressed in specific brain areas, including pons, medulla oblongata, and hypothalamus (Fig. 5, top). Weak or basal expression was observed in the cerebellum, pituitary gland, liver, and testis (Fig. 5, bottom). The preferential expression of BRS3 was observed in rhesus hypothalamus and testis as observed in human tissues. However, in rhesus we detected a higher level of BRS3 expression in the pons and medulla oblongata. In summary, we have shown that mammals do not possess an ortholog corresponding to the amphibian BB4R. Human and rhesus BRS3 appear similar in pharmacology based on equivalent activation potencies with the prototypical agonist dY-bombesin. The expression patterns of NMBR and BRS3 in rhesus are similar to those found in humans. In particular, BRS3 expression in the hypothalamus is supportive of its
143
possible function in feeding behavior and energy homeostasis. Rhesus monkey may be an appropriate animal model for evaluation of bombesin-like peptide receptor ligands.
Material and methods Poly(A)+ mRNA and genomic DNA isolation Poly(A)+ mRNAs were isolated from rhesus hypothalamus, cerebellum, pituitary gland, pons, medulla oblongata, liver, brain (except for hypothalamus, cerebellum, pituitary gland, pons, medulla oblongata), liver, and testis using FastTrack 2.0 (Invitrogen, Carlsbad, CA, USA). Genomic DNA was purified from rhesus liver and Xenopus laevis brain. Human poly(A)+ RNAs and genomic DNA were purchased from Clontech (Palo Alto, CA, USA). Genomic and RT-PCR for BB4R Primers were based on a rhesus BB4 partial sequence [10] and had high homology to Bombina BB4R: primer 51f (5V-CGTGCGGCAAAGCTGTTTGTGTTTGG-3V) and primer 172R (5V-CATCAGCGAATGTGTCTCTTGCAG3V). PCR was carried out on Xenopus, rhesus, and human whole brain cDNA and genomic DNA on each of the species using the Advantage 2 PCR kit (Clontech). Firststrand cDNA was transcribed from the mRNA using Superscript II RT (Invitrogen). cDNA prepared as described above or 400 ng of sheared genomic DNA was used. PCR fragments were cloned into the TA vector (Invitrogen) and sequenced on ABI’s 377 sequencer using BigDye (Applied Biosystems) terminator technology. Xenopus genomic BAC library screen
Fig. 5. Expression of bombesin-like peptide receptor mRNAs. mRNA profiles in rhesus monkey are shown. Data were normalized for h-actin mRNA expression levels. ‘‘Partial brain’’ means the portion of whole brain except for hypothalamus, cerebellum, pituitary gland, pons, and medulla oblongata.
High-density membranes from ResGen (Huntsville, AL, USA) were hybridized with the Xenopus BB4 PCR-generated ORF probe. Hybridization conditions were 50% formamide, 10% dextran sulfate, 4 Denhardt’s solution, 5 SSPE, 0.1% SDS, 30 Ag/ml sheared salmon sperm DNA at 32jC overnight. The probe was labeled by random-primed (Prime-It II; Stratagene, Palo Alto, CA, USA) incorporation of [a-32P]dCTP (Amersham Biosciences, Amersham, UK) to a specific activity of greater than 109 dpm/Ag. The filters were washed to high stringency at 0.1 SSC, 0.1% SDS, 65jC, and exposed to film (XOmat, Kodak, Rochester, NY, USA). Positions of positive duplicate clones were determined. BAC stab cultures were obtained and grown up per the manufacturer’s instructions. The hybridizing region of the BAC DNA was determined by DNA restriction and subsequent Southern blotting. The fragments of interest were cloned and sequenced.
144
H. Sano et al. / Genomics 84 (2004) 139–146
Genomic Southern analysis
Table 2 Oligonucleotides and TaqMan fluorogenic probes
Southern blots were run with genomic DNA from various species. Genomic DNA was prepared from ferret, guinea pig, hamster, and Xenopus by the Bradley Lab Rapid Method. Human, monkey, pig, cow, dog, rabbit, rat, and mouse genomic DNAs were purchased from Clontech Laboratories. Ten micrograms of DNA per species was digested with EcoRI, ethanol precipitated, and electrophoresed on 0.7% agarose, 0.5 TBE. The gel was denatured, neutralized, and transferred onto Nytran Plus membrane (Schleicher and Schuell, Dassel, Germany) by overnight wicking in 20 SSC. DNA was UV-cross-linked onto the membrane. The Southern blots were hybridized as described under the library screen method above.
Gene
Cloning of rhesus bombesin-like peptide receptors cDNAs were synthesized from rhesus hypothalamus mRNA using the SuperScript First-Strand Synthesis System (Invitrogen) with oligo(dT) priming. Based on nucleotide sequences of human GRPR, NMBR, and BRS3, three pairs of primers were synthesized (Table 1). Using the hypothalamus cDNAs for isolation of NMBR and BRS3 or rhesus genomic DNA for that of GRPR as a template, PCRs were carried out and the products were cloned into pCR4-TOPO (Invitrogen). Seven clones were randomly picked from each independent reaction and were subjected to sequence analysis. Using one of the clones whose sequence exactly matched the consensus sequence of rhesus BRS3, PCR was carried out to optimize the Kozak sequence with a pair of primers (forward, ATGGGATCCGCCACCATGGCTCAAAGGCAGCCTCACTCACCT; reverse, ATGCTCGAGTGGAAAGCTAGACTCTATCCTCTGCCTGC) and the amplified products were cloned into the BamHI and EcoRI site of pcDNA3.1/Hyg (+) (Invitrogen) for mammalian expression. The PCR products were verified by sequencing. Real-time RT-PCR First-strand cDNA was synthesized from 1 Ag of total RNA for rhesus and mRNA for human in a 50-Al reaction volume using TaqMan reverse transcription reagents (Applied Biosystems, Foster City, CA, USA). At the same time,
Table 1 Pairs of oligonucleotide primers for cloning Gene
Primer Sequence 5V – 3V
Rhesus GRPR Rhesus NMBR Rhesus BRS3
F R F R F R
ACTGTTTCCTTCTGAACTTGG A AGCAGGTCTCCCAAAGCCAG GTGGGCTTGCTGGGCAACATCATGC GGTATGTTCATTGTATTCTCCAGGAAGATTG TTGGACGTGACAATCACTGTATTTGAACTGAGA TGTTTCTCCTCCCAGCATGTGTATCCG
GenBank accession No.
Human M73481 GRPR
Primer Sequence 5V – 3V
F R FAM Human NM_002511 F NMBR R FAM Human L08893 F BRS3 R FAM Rhesus F NMBR R FAM Rhesus F BRS3 R FAM RhesusF h-actin R VIC
TGCTGCTGGCCATTCCA AGGTCTGGTTGGTGCTTTCCT CCGTGTTTTCTGACCTCCATCCCTTCC GGATGACAGGGATCAGTTTGC ACGCCTCGCGCTACTTCTT CCCACCTTGCCAAACATCCACTCGT GGCAGTTGTGAAGCCACTTGA AGACGCAGCCAGCTTTTACAC AGCCCTCCAATGCCATCCTGAAGACT TGAGCGGGATCAGTTTGCA ACGCTTCGCGCTACTTCTTC CCCACCTTGCCAAACATCCACTCGT GAAAGAGAGCACCTTACAACCAATT CCAGTGGATGCAACCCACTA TTCCGAACAGCCATCCTTCTGCAAG GCAAGCAGGAGTATGACGAGTCT AACTAAGTCACAGTCCGCCTAGAAG CCCTTCCATCGTCCACCGCAAAT
the reactions without reverse transcriptase were carried out for the purpose of detecting genomic DNA contamination. PCR primers and TaqMan probes were designed using Primer Express (Applied Biosystems). Primers and TaqMan probe designed to detect rhesus h-actin expression were based on the sequence that was originally obtained from rhesus genomic DNA. TaqMan assay reagents (human hactin; Applied Biosystems) were used as an internal standard for human expression analysis. Primers and TaqMan probes with the fluorescence label used in this study are shown in Table 2. Each of the oligonucleotide fluorescent probes listed in Table 2 was 3V-labeled with TAMRA. The PCRs were multiplexed using a target gene and an internal control gene with the ABI 7700 Sequence Detector System (Applied Biosystems) according to the manufacturer’s instructions. The amplifications were performed in 50Al reaction volume containing 0.5 Al of cDNA, 25 Al of TaqMan Universal PCR Master Mix (Applied Biosystems), and 900 nM each primer and 250 nM TaqMan probe for the target gene or 60 nM each primer and 250 nM TaqMan probe for an internal control gene. cDNA derived from rhesus brain total RNA or human brain mRNA was used as standard, which allowed quantitation of relative levels of the specific mRNA of interest by the relative standard curve method. The expression data were normalized to the h-actin expression level. Aequorin bioluminescence assay Transient expression of the human and rhesus BRS3 in the aequorin reporter cell line HEK293/aeq17 was used to measure agonist-induced mobilization of intracellular calcium as described [41,42]. Functional EC50 values were measured in triplicate.
H. Sano et al. / Genomics 84 (2004) 139–146
References [1] A. Anastasi, V. Erspamer, M. Bucci, Isolation and structure of bombesin and alytesin, 2 analogous active peptides from the skin of the European amphibians Bombina and Alytes, Experientia 27 (1971) 166 – 167. [2] A. Anastasi, V. Erspamer, M. Bucci, Isolation and amino acid sequences of alytesin and bombesin, two analogous active tetradecapeptides from the skin of European discoglossid frogs, Arch. Biochem. Biophys. 148 (1972) 443 – 446. [3] N. Minamino, T. Sudoh, K. Kangawa, H. Matsuo, Neuromedin B-32 and B-30: two ‘‘big’’ neuromedin B identified in porcine brain and spinal cord, Biochem. Biophys. Res. Commun. 130 (1985) 685 – 691. [4] N. Minamino, K. Kangawa, H. Matsuo, Neuromedin B is a major bombesin-like peptide in rat brain: regional distribution of neuromedin B and neuromedin C in rat brain, pituitary and spinal cord, Biochem. Biophys. Res. Commun. 124 (1984) 925 – 932. [5] M. Brown, Y. Tache, D. Fisher, Central nervous system action of bombesin: mechanism to induce hyperglycemia, Endocrinology 105 (1979) 660 – 665. [6] M. Brown, J. Rivier, W. Vale, Bombesin: potent effects on thermoregulation in the rat, Science 196 (1977) 998 – 1000. [7] I. Zachary, E. Rozengurt, A substance P antagonist also inhibits specific binding and mitogenic effects of vasopressin and bombesin-related peptides in Swiss 3T3 cells, Biochem. Biophys. Res. Commun. 137 (1986) 135 – 141. [8] S.R. Nagalla, B.J. Barry, K.C. Creswick, P. Eden, J.T. Taylor, E.R. Spindel, Cloning of a receptor for amphibian [Phe13] bombesin distinct from the receptor for gastrin-releasing peptide: identification of a fourth bombesin receptor subtype (BB4), Proc. Natl. Acad. Sci. U.S.A. 92 (1995) 6205 – 6209. [9] T. Katsuno, T.K. Pradhan, R.R. Ryan, S.A. Mantey, W. Hou, P.J. Donohue, M.A. Akeson, E.R. Spindel, J.F. Battey, D.H. Coy, R.T. Jensen, Pharmacology and cell biology of the bombesin receptor subtype 4 (BB4-R), Biochemistry 38 (1999) 7307 – 7320. [10] B.J. Barry, S. Nagalla, E.R. Spindel, PCT [WO9603416], Oregon Regional Primate Center, Eugene, OR, USA, 1996. [11] A.V. Schally, A.M. Comaru-Schally, A. Nagy, M. Kovacs, K. Szepeshazi, A. Plonowski, J.L. Varga, G. Halmos, Hypothalamic hormones and cancer, Front. Neuroendocrinol. 22 (2001) 248 – 291. [12] N.E. Muurahainen, H.R. Kissileff, F.X. Pi-Sunyer, Intravenous infusion of bombesin reduces food intake in humans, Am. J. Physiol. 264 (1993) t-4. [13] R.J. Lieverse, J.B. Jansen, A.A. Masclee, C.B. Lamers, Bombesin reduces food intake after a preload in man by a cholecystokininindependent mechanism, Clin. Sci. 85 (1993) 277 – 280. [14] R.J. Lieverse, J.B. Jansen, Z.A. van de, L. Samson, A.A. Masclee, L.C. Rovati, C.B. Lamers, Bombesin reduces food intake in lean man by a cholecystokinin-independent mechanism, J. Clin. Endocrinol. Metab. 76 (1993) 1495 – 1498. [15] A. Cullen, L.J. Van Marter, E.N. Allred, M. Moore, R.B. Parad, M.E. Sunday, Urine bombesin-like peptide elevation precedes clinical evidence of bronchopulmonary dysplasia, Am. J. Respir. Crit. Care Med. 165 (2002) 1093 – 1097. [16] B.M. Lu, H. Kurtel, M.G. Lu, A.O. Aktan, B.C. En, F. Lu, R. Yalin, B.C. En, Bombesin ameliorates colonic damage in experimental colitis, Dig. Dis. Sci. 44 (1999) 1531 – 1538. [17] P.J. Kulkosky, Brain – gut neuropeptides and the limitation of ethanol consumption, Neurosci. Biobehav. Rev. 9 (1985) 179 – 190. [18] A.V. Schally, A. Nagy, New approaches to treatment of various cancers based on cytotoxic analogs of LHRH, somatostatin and bombesin, Life Sci. 72 (2003) 2305 – 2320. [19] H. Ohki-Hamazaki, K. Watase, K. Yamamoto, H. Ogura, M. Yamano, K. Yamada, H. Maeno, J. Imaki, S. Kikuyama, E. Wada, K. Wada, Mice lacking bombesin receptor subtype-3 develop metabolic defects and obesity, Nature 390 (1997) 165 – 169.
145
[20] V. Gorbulev, A. Akhundova, K.H. Grzeschik, F. Fahrenholz, Organization and chromosomal localization of the gene for the human bombesin receptor subtype expressed in pregnant uterus, FEBS Lett. 340 (1994) 260 – 264. [21] H. Ohki-Hamazaki, E. Wada, K. Matsui, K. Wada, Cloning and expression of the neuromedin B receptor and the third subtype of bombesin receptor genes in the mouse, Brain Res. 762 (1997) 165 – 172. [22] H.C. Weber, L.L. Hampton, R.T. Jensen, J.F. Battey, Structure and chromosomal localization of the mouse bombesin receptor subtype 3 gene, Gene 211 (1998) 125 – 131. [23] J. Liu, Z.J. Lao, J. Zhang, M.T. Schaeffer, M.M. Jiang, X.M. Guan, L.H.T. Van der Ploeg, T.M. Fong, Molecular basis of the pharmacological difference between rat and human bombesin receptor subtype3 (BRS-3), Biochemistry 41 (2002) 8954 – 8960. [24] V. Gorbulev, A. Akhundova, H. Buchner, F. Fahrenholz, Molecular cloning of a new bombesin receptor subtype expressed in uterus during pregnancy, Eur. J. Biochem. 208 (1992) 405 – 410. [25] J.C. Whitley, C. Moore, A.S. Giraud, A. Shulkes, Molecular cloning, genomic organization and selective expression of bombesin receptor subtype 3 in the sheep hypothalamus and pituitary, J. Mol. Endocrinol. 23 (1999) 107 – 116. [26] A.M. Bajo, A.V. Schally, M. Krupa, F. Hebert, K. Groot, K. Szepeshazi, Bombesin antagonists inhibit growth of MDA-MB-435 estrogen-independent breast cancers and decrease the expression of the ErbB-2/HER-2 oncoprotein and c-jun and c-fos oncogenes, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 3836 – 3841. [27] Z. Fathi, M.H. Corjay, H. Shapira, E. Wada, R. Benya, R. Jensen, J. Viallet, E.A. Sausville, J.F. Battey, BRS-3: a novel bombesin receptor subtype selectively expressed in testis and lung carcinoma cells, J. Biol. Chem. 268 (1993) 5979 – 5984. [28] Z. Kahan, B. Sun, A.V. Schally, J.M. Arencibia, R.Z. Cai, K. Halmos, G. Halmos, Inhibition of growth of MDA-MB-468 estrogen-independent human breast carcinoma by bombesin/gastrin-releasing peptide antagonists RC-3095 and RC-3940-II, Cancer 88 (2000) 1384 – 1392. [29] I. Chatzistamou, A.V. Schally, K. Szepeshazi, K. Groot, F. Hebert, J.M. Arencibia, Inhibition of growth of ES-2 human ovarian cancers by bombesin antagonist RC-3095, and luteinizing hormone-releasing hormone antagonist Cetrorelix, Cancer Lett. 171 (2001) 37 – 45. [30] B. Sun, A.V. Schally, G. Halmos, The presence of receptors for bombesin/GRP and mRNA for three receptor subtypes in human ovarian epithelial cancers, Regul. Pept. 90 (2000) 77 – 84. [31] B. Sun, A.V. Schally, G. Halmos, The presence of receptors for bombesin/GRP and mRNA for three receptor subtypes in human ovarian epithelial cancers, Regul. Pept. 90 (2000) 77 – 84. [32] B. Sun, G. Halmos, A.V. Schally, X. Wang, M. Martinez, Presence of receptors for bombesin/gastrin-releasing peptide and mRNA for three receptor subtypes in human prostate cancers, Prostate 42 (2000) 295 – 303. [33] A. Plonowski, A. Nagy, A.V. Schally, B. Sun, K. Groot, G. Halmos, In vivo inhibition of PC-3 human androgen-independent prostate cancer by a targeted cytotoxic bombesin analogue, AN-215, Int. J. Cancer 88 (2000) 652 – 657. [34] E. Wada, S. Wary, S. Key, J.F. Battey, Comparison of gene expression for two distinct bombesin receptor subtypes in postnatal rat central nervous system, Mol. Cell. Neurosci. 3 (1992) 446 – 460. [35] H. Ohki-Hamazaki, Neuromedin B. Prog. Neurobiol 62 (2000) 297 – 312. [36] E. Wada, J. Way, H. Shapira, K. Kusano, A.M. Lebacq-Verheyden, D. Coy, R. Jensen, J. Battery, cDNA cloning, characterization, and brain region-specific expression of a neuromedin-B-preferring bombesin receptor, Neuron 6 (1991) 421 – 430. [37] H. Ohki-Hamazaki, Y. Sakai, K. Kamata, H. Ogura, S. Okuyama, K. Watase, K. Yamada, K. Wada, Functional properties of two bombesinlike peptide receptors revealed by the analysis of mice lacking neuromedin B receptor, J. Neurosci. 19 (1999) 948 – 954. [38] D. Xiao, J. Wang, L.L. Hampton, H.C. Weber, The human gastrin-
146
H. Sano et al. / Genomics 84 (2004) 139–146
releasing peptide receptor gene structure, its tissue expression and promoter, Gene 264 (2001) 95 – 103. [39] E.R. Spindel, E. Giladi, T.P. Segerson, S. Nagalla, Bombesin-like peptides: of ligands and receptors, Recent Prog. Horm. Res. 48 (1993) 365 – 391. [40] C.A. Jennings, D.C. Harrison, P.R. Maycox, B. Crook, D. Smart, G.J. Hervieu, The distribution of the orphan bombesin receptor subtype-3 in the rat CNS, Neuroscience 120 (2003) 309 – 324.
[41] D. Button, M. Brownstein, Aequorin-expressing mammalian cell lines used to report Ca2+ mobilization, Cell Calcium 14 (1993) 663 – 671. [42] M.A. Bednarek, C. Tan, D.L. Hreniuk, O.C. Palyha, D.J. MacNeil, L.H.T. Van der Ploeg, A.D. Howard, S.D. Feighner, Synthesis and biological evaluation in vitro of a selective, high potency peptide agonist of human melanin-concentrating hormone action at human melanin-concentrating hormone receptor 1, J. Biol. Chem. 277 (2002) 13821 – 13826.
Characterization of the bombesin-like peptide receptor family in primates Hideki Sano, a,b Scott D. Feighner, a Donna L. Hreniuk, a Hisashi Iwaasa, b Andreas W. Sailer, a Jie Pan, a Marc L. Reitman, a Akio Kanatani, b Andrew D. Howard, a and Carina P. Tan a,* a
Department of Metabolic Disorders, Merck Research Laboratories, P.O. Box 2000, Rahway, NJ 07065, USA b Banyu-Tsukuba Research Institute, Okubo 3, Tsukuba, Ibaraki 300-2611, Japan Received 9 September 2003; accepted 23 January 2004 Available online 14 March 2004
Abstract In mammals, bombesin-like peptides mediate a broad range of physiological functions through binding to three highly conserved G-protein-coupled receptors: the neuromedin B-preferring, the gastrin-releasing peptide-preferring, and the bombesin-receptor subtype 3. Selective modulation of these receptors presents opportunities for the development of novel therapeutics. To ascertain if rhesus monkey could serve as a surrogate animal model for the development of modulators of bombesin-like receptor function, we undertook a search for additional receptor family members and studied the expression profiles of the three known bombesin-related receptors. We found no evidence for additional receptor family members in mammals, suggesting that the expression of the previously described bombesin-receptor subtype 4 is limited to amphibians. We studied the distribution of the three receptors in a broad array of human and rhesus monkey tissues. Based on the similarity between the human and the rhesus expression profiles, we conclude that the rhesus monkey may be a suitable animal model to evaluate the clinical efficacy and potential side effects of bombesin-like peptide ligands. D 2004 Elsevier Inc. All rights reserved.
Bombesin is a 14-amino-acid peptide first isolated from the skin of the European frog Bombina bombina in 1971 [1,2]. A large number of bombesin-like peptides have been found in amphibians and mammals and are grouped into three subfamilies based on the C-terminal tripeptide. The mammalian bombesin-like peptides are gastrin-releasing peptide (GRP), neuromedin C (GRP20-29) [3], and neuromedin B (NMB). The bombesin-like peptides have been shown to modulate smooth muscle contraction [4] as well as exocrine and endocrine secretions of gastrointestinal tissues, pancreas, and pituitary. In addition these peptides have a central effect on behavior, food intake, hyperglycemia [5], and hypothermia [6] and act as growth factors in vitro [7]. There are three known mammalian receptors activated by bombesin-like peptides: the NMB-preferring receptor (NMBR), the GRP-preferring receptor (GRPR), and bombesin-receptor subtype 3 (BRS3). The natural ligand for BRS3 is unknown. A fourth bombesin receptor, bomb* Corresponding author. Fax: (732) 594-6708. E-mail address: [email protected] (C.P. Tan). 0888-7543/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.ygeno.2004.01.008
esin-receptor subtype 4 (BB4R), has been cloned from amphibians [8,9]. In rhesus, a partial sequence has been reported [10], suggesting the possibility that a fourth functional receptor is present in mammals. Bombesin-like peptide receptors have attracted attention as targets of therapeutic drugs [11 –17]. Bombesin/ GRP receptor antagonists have been under clinical development as anti-cancer agents [18]. Bombesin and bombesin-like peptides have effects on energy homeostasis, reducing food intake in mammals, including humans [12 – 14]. BRS3-deficient mice exhibit a delayed-onset obese phenotype with increased food intake and decreased energy expenditure [19]. Therefore, endogenous or synthetic ligands for bombesin-like peptide receptors are potential therapeutic drugs for the treatment of obesity. In the process of drug development, the potency and clinical safety of potential human therapeutics are often profiled in rhesus monkey. Here we examine the distribution pattern of the three bombesin-like peptide receptors in human and rhesus tissues and describe our efforts to identify additional bombesin-receptor family members.
140
H. Sano et al. / Genomics 84 (2004) 139–146
Results and discussion Search for mammalian BB4R RT-PCR and genomic PCR were conducted on rhesus, Xenopus, and human brain cDNA or genomic DNA using primers for the reported rhesus BB4R DNA fragment [10]. The primers were almost perfectly conserved with the Bombina BB4R DNA sequence. Unexpectedly, an amplified fragment from Xenopus cDNA and genomic DNA that perfectly matched the partial rhesus BB4R sequence [10] was found. Attempts to detect the partial rhesus BB4R by RTPCR using human and rhesus mRNA samples were not successful. These results suggest that the partial rhesus BB4R sequence cited in [10] was incorrectly identified as a rhesus clone and may have originated from the frog Xenopus. To extend these results and determine if there were mammalian orthologs of the BB4R, we performed an interspecies Southern blot analysis representing the genomic DNA from multiple mammalian species (human, monkey, pig, cow, dog, ferret, rabbit, rat, mouse, guinea pig) and Xenopus (Fig. 1). This blot was hybridized with a Xenopus BB4R open-reading frame (ORF) probe at low stringency and washed at low stringency to identify any related DNA regions in the species represented. The Xenopus BB4R ORF cDNA was also cloned, expressed, and characterized by functional and binding assays. The Xenopus BB4R protein is 83% identical to the Bombina BB4R and has a similar pharmacological profile (data not shown). As shown in Fig. 1, Xenopus genomic DNA contained a strongly hybridizing fragment. DNA samples from other species had hybridizing bands at reduced intensity, which were all attributed to the detection of the most related
known gene (BRS3) through reprobing of the same blot. A search of the human and mouse genome database with the Xenopus BB4R sequence confirmed that BRS3 is the most related sequence in these mammalian species. Taken together, the above results suggest that there is no detectable mammalian ortholog for frog BB4. Identification and characterization of rhesus BRS3 To isolate rhesus BRS3 cDNA (GenBank AY350447), RT-PCR was carried out using human BRS3 primers. The 1.3-kb amplification product encoded a putative protein of 398 amino acids with a deduced amino acid sequence that was 95% identical to human BRS3 (Fig. 2). PCR amplification using rhesus genomic DNA produced a 4-kb fragment that was cloned and sequenced. The rhesus BRS3 gene is contained on three exons, as observed in other mammals (human, mouse, rat, guinea pig, sheep) [20 –25]. In addition, we isolated partial sequences of rhesus NMBR (GenBank AY350448) and GRPR (GenBank AY350449). Rhesus NMBR and GRPR exhibit strong sequence conservation with their human orthologs (protein sequence identities: 96 and 94%). In a previous report, a drastic difference in potency of the synthetic bombesin receptor panagonist [DTyr6, B-Ala11, Phe13, Nle14] Bombesin (6-14) (dY-bombesin) to rat and human BRS3 was attributed to sequence variation in the third extracellular loop [23]. The amino acid sequence of rhesus BRS3 corresponding to the predicted third extracellular loop domain is identical to that of human BRS3. Therefore dY-bombesin is expected to display a similar potency for both human and rhesus BRS3. To confirm that prediction, calcium mobilization was measured by an aequorin-based assay with HEK293 cells transiently expressing rhesus or human BRS3 cDNA (Fig. 3). dYbombesin stimulated calcium mobilization in a dose-dependent manner with similar EC50 values for rhesus BRS3 (5.6 nM) and human BRS3 (4.3 nM). In contrast, the EC50 value of rat BRS3 (2 AM) [23] was about 1000-fold weaker than those of human and rhesus BRS3. These results suggest that the pharmacological profile of the rhesus BRS3 is similar to that of human BRS3. Expression profile of human bombesin-like peptide receptors
Fig. 1. Multiple-species Southern zoo blot containing 10 Ag of EcoRIdigested genomic DNA samples from human, monkey, Xenopus, pig, cow, dog, ferret, rabbit, rat, mouse, and guinea pig was probed with Xenopus BB4 PCR-generated ORF probe.
Next we surveyed NMBR, GRPR, and BRS-3 in normal mammalian tissues to complement the receptor profiles in human cancer cell lines and tumor tissues [26 – 33]. Using real-time PCR (TaqMan), we found NMBR gene expression in a broad range of brain regions (amygdala, caudate nucleus, corpus callosum, hippocampus, hypothalamus, thalamus, brain stem, spinal cord), testis, and stomach (Fig. 4, top), similar to the mRNA receptor distribution reported in rats and mice [21,34 – 37]. We did not detect NMBR in human intestine or uterus, in contrast to a mouse study [21]. GRPR mRNA was preferentially expressed in
H. Sano et al. / Genomics 84 (2004) 139–146
141
Fig. 2. Alignment of amino acid sequences of BRS3 using the AlignX program of the Vector NTI Bioinformatics suite (Informax, Frederick, MD, USA). Predicted transmembrane domains are underlined. The predicted third extracellular loop is shaded gray.
142
H. Sano et al. / Genomics 84 (2004) 139–146
Fig. 3. Release of intracellular calcium measured by dose – response curves of aequorin bioluminescence induced in HEK293-AEQ17 cells by dYbombesin; n = 3.
pancreas, with weak expression detected in the stomach (Fig. 4, middle). Unlike NMBR and BRS3, GRPR was expressed in the brain at very weak or basal levels. These results are consistent with the previous two reports from Xiao et al. [38] and Spindel et al. [39]. TaqMan analysis revealed that BRS3 is preferentially expressed in human hypothalamus, which is in agreement with previous reports in rat, mouse, and sheep [21 – 23,25,40] (Fig. 4, bottom). This result suggests that BRS3 could be involved in the regulation of feeding behavior in several mammalian species. In addition to the hypothalamus, BRS3 expression was weakly detected in several other brain areas, including amygdala, caudate nucleus, corpus callosum, and hippocampus. BRS3 mRNA was also localized in the pituitary gland, one of the major sites where hormones regulating energy homeostasis are secreted. In sheep, BRS3 is also expressed in the pituitary gland [25]. In peripheral tissues, BRS3 was strongly expressed in human testis, and weaker expression was noted in fetal kidney, ovary, pancreas, and thyroid.
Fig. 4. Expression of bombesin-like peptide receptor mRNAs in various human tissues. mRNA profiles for NMBR, GRPR, and BRS3 in human are shown. Data were normalized to h-actin mRNA expression levels.
H. Sano et al. / Genomics 84 (2004) 139–146
Expression profile of rhesus bombesin-like peptide receptors We conducted a limited rhesus tissue survey to complement the human expression data. Rhesus NMBR was preferentially expressed in specific brain areas, including pons, medulla oblongata, and hypothalamus (Fig. 5, top). Weak or basal expression was observed in the cerebellum, pituitary gland, liver, and testis (Fig. 5, bottom). The preferential expression of BRS3 was observed in rhesus hypothalamus and testis as observed in human tissues. However, in rhesus we detected a higher level of BRS3 expression in the pons and medulla oblongata. In summary, we have shown that mammals do not possess an ortholog corresponding to the amphibian BB4R. Human and rhesus BRS3 appear similar in pharmacology based on equivalent activation potencies with the prototypical agonist dY-bombesin. The expression patterns of NMBR and BRS3 in rhesus are similar to those found in humans. In particular, BRS3 expression in the hypothalamus is supportive of its
143
possible function in feeding behavior and energy homeostasis. Rhesus monkey may be an appropriate animal model for evaluation of bombesin-like peptide receptor ligands.
Material and methods Poly(A)+ mRNA and genomic DNA isolation Poly(A)+ mRNAs were isolated from rhesus hypothalamus, cerebellum, pituitary gland, pons, medulla oblongata, liver, brain (except for hypothalamus, cerebellum, pituitary gland, pons, medulla oblongata), liver, and testis using FastTrack 2.0 (Invitrogen, Carlsbad, CA, USA). Genomic DNA was purified from rhesus liver and Xenopus laevis brain. Human poly(A)+ RNAs and genomic DNA were purchased from Clontech (Palo Alto, CA, USA). Genomic and RT-PCR for BB4R Primers were based on a rhesus BB4 partial sequence [10] and had high homology to Bombina BB4R: primer 51f (5V-CGTGCGGCAAAGCTGTTTGTGTTTGG-3V) and primer 172R (5V-CATCAGCGAATGTGTCTCTTGCAG3V). PCR was carried out on Xenopus, rhesus, and human whole brain cDNA and genomic DNA on each of the species using the Advantage 2 PCR kit (Clontech). Firststrand cDNA was transcribed from the mRNA using Superscript II RT (Invitrogen). cDNA prepared as described above or 400 ng of sheared genomic DNA was used. PCR fragments were cloned into the TA vector (Invitrogen) and sequenced on ABI’s 377 sequencer using BigDye (Applied Biosystems) terminator technology. Xenopus genomic BAC library screen
Fig. 5. Expression of bombesin-like peptide receptor mRNAs. mRNA profiles in rhesus monkey are shown. Data were normalized for h-actin mRNA expression levels. ‘‘Partial brain’’ means the portion of whole brain except for hypothalamus, cerebellum, pituitary gland, pons, and medulla oblongata.
High-density membranes from ResGen (Huntsville, AL, USA) were hybridized with the Xenopus BB4 PCR-generated ORF probe. Hybridization conditions were 50% formamide, 10% dextran sulfate, 4 Denhardt’s solution, 5 SSPE, 0.1% SDS, 30 Ag/ml sheared salmon sperm DNA at 32jC overnight. The probe was labeled by random-primed (Prime-It II; Stratagene, Palo Alto, CA, USA) incorporation of [a-32P]dCTP (Amersham Biosciences, Amersham, UK) to a specific activity of greater than 109 dpm/Ag. The filters were washed to high stringency at 0.1 SSC, 0.1% SDS, 65jC, and exposed to film (XOmat, Kodak, Rochester, NY, USA). Positions of positive duplicate clones were determined. BAC stab cultures were obtained and grown up per the manufacturer’s instructions. The hybridizing region of the BAC DNA was determined by DNA restriction and subsequent Southern blotting. The fragments of interest were cloned and sequenced.
144
H. Sano et al. / Genomics 84 (2004) 139–146
Genomic Southern analysis
Table 2 Oligonucleotides and TaqMan fluorogenic probes
Southern blots were run with genomic DNA from various species. Genomic DNA was prepared from ferret, guinea pig, hamster, and Xenopus by the Bradley Lab Rapid Method. Human, monkey, pig, cow, dog, rabbit, rat, and mouse genomic DNAs were purchased from Clontech Laboratories. Ten micrograms of DNA per species was digested with EcoRI, ethanol precipitated, and electrophoresed on 0.7% agarose, 0.5 TBE. The gel was denatured, neutralized, and transferred onto Nytran Plus membrane (Schleicher and Schuell, Dassel, Germany) by overnight wicking in 20 SSC. DNA was UV-cross-linked onto the membrane. The Southern blots were hybridized as described under the library screen method above.
Gene
Cloning of rhesus bombesin-like peptide receptors cDNAs were synthesized from rhesus hypothalamus mRNA using the SuperScript First-Strand Synthesis System (Invitrogen) with oligo(dT) priming. Based on nucleotide sequences of human GRPR, NMBR, and BRS3, three pairs of primers were synthesized (Table 1). Using the hypothalamus cDNAs for isolation of NMBR and BRS3 or rhesus genomic DNA for that of GRPR as a template, PCRs were carried out and the products were cloned into pCR4-TOPO (Invitrogen). Seven clones were randomly picked from each independent reaction and were subjected to sequence analysis. Using one of the clones whose sequence exactly matched the consensus sequence of rhesus BRS3, PCR was carried out to optimize the Kozak sequence with a pair of primers (forward, ATGGGATCCGCCACCATGGCTCAAAGGCAGCCTCACTCACCT; reverse, ATGCTCGAGTGGAAAGCTAGACTCTATCCTCTGCCTGC) and the amplified products were cloned into the BamHI and EcoRI site of pcDNA3.1/Hyg (+) (Invitrogen) for mammalian expression. The PCR products were verified by sequencing. Real-time RT-PCR First-strand cDNA was synthesized from 1 Ag of total RNA for rhesus and mRNA for human in a 50-Al reaction volume using TaqMan reverse transcription reagents (Applied Biosystems, Foster City, CA, USA). At the same time,
Table 1 Pairs of oligonucleotide primers for cloning Gene
Primer Sequence 5V – 3V
Rhesus GRPR Rhesus NMBR Rhesus BRS3
F R F R F R
ACTGTTTCCTTCTGAACTTGG A AGCAGGTCTCCCAAAGCCAG GTGGGCTTGCTGGGCAACATCATGC GGTATGTTCATTGTATTCTCCAGGAAGATTG TTGGACGTGACAATCACTGTATTTGAACTGAGA TGTTTCTCCTCCCAGCATGTGTATCCG
GenBank accession No.
Human M73481 GRPR
Primer Sequence 5V – 3V
F R FAM Human NM_002511 F NMBR R FAM Human L08893 F BRS3 R FAM Rhesus F NMBR R FAM Rhesus F BRS3 R FAM RhesusF h-actin R VIC
TGCTGCTGGCCATTCCA AGGTCTGGTTGGTGCTTTCCT CCGTGTTTTCTGACCTCCATCCCTTCC GGATGACAGGGATCAGTTTGC ACGCCTCGCGCTACTTCTT CCCACCTTGCCAAACATCCACTCGT GGCAGTTGTGAAGCCACTTGA AGACGCAGCCAGCTTTTACAC AGCCCTCCAATGCCATCCTGAAGACT TGAGCGGGATCAGTTTGCA ACGCTTCGCGCTACTTCTTC CCCACCTTGCCAAACATCCACTCGT GAAAGAGAGCACCTTACAACCAATT CCAGTGGATGCAACCCACTA TTCCGAACAGCCATCCTTCTGCAAG GCAAGCAGGAGTATGACGAGTCT AACTAAGTCACAGTCCGCCTAGAAG CCCTTCCATCGTCCACCGCAAAT
the reactions without reverse transcriptase were carried out for the purpose of detecting genomic DNA contamination. PCR primers and TaqMan probes were designed using Primer Express (Applied Biosystems). Primers and TaqMan probe designed to detect rhesus h-actin expression were based on the sequence that was originally obtained from rhesus genomic DNA. TaqMan assay reagents (human hactin; Applied Biosystems) were used as an internal standard for human expression analysis. Primers and TaqMan probes with the fluorescence label used in this study are shown in Table 2. Each of the oligonucleotide fluorescent probes listed in Table 2 was 3V-labeled with TAMRA. The PCRs were multiplexed using a target gene and an internal control gene with the ABI 7700 Sequence Detector System (Applied Biosystems) according to the manufacturer’s instructions. The amplifications were performed in 50Al reaction volume containing 0.5 Al of cDNA, 25 Al of TaqMan Universal PCR Master Mix (Applied Biosystems), and 900 nM each primer and 250 nM TaqMan probe for the target gene or 60 nM each primer and 250 nM TaqMan probe for an internal control gene. cDNA derived from rhesus brain total RNA or human brain mRNA was used as standard, which allowed quantitation of relative levels of the specific mRNA of interest by the relative standard curve method. The expression data were normalized to the h-actin expression level. Aequorin bioluminescence assay Transient expression of the human and rhesus BRS3 in the aequorin reporter cell line HEK293/aeq17 was used to measure agonist-induced mobilization of intracellular calcium as described [41,42]. Functional EC50 values were measured in triplicate.
H. Sano et al. / Genomics 84 (2004) 139–146
References [1] A. Anastasi, V. Erspamer, M. Bucci, Isolation and structure of bombesin and alytesin, 2 analogous active peptides from the skin of the European amphibians Bombina and Alytes, Experientia 27 (1971) 166 – 167. [2] A. Anastasi, V. Erspamer, M. Bucci, Isolation and amino acid sequences of alytesin and bombesin, two analogous active tetradecapeptides from the skin of European discoglossid frogs, Arch. Biochem. Biophys. 148 (1972) 443 – 446. [3] N. Minamino, T. Sudoh, K. Kangawa, H. Matsuo, Neuromedin B-32 and B-30: two ‘‘big’’ neuromedin B identified in porcine brain and spinal cord, Biochem. Biophys. Res. Commun. 130 (1985) 685 – 691. [4] N. Minamino, K. Kangawa, H. Matsuo, Neuromedin B is a major bombesin-like peptide in rat brain: regional distribution of neuromedin B and neuromedin C in rat brain, pituitary and spinal cord, Biochem. Biophys. Res. Commun. 124 (1984) 925 – 932. [5] M. Brown, Y. Tache, D. Fisher, Central nervous system action of bombesin: mechanism to induce hyperglycemia, Endocrinology 105 (1979) 660 – 665. [6] M. Brown, J. Rivier, W. Vale, Bombesin: potent effects on thermoregulation in the rat, Science 196 (1977) 998 – 1000. [7] I. Zachary, E. Rozengurt, A substance P antagonist also inhibits specific binding and mitogenic effects of vasopressin and bombesin-related peptides in Swiss 3T3 cells, Biochem. Biophys. Res. Commun. 137 (1986) 135 – 141. [8] S.R. Nagalla, B.J. Barry, K.C. Creswick, P. Eden, J.T. Taylor, E.R. Spindel, Cloning of a receptor for amphibian [Phe13] bombesin distinct from the receptor for gastrin-releasing peptide: identification of a fourth bombesin receptor subtype (BB4), Proc. Natl. Acad. Sci. U.S.A. 92 (1995) 6205 – 6209. [9] T. Katsuno, T.K. Pradhan, R.R. Ryan, S.A. Mantey, W. Hou, P.J. Donohue, M.A. Akeson, E.R. Spindel, J.F. Battey, D.H. Coy, R.T. Jensen, Pharmacology and cell biology of the bombesin receptor subtype 4 (BB4-R), Biochemistry 38 (1999) 7307 – 7320. [10] B.J. Barry, S. Nagalla, E.R. Spindel, PCT [WO9603416], Oregon Regional Primate Center, Eugene, OR, USA, 1996. [11] A.V. Schally, A.M. Comaru-Schally, A. Nagy, M. Kovacs, K. Szepeshazi, A. Plonowski, J.L. Varga, G. Halmos, Hypothalamic hormones and cancer, Front. Neuroendocrinol. 22 (2001) 248 – 291. [12] N.E. Muurahainen, H.R. Kissileff, F.X. Pi-Sunyer, Intravenous infusion of bombesin reduces food intake in humans, Am. J. Physiol. 264 (1993) t-4. [13] R.J. Lieverse, J.B. Jansen, A.A. Masclee, C.B. Lamers, Bombesin reduces food intake after a preload in man by a cholecystokininindependent mechanism, Clin. Sci. 85 (1993) 277 – 280. [14] R.J. Lieverse, J.B. Jansen, Z.A. van de, L. Samson, A.A. Masclee, L.C. Rovati, C.B. Lamers, Bombesin reduces food intake in lean man by a cholecystokinin-independent mechanism, J. Clin. Endocrinol. Metab. 76 (1993) 1495 – 1498. [15] A. Cullen, L.J. Van Marter, E.N. Allred, M. Moore, R.B. Parad, M.E. Sunday, Urine bombesin-like peptide elevation precedes clinical evidence of bronchopulmonary dysplasia, Am. J. Respir. Crit. Care Med. 165 (2002) 1093 – 1097. [16] B.M. Lu, H. Kurtel, M.G. Lu, A.O. Aktan, B.C. En, F. Lu, R. Yalin, B.C. En, Bombesin ameliorates colonic damage in experimental colitis, Dig. Dis. Sci. 44 (1999) 1531 – 1538. [17] P.J. Kulkosky, Brain – gut neuropeptides and the limitation of ethanol consumption, Neurosci. Biobehav. Rev. 9 (1985) 179 – 190. [18] A.V. Schally, A. Nagy, New approaches to treatment of various cancers based on cytotoxic analogs of LHRH, somatostatin and bombesin, Life Sci. 72 (2003) 2305 – 2320. [19] H. Ohki-Hamazaki, K. Watase, K. Yamamoto, H. Ogura, M. Yamano, K. Yamada, H. Maeno, J. Imaki, S. Kikuyama, E. Wada, K. Wada, Mice lacking bombesin receptor subtype-3 develop metabolic defects and obesity, Nature 390 (1997) 165 – 169.
145
[20] V. Gorbulev, A. Akhundova, K.H. Grzeschik, F. Fahrenholz, Organization and chromosomal localization of the gene for the human bombesin receptor subtype expressed in pregnant uterus, FEBS Lett. 340 (1994) 260 – 264. [21] H. Ohki-Hamazaki, E. Wada, K. Matsui, K. Wada, Cloning and expression of the neuromedin B receptor and the third subtype of bombesin receptor genes in the mouse, Brain Res. 762 (1997) 165 – 172. [22] H.C. Weber, L.L. Hampton, R.T. Jensen, J.F. Battey, Structure and chromosomal localization of the mouse bombesin receptor subtype 3 gene, Gene 211 (1998) 125 – 131. [23] J. Liu, Z.J. Lao, J. Zhang, M.T. Schaeffer, M.M. Jiang, X.M. Guan, L.H.T. Van der Ploeg, T.M. Fong, Molecular basis of the pharmacological difference between rat and human bombesin receptor subtype3 (BRS-3), Biochemistry 41 (2002) 8954 – 8960. [24] V. Gorbulev, A. Akhundova, H. Buchner, F. Fahrenholz, Molecular cloning of a new bombesin receptor subtype expressed in uterus during pregnancy, Eur. J. Biochem. 208 (1992) 405 – 410. [25] J.C. Whitley, C. Moore, A.S. Giraud, A. Shulkes, Molecular cloning, genomic organization and selective expression of bombesin receptor subtype 3 in the sheep hypothalamus and pituitary, J. Mol. Endocrinol. 23 (1999) 107 – 116. [26] A.M. Bajo, A.V. Schally, M. Krupa, F. Hebert, K. Groot, K. Szepeshazi, Bombesin antagonists inhibit growth of MDA-MB-435 estrogen-independent breast cancers and decrease the expression of the ErbB-2/HER-2 oncoprotein and c-jun and c-fos oncogenes, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 3836 – 3841. [27] Z. Fathi, M.H. Corjay, H. Shapira, E. Wada, R. Benya, R. Jensen, J. Viallet, E.A. Sausville, J.F. Battey, BRS-3: a novel bombesin receptor subtype selectively expressed in testis and lung carcinoma cells, J. Biol. Chem. 268 (1993) 5979 – 5984. [28] Z. Kahan, B. Sun, A.V. Schally, J.M. Arencibia, R.Z. Cai, K. Halmos, G. Halmos, Inhibition of growth of MDA-MB-468 estrogen-independent human breast carcinoma by bombesin/gastrin-releasing peptide antagonists RC-3095 and RC-3940-II, Cancer 88 (2000) 1384 – 1392. [29] I. Chatzistamou, A.V. Schally, K. Szepeshazi, K. Groot, F. Hebert, J.M. Arencibia, Inhibition of growth of ES-2 human ovarian cancers by bombesin antagonist RC-3095, and luteinizing hormone-releasing hormone antagonist Cetrorelix, Cancer Lett. 171 (2001) 37 – 45. [30] B. Sun, A.V. Schally, G. Halmos, The presence of receptors for bombesin/GRP and mRNA for three receptor subtypes in human ovarian epithelial cancers, Regul. Pept. 90 (2000) 77 – 84. [31] B. Sun, A.V. Schally, G. Halmos, The presence of receptors for bombesin/GRP and mRNA for three receptor subtypes in human ovarian epithelial cancers, Regul. Pept. 90 (2000) 77 – 84. [32] B. Sun, G. Halmos, A.V. Schally, X. Wang, M. Martinez, Presence of receptors for bombesin/gastrin-releasing peptide and mRNA for three receptor subtypes in human prostate cancers, Prostate 42 (2000) 295 – 303. [33] A. Plonowski, A. Nagy, A.V. Schally, B. Sun, K. Groot, G. Halmos, In vivo inhibition of PC-3 human androgen-independent prostate cancer by a targeted cytotoxic bombesin analogue, AN-215, Int. J. Cancer 88 (2000) 652 – 657. [34] E. Wada, S. Wary, S. Key, J.F. Battey, Comparison of gene expression for two distinct bombesin receptor subtypes in postnatal rat central nervous system, Mol. Cell. Neurosci. 3 (1992) 446 – 460. [35] H. Ohki-Hamazaki, Neuromedin B. Prog. Neurobiol 62 (2000) 297 – 312. [36] E. Wada, J. Way, H. Shapira, K. Kusano, A.M. Lebacq-Verheyden, D. Coy, R. Jensen, J. Battery, cDNA cloning, characterization, and brain region-specific expression of a neuromedin-B-preferring bombesin receptor, Neuron 6 (1991) 421 – 430. [37] H. Ohki-Hamazaki, Y. Sakai, K. Kamata, H. Ogura, S. Okuyama, K. Watase, K. Yamada, K. Wada, Functional properties of two bombesinlike peptide receptors revealed by the analysis of mice lacking neuromedin B receptor, J. Neurosci. 19 (1999) 948 – 954. [38] D. Xiao, J. Wang, L.L. Hampton, H.C. Weber, The human gastrin-
146
H. Sano et al. / Genomics 84 (2004) 139–146
releasing peptide receptor gene structure, its tissue expression and promoter, Gene 264 (2001) 95 – 103. [39] E.R. Spindel, E. Giladi, T.P. Segerson, S. Nagalla, Bombesin-like peptides: of ligands and receptors, Recent Prog. Horm. Res. 48 (1993) 365 – 391. [40] C.A. Jennings, D.C. Harrison, P.R. Maycox, B. Crook, D. Smart, G.J. Hervieu, The distribution of the orphan bombesin receptor subtype-3 in the rat CNS, Neuroscience 120 (2003) 309 – 324.
[41] D. Button, M. Brownstein, Aequorin-expressing mammalian cell lines used to report Ca2+ mobilization, Cell Calcium 14 (1993) 663 – 671. [42] M.A. Bednarek, C. Tan, D.L. Hreniuk, O.C. Palyha, D.J. MacNeil, L.H.T. Van der Ploeg, A.D. Howard, S.D. Feighner, Synthesis and biological evaluation in vitro of a selective, high potency peptide agonist of human melanin-concentrating hormone action at human melanin-concentrating hormone receptor 1, J. Biol. Chem. 277 (2002) 13821 – 13826.