Characterization of the Bovine Papilloma virus plasmid maintenance sequences

Cell, Vol. 36, 391-401,

February

1964, Copyright

Q 1964 by MIT

00928674/64/020391-11

$02.00/O

Characterization of the Bovine Papilloma Virus Plasmid Maintenance Sequences Monika Lusky and Michael R. Botchan Department of Molecular Biology University of California Berkeley, California 94720

Summary Bovine Papilloma Virus (BPV-1) establishes itself as a multicopy nuclear plasmid in somatic mammalian cells in culture. We report here that two discontinuous regions within the viral genome can independently support extrachromosomal replication of the Tn5 neomycin’ gene in cells that provide viral factors in trans. The viral plasmid maintenance sequences (PMS) act in cis and will integrate along with the marker gene in cell lines that do not provide BPV-1 gene products. PMS-1 is localized within a 521 bp region upstream of the BPV-1’ early transcription unit; PMS-2 has been localized to a 140 bp region within the putative reading frame for the El protein of the viral genome. Recombinant plasmids carrying either of the PMS elements are unrearranged and stably maintained at a constant copy number supernumerary to the resident BPV-1 genomes even in the absence of selective pressure. Specific deletion mutants within the viral genome show that BPV-1 gene products required for morphological transformation are dispensable for plasmid maintenance. In mouse cells cotransformed with such deletion derivatives and an unlinked marker gene (neomycin’ or Tk), the marker genes integrate into the host genome while the BPV molecules are nonselectively carried as nuclear plasmids. This result implies that the BPV-1 genome must have signals that specifically preclude integration in the presence of fransacting factors. Introduction Animal viruses have provided useful systems for the study of DNA replication in eucaryotic cells. Characteristic features unifying the replication of DNA viruses are specific viral sequences that serve as origins of DNA synthesis and at least one specific viral protein whose direct interaction with these sequences is thought to be involved in the initiation of the replication procdss (for review see Cold Spring Harbor Symp. Quant. Biol. 43, part 2, 1978). These systems may be models for the regulated replication of chromosomes or, alternatively, adaptations of lytic viruses evolved to circumvent the normal cell-cycle controls imposed upon DNA replication (Harland and Laskey, 1980). In this context the papilloma viruses may provide new insights into the regulation of this process. Bovine papilloma type 1 viral DNA is maintained as a multicopy nuclear plasmid in mammalian cells morphologically transformed either by virus or by recombinant DNA molecules initially

propagated in E. coli (Lancaster, 1981; Law et al., 1981; Sarver et al., 1982; DiMaio et al., 1982). The plasmid copy number, once established, is stably maintained in a given cell line, and the best available data show that fluctuations with respect to copy number from cell to cell within a given line are not large (Moar et al., 1981). Moreover, indirect data indicate that continued viral gene expression is required for plasmid maintenance in proliferating cells in culture. Thus cells harboring plasmid DNA treated with interferon are rapidly cured of plasmids (Turek et al., 1982). The signals that are needed for the viral plasmids to enter a lytic response in vivo are unknown and are only active in those cells in the proliferating layers of the epidermis that are terminally differentiated (Zur Hausen, 1980). To study the mechanism of BPV-1 plasmid maintenance, its regulation, and its relationship to morphological transformation, we were interested in defining the viral sequences required in cis for autonomous replication. We also wanted to provide more direct evidence for the role of trans-acting viral functions for extrachromosomal establishment. Moreover, while previous studies have ‘shown that autonomous replication is dispensable for the expression and establishment of morphological transformation (Nakabayashi et al., 1983; N. Satver, P. Howley, and L. Berg, personal communication), it is not known whether the expression of the oncogenic functions of the virus is required for plasmid maintenance. Addressing the first of these questions, a series of recombinant plasmids was constructed, each containing a defined BPV-1 restriction fragment linked to the neomycin resistance gene (neo’) as selectable marker. After transfection of Cl 27 cells, a contact-inhibited mouse cell line, or BPV-I -transformed Cl 27 cells (ID13), neomycin-resistant colonies were isolated. The state of the marker DNAs was then assayed by blot hybridization and plasmid rescue. We found that two noncontiguous regions within the viral genome can each be maintained as plasmids in ID13 cells but not in Cl27 cells. Since we do not know at present whether these two elements function as origins of replication, e.g., as start sites for DNA synthesis, they will be referred to as PMS elements (plasmid maintenance sequences). Second, we asked whether BPV-1 plasmid replication and stable maintenance can be separated from BPV-1 morphological transformation. Deletion mutants were constructed within the transforming region of the viral genome. The mutated genomes were then tested for their ability to maintain the plasmid state upon cotransfection with the neo’ marker gene into Cl27 cells. Our results show that functions required for papillomavirus morphological transformation are dispensable for establishment of the viral plasmid state.

Results Transformation neo Plasmids

of Cl27 and ID13 Cells with BPV-

The experimental design for the studies presented in this report is outlined in Figure 1. For the constructions of BPV-

pNE05’. (See Experimental Procedures for a complete description of this DNA construction.) The unique restriction endonuclease cleavage sites Barn HI and Cla I were used as sites for the insertion of BPV-1 DNA sequences. To test the compatibility of the neomycin’ marker gene with BPV-1 gene expression and autonomous replication, the entire viral genome and the 69% transforming region of BPV-1 (Lowy et al., 1980) were separately cloned into the vector plasmid at the Barn HI site. Mouse Cl27 and ID13 cells were transfected with these two recombinant DNAs. ID1 3 is a Cl 27 cell line stably transformed with viral BPV-1 DNA. These cells contain approximately 150 copies of the viral genome per cell (Law et al., 1981). When the transformation frequencies of both types of recombinant plasmids were compared to that of pNE05’ in both cell lines, we noticed a 3 to 4 fold increase in the transformation efficiency of the recombinant plasmids containing the BPV genomes (see Table 1). All the Cl 27-derived G418-resistant colonies eventually displayed a morphologically transformed phenotype. The number of colonies selected in G418containing medium was equal to the number of morphologically transformed foci selected in DME medium (Table I), using either pNEO-BPVIm or pNEOBPVegT plasmids for the transfections. From each experiment five G418-resistant colonies were expanded into cell lines and assayed for the state of the plasmid DNA by blot analysis. We found that in all 20 lines examined (five lines from the Cl27 cells transformed with pNEO-BPV,w, five lines of Cl27 cells transformed with pNEOBPVsST, and the similar set of ID13 G41&resistant transformants), the recombinants were maintained as unrearranged plasmids in Cl 27 cells and in ID13 cells together with the resident viral genomes (data not shown). This indicates that the expression of the marker gene did not interfere with or prevent BPV-1 functions, and that different BPV molecules are

1 recombinant plasmids the aminoglycoside phosphotransferase gene of Tn5 (neo’) was used as a genetic marker. The gene product of neo’ confers resistance to the antibiotic G418, which is toxic to eucaryotic cells (Jimenez and Davies, 1980; Colbere-Garapin et al., 1981; Southern and Berg, 1982). The transcriptional unit modulating neo’ expression in eucaryotic ceils consists of the long terminal repeat (LTR) of the Harvey murine sarcoma virus, which contains an efficient promoter and rodent cell enhancer, the coding region of the neo’ gene, and the SV40 early polyadenylation signal. This unit is inserted into the plasmid pMLl (Lusky and Botchan, 1981) between its Cla I and Barn HI sites, giving rise to the vector plasmid

-c

DML

+ Tronrf.st recombinant BPV-n*o plosmidr anta recipient Cells

Figure 1. Experimental

Outline

The construction of the vector plasmid pNE05’ and the structure of recombrnant BPV-neo plasmids are described in the Experimental Procedures

Table 1. Transfection

of ID13 Cells and Cl27 G418e Colonies

Cells with Recombinant

Net-BPV

Plasmids

per 0.2 ag of DNA

Foci per 0.2 pg of DNA

ID1 3

Cl27

Plasmid

1

2

PML

0

0

pNE05

14

16

pNEOBPV,m(+)

55

3

Cl27

1

2

1

2

3

0

0

0

0

0

13

15

18

0

0

0

42

50

45

48

51

38

49

48

51

45

38

37

46 21

pNEOBPV,&-)

49

41

pNEOBPV&-)

35

43

45

36

46

25

31

pNEOBPV.A(+)

49

40

47

41

36

0

0

0

pNEOBPV-A(-)

41

17

52

35

28

0

0

0

pNEOBPV-B(+)

52

51

55

44

42

0

0

0

pNEOBPV-B(-)

45

43

35

35

29

0

0

0

pNEOPBV-C(+)

11

17

10

23

15

0

0

0

pNEOPBV-C(-)

13

7

9

16

24

0

0

0

pNEOPBV-D(+)

53

43

45

31

21

0

0

0

pNEOBPV-D(-)

50

48

42

19

29

0

0

0

BPV Plasmid Maintenance 393

mutually compatible and can stably coexist in the same cell (e.g., in ID13 cells). Others have recently reported that BPV-neo plasmids can be maintained extrachromosomally in Cl27 cells (Matthias et al., 1983: Law et al., 1983).

Neo BPV-A 1234R1234R

(a)

Neo

BPV-B

Isolation of PMS Elements from the BPV-1 Genome In order to assay for the presence of specific viral sequences that are required in cis to allow for plasmid replication, the BPV-1 genome was initially dissected into large fragments, covering the whole genome, using the endonucleases Barn HI and Bgl II. The resulting four fragments were inserted into the vector plasmid pNEO5’ at the Barn HI site in both orientations (+, -; see Experimental Procedures) relative to the direction of transcription of the neo’ gene. Fragments A and B are located in the transforming early region; fragments C and D are located in the late region of the BPV-1 genome (see Figure 6). The transformation frequencies obtained in three independent experiments with these recombinant plasmids in Cl 27 and ID13 cells are shown in Table 1. The number of transformants obtained in each case was similar, although for fragment C it was consistently 2 to 3 fold lower. The transformation frequency in ID13 cells was essentially identical with the frequencies measured in Cl27 cells. For each construction 15 G418-resistant colonies were expanded into cell lines. To examine the state of the recombinant plasmid DNAs, either low molecular weight DNA from Hit-t supernatants or total cell DNA was prepared and analyzed by the Southern blot technique. Furthermore, the Hi&extracted DNA was used to reestablish the recombinant plasmids in E. coli via selection for ampicillin-resistant colonies. Representative results are shown in Figures 2 through 4 and Table 3 and can be summarized as follows: -Both fragments A and B, contained in the BPV-1 early region, are able to support extrachromosomal replication of the marker gene in ID1 3 cells. The recombinants coexist as unrearranged plasmids (Figure 2) with the resident BPV1 DNA in these cells. -The copy number of the plasmids pNEOBPV-A and pNEOBPV-B is lower in comparison to that of the resident BPV-1 genome in the ID13 cells (Figures 2b, 3a). -Plasmids carrying BPV-1 fragments C or D, contained in the viral late region, are found linked to high molecular weight DNA in ID1 3 cells (Figure 3b). -None of the G418-resistant Cl 27-derived cell lines contain extrachromosomal BPV-neo recombinant plasmids; instead all material hybridizing to either BPV-1 DNA or neoDNA migrates with high molecular weight chromosomal DNA (Figure 4). Figure 2a shows the Southern blot analysis of undigested DNAs prepared from Hirt supernatants from each of four independently chosen G418-resistant ID1 3-derived cell lines transfected with the recombinant plasmids pNEOBPV-A and pNEO-BPV-B. 32P-labeled pNE05’ DNA was used as hybridization probe. This probe does not hybridize to the resident BPV-1 DNA in these cells. All cell lines contain

extrachromosomal

DNA

migrating

at

the

same

(b)

Neo

BPV-A

1234567~K1234567KKg2

Neo

BPV-B &s

22

--II I-+I

Figure 2. The Plasmids pNEOBPV-A Extrachromosomally in ID13 Cells

and pNEOBPV-B

Are Maintained

(A) Low molecular weight DNA from G41 a-resistant ID13 cell lines NEOBPVA (l-4) and NEOBPV-B (l-4) was used for the blot analysis. Lanes R contain 50 pg of plasmid DNAs pNEOBPV-A and pNEOBPV-B, respectively. The probe used for hybridization was nick-translated pNEO5’ DNA. Arrows denote the positions of the form I and form II DNAs of the plasmids. Exposure was for 5 days. (8) The analysis for seven cell lines each (NEOBPV-A and NEOBPV-B) is shown, each lane containing 10 Fg of total cellular DNA. Lanes RIO, R50, RIO8 contain as marker DNAs 10 pg and 50 pg of pNEOBPV-A and IO pg, 50 pg, 100 pg of pNEOBPV-B DNA. Lane ID13 contains 10 pg of DNA extracted from the ID13 cell line. Arrows indicate the positions of form I and II of BPV-1 DNA. The farnt band migrating between form I and II DNA, also seen in the G418-resrstant cell lines is presumably a form of BPV-1 DNA different from monomeric circles. Hybridization was done with 1 X l@ counts per ml each of pNE05’ and pMLBPV DNA. Exposure of the autoradiogram was for one day.

positions as the supercoiled DNAs of the control plasmids pNEOBPV-A and pNEOBPV-B, respectively. To investigate the copy number of the recombinant plasmids and compare it with that of the internal BPV-1 DNA, total DNA was prepared from seven independent cell lines each and subjected to Southern blot analysis. Hybridization was done with equal amounts of 3zP-labeled nick-translated pNEO.5’ and pMLBPV DNA, each probe having a specific activity of 2-3 x 10’ d.p.m. per rg of DNA. The copy number of the additional introduced plasmid DNAs is lower than the resident BPV-1 plasmid DNA and seems to vary from cell line to cell line. Plasmids carrying near exist in the range of 10 to approximately 50 copies per cell, whereas the copy number of BPV-1 DNA in each cell line is constant (Figure 2b). These experiments confirm the results presented in the previous section: two distinct BPV molecules can stably coexist in the same cell in an unrearranged

Cell 394

state. Digestion of the DNAs with Eco RI, which cleaves twice in the plasmid pNEOBPV-A and once in the plasmid pNEOBPV-B, supports these findings (Figure 3a). In both cases only bands migrating with those of the control DNAs are observed and even very long exposure of the Southern blot does not reveal any unexpected fragments. Since the blot was hybridized to both probes pNE05’ and pMLBPV DNA, the resident BPV-1 DNA, which becomes linearized upon cleavage with Eco RI, is seen in addition to the cleavage products of the recombinant plasmids. In contrast, in ID13 cell lines transfected with the plasmids pNEOBPV-C and pNEOBPV-D the recombinant plasmid DNAs were always found linked to the high molecular weight DNA (data removed for shortening). DNA analysis by restriction with Eco RI, which cleaves once in both plasmid DNAs shows a characteristic set of Eco RI fragments for each cell DNA (Figure 3b). The pattern is heterogeneous and does not align with linearized plasmid reconstructions These experiments suggest that pNEOBPV(a)

Neo

BPV-A

Neo

008 123456GgE123456n;

BPV-B

:: 8

C and pNEOBPV-D are randomly recombining and being carried in high molecular weight DNA, presumably in the chromosomes of ID13 cells (Perucho et al., 1980; Robins et al., 1981). None of the four plasmids can be maintained in an extrachromosomal state in Cl27 cells (Figure 4). Since the BPV-I fragments A and B together span the entire early region of the viral genome, a precise location of the PMS elements contained within both fragments is not possible. Therefore both fragments were dissected into subfragments (see Figure 5). The Cla-C, Taq-C, TaqD-G, Hpa II-C fragments were inserted into the Cla I site of pNE05’. The Bcl I-Barn HI and the Bgl II-Hpa I fragments were cloned into the Barn HI site. Plasmids containing the BPV-1 fragments Bgl I-Sph and Sph-Barn HI are deletion derivatives of pNEOBPV-A(-) and pNEOBPV-A(+), respectively. The plasmid carrying the viral Cla I-Bgl II fragment is a derivative of pNEOBPV-B(-). (A detailed description of these recombinants is given in the Experimental Procedures.) The plasmids were again transfected into ID13 and Cl27 cells and from each transfection 5-10 colonies were assayed after selection of G418-resistant colonies by blot analysis. Map locations of the BPV-1 fragments that carry PMS activity are shown in Figure 5. For example, the Cla-C fragment, the Bgl II-Hpa I fragment, the Taq D-G fragment, and the Bgl II-Sph I fragment can be maintained as plasmids when inserted into the vector plasmid pNE05’ and transfected into ID13 cells (data removed for shortening). All other BPV-1 subfragments tested are negative in this assay. In all cases the resident BPV-I plasmids are maintained (Figure 6). Restriction analysis of cell DNAs from these cell lines confirms this result. An example is shown in Figure 38, where DNA from three independent cell lines transfected with pNE0 Hpa II-C upon cleavage with Eco RI was analyzed. We conclude that PMS-1 is located in the Cla-C fragment Cl27 NW WV-A rho e W-8 1234557es-

Figure 3. Restriction Derived NEOBPV-A, C Cell Lines

R1

Cl27 NeoWV-C tie0 WV-0

Analysis of DNA Extracted from G418Resistant ID15 NEOBPV-B, NEOBPV-C, NEOBPV-D, and NE0 Hpa II-

(A) Six out of seven cell lines each from Figure 2b were analyzed. 10 ag of total cellular DNA was restricted with Eco RI. The enzyme cleaves the plasmid pNEOBPV-A twice and pNEOBPV-B once. Likewise the endogenous BPV-1 DNA is linearized upon restriction with this enzyme. Hybridization was done as in Figure 2. Exposure was for 4 days. The position of the linear BPV-1 DNA is indicated by the arrow. Lanes R contain plasmid reconstructrons: IO pg, 50 pg, 100 pg of Eco RI-cut pNEOBPV-A DNA and 50 pg. 100 pg of Eco RI-cut pNEOBPV-B DNA. (B) Each lane contains 10 pg of total DNA cleaved with Eco RI: three cell lines containing pNEOBPV-C (same samples as in lanes 1, 3, 7, in Figure 3) four pNEOBPV-D-containing lines (same samples as lanes 8, 9, 12, 13, in Figure 3) and three pNEOHpa II-C containing cell lines. The position of the linearized plasmids is shown in the marker lanes R: C, D. Hpa II-C containing 50 pg each of Eco RI-cut plasmid DNA. Hybridization was with %abeled pNE05’ DNA.

Figure 4. G418-Resistant Cl27 Cells Contain the Recombinant BPV-neo Plasmids Carrying BPV-I Fragments A, B, C, D in High Molecular Weight DNA Left autoradiogram: Each lane contains 10 pg of total cellular DNA extracted from five lines derived from transfection with pNEOBPV-A and four lines derived from transfection with pNEOBPV-B. Plasmid reconstructions of both plasmids pNEOBPV-A (RI) and pNEOBPV-B (R2) were 10 pg. 50 pg, 100 pg each. Arrows denote the positions of form I and II DNA of the markers, The probe was nick-translated pNEO5’ DNA. Exposure was for 7 days. Right autoradiogram: C127-derived cell lines NEOBPV-C (l-5) and NEOBPV-D (6-10) established upon transfection with pNEOBPV-C and pNEOBPV-D DNA. The analysis was as in Figure 4A. The arrow points to the position of form I of the marker DNAs: Rl (pNEOBPV-C), R2 (pNEOBPV D). Exposure was for IO days.

BPV Plasmid Maintenance 395

RNA

ID13 A

Figure 5. BPV-1 Fragments the Viral Genome

Exerting PMS Function are Discontinuous

A

A-

4

M 1234

within

The double line represents the entire BPV-1 genome opened at the Bam HI site, The arrow above indicates the direction of transcription within the BPV-1 early region. The lines below the physical map represent the BPV-1 restriction fragments used to generate recombinant BPV-neo plasmids (see Experimental Procedures). Thick lines showing the plus sign represent fragments that have PMS function in ID13 cells. Thin lines showing the minus sign are negative for PMS activity in these cells. The regions of homology between PMS-1 and PMS2 are: 1582 7103

GTTTCTCTGCTTTTAGCTGT--GT-TAAAGCAG-A-TTAAGT . . . .. . . . . . . .. . . . . . . . . . GTTTCTATAAATGT-TCTGTAAATGTAAAACAGAAGGTAAGT AAACTGCAC--AA-GTTCCTC-CTTCAT . . .. . . . . .. .. . . . CAACTGCACCTAATAAAAATCACTTAAT

. .

. . . . .

1522

PM-2

7171

PM-1

between Bgl II and Cla I (pos. 6945-7476), within the noncoding region upstream of the BPV-1 early transcription unit (in fragment B). Since the BPV-1 Hpa II-C and the Sph I-Barn HI fragments are negative in this assay, PMS-2 must be contained in the overlapping part of the Taq D-G and the Bgl II-Sph I fragments within a 140 bp Bgl II-Taq I fragment (pos. 1515-1655), which is in the coding region of the BPV-1 El open reading frame (in fragment A; see Figure 6). Both PMS elements and all other subfragments, when inserted into pNE05’ and transfected into Cl27 cells, were found linked to the chromosomal DNA in these cells (data not shown). Table 2 shows the transformation efficiencies of the neomycin marker gene obtained with these plasmids in a set of parallel experiments with ID1 3 and Cl 27 cell lines as recipients. As observed with the large BPV-1 fragments (A, 8, C, and D), transformation frequencies in the two cell lines were nearly identical for a given construction. Furthermore, in the ID13 cells the transformation efficiencies of the recombinant DNAs that integrated were equivalent tb the efficiencies obtained with the autonomously replicating plasmids (e.g., Hpa II-C and Taq D-G).

Rescue of PMS Containing Plasmids into E. coli from G418-Resistant ID13 Cells To provide further evidence for extrachromosomal maintenance of the PMS-containing plasmids in ID13 cells we attempted to rescue these plasmids from the eucaryotic cells and to reestablish them in E. coli (Tables 3 and 4). DNA from cell lines containing resident BPV-1 genomes and a recombinant pML-neoplasmid yielded 2-5 times less

Figure 6. Analysis of Total Cellular DNA from G418-Resistant ID13 Cell Lines Established upon Transfection with the Recombinant Plasmids pNEOSph-Barn (l), pNEOHpa II-C (2), pNEOTaq-C (3), pNEOBcl-Bam (4) The analysis of three cells lines each is shown. Each lane contains 10 rg of total cellular DNA. Lanes M (1, 2, 3. 4) show the four plasmid reconstructions, each containing 100 pg of DNA. The upper autoradicgram shows the result upon hybridization with nick-translated pNE05’ DNA. Exposure was for 12 days. Thereafter the probe was removed (see Experimental Procedures) and the filter was rehybridized with nick-translated pMLBPV DNA (lower autoradiogram). Exposure was for one day.

bacterial colonies than cell lines containing binant

plasmids

morphologically

transformed

only the recomwith pMLCl27neoBPV,,

BPVla, or with pNEOBPVIW (Cl27-BPV&, in Table 3). Absolute copy numbers measured by this approach yields estimates from 100 copies for C127-NEOBPVloo to 20 copies per cell for IDl3-NEOBPV-A. The differences in colony numbers obtained with the DNAs from the PMS containing ID13 cells also reflect the differences in copy number measured by blot analysis. In each case plasmid DNA from five Amp’ colonies was prepared and characterized by restriction enzyme analysis, which revealed the same pattern as the parental DNAs (data not shown). In contrast, none of the plasmids that were found linked to high molecular weight DNA in either ID13 cells or Cl27

Cell 396

Table 2. Transfection BPV Plasmids

of ID13 and Cl27 Cells with Recombinant

G418Besistant DNA

Colonies per 0.2 r.rg of

ID13 Plasmid

NEO-

Cf27

1

2

1

2

pNE05

16

13

15

18

pNEOBPV Cla-C(+)

59

63

45

39

pNEOBPV Cla-C(-)

14

30

49

51

pNEOBPV Taq-C(+)

8

10

12

20

pNEOBPV Taq-C(-)

IO

27

19

23

pNEOBPV Taq D-G(+)

40

36

35

26

pNEOBPV Taq D-G(-)

35

38

31

34

pNEOBPV Hpa-C(+)

46

13

33

29

pNEOBPV Hpa-C(-)

13

30

35

31

pNEOBPV

Bgl II-Sph

36

31

22

29

pNEOBPV

Sph-Barn

51

58

56

49

pNEOBPV

B&Barn(+)

44

50

51

42

pNEOBPV

Bcl-Bam(-)

53

50

58

61

pNEOBPV

Bgl II-Hpa I(+)

-

45

-

55

pNEOBPV

Cla-Bgl II(-)

55

51

Table 3. Transformatron of E. coli HBlOl by Hin-Extracted DNA from Transformed Cl 27 and G418-Resistant Cl 27 and ID1 3 Cells Source of DNA

Ampa E. co11Transformants

Cl27 DNA + pMLBPV,mDNA 5Kl+ tgpg 5Pg+t@3Pg

9 36

Cl 27.BP&C

56

Cl 27.neoBPV,&+)

45

IDl3-neoBPV,&+)

25

Cl 27.neo-A

0

ID13-neo-A

9

Cl27-neo-B

0

ID1 3-neo-B

12

Cl27-neo-C

0

ID1 3-neo-C

0

Cl 27.neo-D

0

ID1 3.neo-D

0

Cl 27.neo Cla-C

0

ID1 3-neo Cla-C

15

C127-neo

Taq-D-G

ID1 3-neo Taq-D-G C127neo

Bgl II-Sph

ID13-neo Bgl II-Sph

cells could be rescued in E. coli. Furthermore, DNAs that had replicated in the eucaryotic cells should be resistant to cleavage with Dpn I and sensitive to restriction with Mbo I (Peden et al., 1980). The results shown in Table 4 confirm that the plasmids which can be rescued into E. coli had indeed replicated in the ID13 cells.

Separation of Autonomous BPV-1 Replication from Morphological Transformation The factors provided by ID13 cells for the establishment of the plasmid state of the PMS-neo recombinants could be required for replication and transformation, or simply be required for replication. Furthermore, they could be specific cell factors expressed only in a papilloma virustransformed cell line. In order to investigate these possibilities, we asked whether the transforming functions of BPV-1 were crucial for the autonomous replication of the viral genome. We constructed deletion mutants within the E2 region of the BPV-I genome. Previous studies have localized gene product(s) required for BPV-I -mediated transformation to sequences within the this region (Nakabayashi et al., 1983; P. Howley, N. Sarver, and L. Berg, personal communication). The parental plasmid was pMLBPVIoo, a recombinant DNA carrying the entire BPV-1 genome inserted in pML1 at the Barn HI site (see Figure 7). The plasmid pMLBPVloo was linearized at the unique Kpn I site followed by treatment with the nuclease Bal 31. At the deletion endpoints a 278 bp BPV-1 fragment containing the early polyadenylation signal (Heilman et al., 1982) and an enhancer of the BPV-1 genome (Lusky et al., 1983) was inserted.

0 9 0 16

ID13-neo Hpa-C

0

ID1 3-neo Taq-C

0

ID1 3.neo Bcl-Barn

0

For each transformation a fraction of DNA extracted from Hirt supernatants was used (e.g., one-fifth of the DNA obtarned from one 10 cm dish). The numbers of colonies represent the average of three Independent experiments. C127BPV& is a cell line stably transformed with the plasmid pMLBPVIm (see Figure 5 in Lusky et al., 1983). The control experiment where total DNA (5 Ag) from C-127 cells was mixed with 10 or 100 pg of pMLBPVlm DNA shows that the high molecular weight DNA did not inhibit the transformation and predicts a transformation of 1 x 106 Amp’ colonies per 1 pg of plasmid DNA.

The structures of two such deletion mutants, Bal 15 and Bal 26 are depicted in Figure 7 and described in Experimental Procedures. The deletion endpoints of Bal 15 and Bal26 map in the BPV-1 genome at pos. 2694 and pos. 2723, respectively. Thus both deletion mutants contain the BPV-1 El coding region intact. Upon transfection into Cl 27 cells, both deletion mutants were incapable of producing foci, whereas the parental plasmid pMLBPVloo could transform the cells efficiently (see Table B in Figure 8; Sarver et al., 1982; Lusky et al., 1983). To test whether the deletion mutants were still capable of autonomous replication they were cotransfected with the neomycin marker gene on pNE05’. The results of the cotransformation experiments are shown in Figure 8 (Table B). From each experiment four G418-resistant Cl 27 colonies were expanded into cell lines and analyzed for the state of the plasmid DNAs as described above. In the Southern blot analysis of these eight cell lines, when probed with 32P-labeled pMLBPV

BPV Plasmid Maintenance 397

DNA, the hybridizing material migrates in all cases with form I of the control DNAs. However, when analyzed with a neo’specific probe the picture is different. In all cases the marker DNA appears to be linked to the high molecular weight DNA fraction (data removed for shortening). Analysis of these DNAs by restriction-enzyme digestion and Southern blot analysis confirm these points, Identical results were obtained when the deletion mutants were cotransfected with the Herpes virus thymidine kinase gene into mouse LTK- cells. Figure 8 shows the morphology of a G418resistant Bal 15containing Cl 27 cell line compared to a cell line transformed with pMLBPVloo DNA. The cell lines derived from the cotransfection experiments have a flat and contactinhibited appearance, in contrast to the BPV-1 -transformed cells, although unlike parental Cl27 cells, they appear to grow to a higher cell density. We do not know at present whether this is due to the expression of the neomycin marker DNA in these cells or whether the BPV-1 molecules or BPV-1 gene products in the cells induce the cells to grow to higher saturation densities. We tested whether these cells, which harbor Bal 15 or Bal 26 plasmids, remained susceptible to BPV-1 -mediated morphological transformation. Two such cell lines were chosen as recipients and subjected to transfection with pMLBPVloo DNA. The number of foci obtained in each case is similar to the number of foci obtained in normal Cl27 cells with this DNA (see table D in Figure 8). Taken together with the results described above, we conclude that the deletion mutants Bal 15 and Bal 26 contain all the information required for plasmid replication. Furthermore, BPV-1 extrachromosomal maintenance is not dependent upon viral gene products required for morphological transformation nor upon the typical BPV-l-transformed state of the host cell.

Table 4. Transformation of E. coli HBlOl G41 a-Resistant ID13 Cells

by Hit+Extracted

Discussion We have shown in this report that two noncontiguous DNA regions within the BPV-1 genome can support stable extrachromosomal replication in mouse cells harboring viral genomes (ID1 3) but not in untransformed Cl 27 cells. This shows that some transacting factors are required for the establishment and/or maintenance of the BPV-1 plasmid state. We have analyzed over 200 cell lines stably transformed to G418 resistance, and in all cases extrachromosomal plasmid DNA was detected provided that the recipient cells contained viral genomes that could provide transacting factors. Furthermore, upon restriction-endonuclease cleavage analysis of the DNA of these cell lines, we do not detect any unexpected bands, which would arise if the DNA had recombined with chromosomal or carrier DNAs. The two PMS sequences are distinct in the BPV-1 genome since all other regions tested in our assays were incapable of maintaining the marker neomycin-resistance gene as a plasmid in either the Cl 27 cells or ID13 cells. PMS-1 is localized to a 521 bp region within the noncoding part of the BPV-1 genome over 600 bp 5’ to start sites of early messenger RNAs (Ahola et al., 1983). The location of regulatory sequences in this region has been proposed based upon the primary DNA sequence of the genome, which shows the presence of an untranslated region in this part of the viral genome (Chen et al., 1982). Furthermore, a prominent DNAase l-hypersensitive site in the intracellular viral chromatin has been found in this region (R&l et al., 1983). PMS-2 is localized to a 140 bp region residing within the putative coding sequences for the BPV1 El protein. This position of PMS-2 is particularly intriguing, as unpublished observations from our laboratory and those

DNA from

Ampe E. coli Transformants Source of DNA Cell Line ID1 3-neo-A

Uncut

Dpn I-cut

Mbo i-cut

9

4

0

IDWneo-B

12

9

0

ID1 3-neo Cla-C

15

11

0

9

2

0

16

14

0

ID1 3-neo Taq-D-G ID13-neo Bgl II-Sph

To test the possibility that the rescued DNAs were contaminants from the original DNAs, which, upon transfection into the mouse cells, could have persisted throughout selection and establishment of the cell lines, the DNAs extracted from the eucaryotic cells were incubated with the restriction endonucleases Mbo I and Dpn I prior to transformation into HE101 cells, Both enzymes recognize and cleave the DNA sequence 5’GATC 3’. However, the enzymes have different specrfrcrtres with respect to methylation of the internal A residue. DNAs extracted from Hirt supernatants were therefore incubated with an excess of each enzyme and after cleavage phenol-extracted and ethanol-precipitated prior to transformation.

Figure 7. Structure

of BPV-1 Deletion Mutants

Important restriction sites used for construction and mapping of the deletion mutants are indicated in the structure of pMLBPVjm. The location of PMSl and PMS2 within the BPV-1 genome is shown below the line. The wavy line above the physical map represents the direction of BPV-1 early transctiption. The open boxes on top depict the location of open reading frames of the BPV-I genome within this region (Chen et al., 1982; Danos et al., 1983). The structure of the deletion mutants BeJ 15 and Bal 26 is shown below pMLBPVlm. The hatched region is the BPV-1 Pst I-Barn HI fragment (pas. 4172-4450) containing the early polyadenylation signal and an enhancer of BPV-1.

Cell 396

Figure 8. Analysis

of BPV-I Deletion Mutants

in Cl27 Cells

(A) Focus assay using the plasmids Bal 15 (left) and pMLBPVIm (right). (B) Focus assays and cotransfection experiments. The number of foci is per 1 rg of DNA. For the cotransfections the ratio of Bal 15 or Bal26 DNA to pNE05’ DNA was 10: 1 (e.g., 5 pg of Bal 15 or Bal 26 DNA: 0.5 rg of pNE05’ DNA per 1 x lb cells each. (C) Morphology of G416-resistant Cl27 cells derived from cotransfection with Bal I5 and pNE05’ DNA (left) and morphology of Cl27 cells transformed with pMLBPV,,,, DNA (right). In (A) and (B) cells were fixed with glutaraldehyde and stained with methylene blue. (D) Focus assay in C127-Bal 15 and Cl27 Bal 26 cell lines with pMLBPV,, DNA. The number of foci obtained is per 1 pg of DNA per 1 x 10’ cells.

of Sarver and Howley (NIH) indicate that specific deletions within the El protein reading frame render viral DNA incapable of plasmid maintenance. This implies that the El region includes sequences required in trans for the plasmid maintenance, since PMS-1 and PMS-2 no longer function. The location of PMS-2 within a coding region is reminiscent of the location of an origin of DNA replication of bacteriophage lambda, which has been localized within the coding region of the X O-gene (Rambach, 1973; Moore et al., 1979; Lusky and Hobom, 1979). The X O-gene encodes for one of the phage-specific proteins required in frans for the initiation of viral DNA synthesis. Comparison of the DNA sequences within the two PMS elements reveals a striking similarity: the nucleotide sequence pos. 7103-7173 in PMS-1 displays a homology of 73% to the sequence pos. 1522-1592 in PMS-2; these homologous sequences are on opposite strands (see legend to Figure

6).

We do not know why there are two PMS elements in the BPV-1 genome and what the significance of these two elements are for the life cycle of the virus. One may suggest that the two sequences play some role in the switch from the early-regulated to the late vegetative mode of viral replication. However, we do not have any evidence that PMS actually serve as sites for initiation of DNA synthesis. An intriguing possibility is that these PMS loci play an important role in the proper partitioning of newly replicated daughter molecules. The start site for DNA synthesis could then overlap with PMS, or else DNA synthesis could start at random sites within the recombi-

nant BPV-neo plasmids. In this context we have found that plasmids carrying either of the PMS elements, once established, are stably maintained in the cells even in the absence of selection. Thus we have passaged two cell lines containing either PMS-1 or PMS-2 plasmids twice per week for two months without G418 present in the medium and analyzed the DNA copy number at various times by Southern blot analysis. No loss of the recombinant molecules extracted from the population of cells was found. This result is particularly striking as the recombinant plasmids were present in these cells in low copy number-a minor subpopulation of the 150 resident BPV-1 circles. We would expect a rapid loss of the neo’carrying plasmids if these copies segregate randomly. In another set of experiments we described deletion mutants of the BPV-1 genome that lack the ability of the DNA to induce foci in mouse Cl27 cells. However, upon cotransformation with a marker gene, competent cells incorporate the marker into high molecular weight DNA presumably integrated while the BPV DNA is nonselectively carried as a plasmid in these cells. Taken together these observations imply that the PMS elements contain some activity that contributes to the regular partitioning of the plasmids in the presence of transacting factors. We know that BPV-1 DNA and specifically the PMS elements can be integrated into the cells’ genome (see Figures 4 and 6 and Lusky et al., 1983) but in these cases the Vans factors may be absent, or present at subthreshold levels. We were surprised to find that establishment of the neo’ marker occurred as readily via recombination and integra-

EJg;PlasmidMaintenance

tion as it did when it established itself as an autonomously replicating circle (see Tables 1 and 2). We expected that establishment of the marker gene as plasmid would lead to enhanced transformation efficiencies, since this has been used by others (Struhl et al., 1979) as an indirect measure of autonomous replication. In our cells the ratelimiting process for genotypic establishment of a marker may simply be the efficiency of transportation of the DNA from cytoplasmic vesicles to the nucleus. Recent experiments, showing that transformation efficiencies approaching 100% can be obtained with microinjected DNA, support this argument (Capecchi, 1980; M. Capecchi and A. Graessmann, personal communication). However, stable phenotypic transformation frequencies are also dependent upon levels of gene expression, which may be influenced by chromosomal domains. For example, it has been shown that cryptic insertions of both the SV40 genome and the HSV-TK gene are quite common in rodent cells and that activators of transcription increase the stable phenotypic transformation frequencies of these markers (Kriegler et al., 1983; Luciw et al., 1983). Indeed, our initial attempts to isolate a c&-acting BPV-1 sequence that might enhance marker gene transformation frequencies led to the discovery of a BPV-1 activator and not the PMS elements (Lusky et al., 1983). Therefore if a given gene is sensitive to position effects and does not interfere with the plasmid state we would predict a dramatic enhancement of transformation frequencies using BPV-1 -derived vectors. Conceivably, if we had utilized a weak promoter to regulate the neo’ gene, we might have measured an enhanced transformation frequency with the autonomously replicating plasmids. If promiscuous integration of transfected marker genes occurs with equal efficiencies as does the extrachromosomal establishment of the marker, it is somewhat paradoxical that plasmids containing the neomycin marker and a PMS element were never detected as integrated DNA in ID13 cells. One simple model that would accommodate these results is that integration of such an element in the presence of trans-acting factors would be of selective disadvantage. Information that will be essential in defining the BPV-1 plasmid state concerns the nature of the trans-acting factors that are required for this process. From our data we cannot infer whether those factors are required for the initiation of the plasmid state as distinct from its maintenance. Nevertheless some functional dissection of trans factors is available from the results presented here: the deletion mutants Bal 15 and Bal 26 are incapable of inducing morphological transformation as assayed by focus formation in Cl27 cells. These mutants, however, provide both the cis- and transacting factors required for the viral plasmid state. Candidate factors required in tram for the regulation of the plasmid state may be encoded by the open reading frames El, E6 or E7 (Figure 7). Indeed BPV-1 replication may require multiple factors, and a careful genetic dissection of these regions will be needed to resolve this issue.

We do not know why the copy number of the BPV plasmids “added on” to the resident BPV-1 genomes in ID13 cells is lower than that of the BPV-1 genomes within these cells. We can rule out that this effect is mediated by the constructions employed in our experiments. For example, a BPV-neo plasmid carrying the entire viral genome (pNEOBPV,& can establish itself with equal copy number in Cl27 cells as does the BPVI genome in ID13 cells. However the copy number of this recombinant molecule in ID13 cells is lower than that of the resident BPV-1 genome. Thus it could be possible that certain factors within a particular cell line may regulate the upper limit of copy number. We have shown that oncogenic transformation as mediated by the intact BPV-1 viral genome is nonessential for establishment of the plasmid state. Our ability to obtain transformed foci in cell lines carrying the Bal 15 and Bal 26 plasmids by supertransfection with wild-type BPV-1 genomes shows that such deletion mutants are not capable of inducing the complete papilloma transformation phenotype. However, certain cellular physiological changes may be induced by the remaining viral proteins encoded by the Bal 15 or Bal 26 deletion mutants. Furthermore, we have assayed oncogenic transformation with these deletions only through the focus assay, and other parameters of transformation (for example growth in low serum or anchorage-independent growth) need to be examined. If cellular changes are induced by the BPV-1 gene products encoded by the Ball5 or Ba126 genomes these altered physiological states may play an important role both in regulating plasmid replication and segregation. Indeed certain cell types may support BPV plasmid replication in the absence of any BPV-l-specific factors if the action of viral factors is indirect. Experimental

Procedures

Recombinant

Plasmids

The structureof the vector plasmid pNE05’ used to create recombinant BPV-neo molecules is shown in Figure 1. The construction of pNE05’ was achieved as follows: a 950 bp Cla I-Barn HI fragment of the Harvey murine sarcoma virus (HaMuSV) genome spanning the long terminal repeat (LTR) of this virus, which contains enhancer and promoter sequences (see Figure 4 in Kriegler and Botchan, 1983), was ligated to a 1.5 kb Bgl II-Barn HI fragment of Tn5 containing the neo’ gene (Jorgensen et al., 1979). The source of the Tn5 restriction fragment was a plasmid that has the neo’ gene inserted into the HSV-TK gene (Colbere-Garapin et al., 1981). The HaMuWTn5 Cla I-Barn HI/Bgl II-Barn HI fusion fragment was then inserted into pML1 (Lusky and Botchan, 1981) between its Cla I and Bam HI sites. The resulting plasmid pML-neo (not shown) was then linearized at the unique Bam HI site and a 237 bp Barn HI-Bcl I fragment of SV40 (pos. 2533-2770) was inserted. This restriction fragment contains the polyadenyiation site of the SW0 early transcription unit. Insertion of this fragment in the same transcriptional orientation as that of the neo’ gene fuses the Bcl I site of the SV40 fragment to the Bam HI site 3’ to the neo’ gene, giving rise to pNE05’. The BPV-I fragments that were cloned into pNE05’ are depicted in Figure 5. The four fragments covering the BPV-1 early region (A and B) and covering the BPV-1 late region (C and D) were inserted Into the Bam HI site of the vector DNA in both orientations. giving rise to the recombinants pNEOBW-A (+, -), pNEOBPV-B(+. -), pNEOBW-C(+, -). pNEOBPVD(+, -), (The plus sign indicates that linking of the neo’gene and the BPV-

Cell 400

1 fragment occurred in the same orientation with respect to transcriptional directions within the neo’ gene and the BPV-1 genome, whereas the minus sign indicates that linkage of these two units occurred in opposite orientations.) Likewise the BPV-I Bcl I-Barn HI fragment (pos. 3837-4450) was inserted into the Bam HI sfte of pNE05’. The BPV-1 fragments Cla I-C (pos. 6834-7476) Taq-C (pos. 7794-697) Taq D-G (pos. 767-1652) Hpa II-C (pos. 946-1586) were all inserted into the Cla I site of pNE05’. The recombinant plasmids pNEOSph-Bam and pNEOBgl II-Sph carrying the BPV-1 fragments Sph I-Bam HI (pos. 1978-4450) and Bgl II-Sph I (pas. 1515-2617) respectively, are deletion derivatives of pNECBPV-A (-) and pNEOBPV-A (+). pNEOBPV-A(-) was subjected to partial cleavage with Sph I to delete the sequences between pos. 565 in pML1 and pos. 1978 in the BPV-1 fragment, giving rise to pNEOSph-Bam; likewise pNEOBPVA(+) was partially digested with the same enzyme to delete the sequences between pos. 565 in pML1 and pos. 2617 in the BPV fragment, giving rise to pNEOBgl II-Sph. The BPV-1 Bgl II-Hpa I fragment (pos. 6945-l) was inserted into pNEO5’ by fusing the Bgl II site with the Bam HI site on one site of the vector DNA, followed by filling in the other Barn HI end and ligating it to the Hpa I site The recombinant plasmid carrying the BPV-1 fragment Cla I-Bgl II (pos. 7476-1515) was obtained using pNEOBPV-B(-) as starttng material. pNEOBPV-B(-) was restricted with Cla I, releasing two fragments. The Cla I fragment containing the marker gene and most of the BPV-B fragment was then inserted into pMLl at the Cla I site. To create deletion mutants within the E2 region of the BPV-1 genome, the plasmid pMLBPVlm was used as starting material. The DNA was ltnearized at its unique Kpn I site followed by treatment wrth the nuclease Bal 31. At the deletion endpoints an Xho I-lanker fragment was inserted, and their positions were defined by extensive restnction analysis. In addition, to define more precisely the deletion endpoints of some of the mutants, the plasmid DNAs were lineanzed at the Xho I site, labeled at the 5’ end with -/-“P-ATP and T4 polynucleotide kinase, followed by restriction with Sph I. The digestion products were then separated on a 7 M urea 6% sequencing gel. Two of these deletion mutants with deletion endpoints at pos. 2694 and pos. 2723 in the BPV-I DNA were then used to insert a 278 bp BPV-1 Pst I-Barn HI fragment (pos. 4172-4450) into the Xho I site via blunt-end ligation, giving rise to the plasmids Bal 15 and Bal26, respectively. The inserted BPV-1 fragment provides the BPV-1 polyadenylation signal of the viral early transcription unit and an enhancer of the vrral genome (Lusky et al., 1983). The numbering of the BPV-1 sequences to define the restriction fragments was done according to Chen et al. (1982). Cells and DNA Transfections Mouse Cl27 cells and ID13 cells were obtained from P. Hawley. DNA transfections were done by the procedure of Wigler et al. (1978) as described rn Lusky et al (1983). For morphological transformation assays, afler DNA transfection, the Cl27 cells were incubated for 2 to 3 weeks to allow foci to appear. The medium was changed twice per week. G418. resistant colonies rn both cell lines were selected in DME medium contarnrng 500 pg/ml G418 (Gibco). Prior to the addition of the antibiotic, which was applied to the cells 48 hr afler transfection, the cells were trypsinized and split at a ratio of 1110 (Cl27 cells) and 1:20 (ID13 cells). It has been observed that cell-killing by G418 is a rather slow process, because the cellular division IS not blocked within the first days after the addition of the antibiotic (Colbbe-Garapin et al., 1981). G418-resistant colonies were stained and counted or isolated and individually expanded into cell lines three weeks after transfection. Isolation and Analysis of Cellular DNA Total chromosomal DNA from the eucaryotic cells was prepared by the procedure of Thomas et al. (1966). Low molecular weight DNA was extracted by the method of Hirt (1967). For DNA analysis by the Southern blot technique either 10 rg of total DNA or fractions of Hi&extracted DNA (undrgested or digested) were subjected to electrophoresis on 0.8% or 1% agarose gels. When total DNA was used undigested, the DNA was sheared prior to electrophoresis to detect form I DNA and form II DNA of recombinant BPV-neo plasmids (Law et al., 1981). After gel electrophoresis the DNA was transferred to nitrocellulose filters. Prehybridizations and hybridizations were performed according to Wahl et al. (1979) as described in Thomas (1980) with some modifications. The buffer for both procedures contained

50% vol/vol deionized formamide, 5x SSC, 0.02% each bovine serum albumin, Ficoll and Polyvinylpyrrolidone, 50 mM Hepes (pH 7.0) 1 mM EDTA, 100 Ag/ml denatured salmon sperm DNA. The hybridization buffer contained in addition 10% dextran sulfate. Prehybridrzations were done for 2 to 4 hr at 42°C. hybridizations for 15 to 18 hr at the same temperature. The probes used were 32P-labeled nick-translated pNE05’ or pMLBPV DNA; 1 x 10s counts per ml were added. After hybridization the filters were washed for 5 to 10 min in 2x SSC, 0.1% SDS at 42°C. followed by washing with several changes in 0.1 x SSC, 0.1% SDS for 5 min each at 65’C. The filters were then exposed to X-ray film for one to several days. Removal of the hybridization probe for rehybridization was achieved by pouring distilled H,O, heated to lOO”C, over the filters, which were allowed to cool to room temperature. The filters could then be used for rehybridization.

We thank Dr. B. Polisky and L. Berg for their critical review of this manuscript and helpful comments. This work was supported by Public Health Service grant CA 30490 from the National Cancer Institute and by grant MV-91 from the American Cancer Society. M. L. is a recipient of a Leukemia Society postdoctoral fellowship. The costs of publication of thus article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact. Received

October

18, 1983; revised

November

28, 1983

References Ahola. H.. Stenlund, A., Moreno-Lopez, J.. and Petterson, U. (1983). Sequences of bovine papilloma type 1 DNA-functional and evolutionary rmplications. Nucl. Acids Res. 7 1. 2639-2650. Binetruy. G., Meneguzzi, G., Breathnach, R.. and Cuzin, F. (1982). Recombinant DNA molecules comprising bovine papilloma virus type 1 DNA linked to plasmid DNA are maintained in a plasmidial state both in rodent fibroblasts and in bacterial cells. EMBO J. 1, 621-268. Capecchi, M. R. (1980). High efficiency transformation by direct microinjection of DNA into cultured mammalian cells. Cell 22, 479-488. Chen, E. Y., Howley, P. M., Levinson, A. D., and Seeburg, P. (1982). The primary structure and genetic organization of the bovine papilloma virus type 1 genome. Nature 299, 529-534. Colbere-Garapin, F., Horodniceanu, F., Kourilsky, P., and Garapin, (1981). A new dominant hybrrd selective marker for higher eukaryotic J. Mol. Biol. 150, 1-14.

A.-C. cells.

Danos. 0.. Engel, L. W., Chen, E. Y., Yaniv, M., and Howfey, P. M. (1983). A comparative analysis of the human type 1a and bovine type 1 paprlloma virus genomes. J. Vrrol. 46, 557-566. DiMato, D., Treisman, R., and Maniatis, T. (1982). Bovine papilloma virus vector that propagates as a plasmrd in both mouse and bacterial cells. Proc. Nat. Acad. Sci. USA 79, 4030-4034. Harfand, R. M., and Laskey, R. A. (1980). Regulated replication mrcrornjected tnto eggs of Xenopus laevis. Cell 27. 761-771.

of DNA

Herlman, C. A., Engel. L., Lowy, D. R., and Howley, P. (1982). Virus specific transcription in bovine papilloma virus transformed mouse cells. Virology 119,22-34 Hrrt, B. (1967). Selective extractron of polyoma cell cultures. J. Mol. Biol. 26, 365-369.

DNA from infected

Jrmenez, A., and Davies, Y. (1980). Expression of a transposable resistance element in Saccharomyces. Nature 287, 869-871.

mouse antibiotic

Jorgensen, R. A., Rothstem. S. Y.. and Reznikoff, W. S. (1979). A restriction enzyme cleavage map of Tn5 and location of a region encoding neomycin resistance. Mol. Gen. Genet. 777, 6572. Kriegler, M., and Botchan, M. (1983). Enhanced transformation by a simian virus 40 recombinant virus containing a Harvey munne sarcoma virus long terminal repeat. Mol. Cell. Biol. 3, 325-339. Krregler, M.. Perez. C., and Botchan.

M. (1983). Promoter

substitutron

and

BPV Piasmid Maintenance 401

enhancer augmentation increases the penetrance of the SV40 A gene levels comparable to that of the Harvey murine sarcoma virus ras gene morphologic transformation. In Gene Expression: UCLA Symposium Molecular and Cellular Biology, New Series, Vol. 8, D. Hamer and Rosenberg, eds. (New York: Alan R. Liss, Inc.), pp. 107-124.

to in on M.

Lancaster, W. D. (1981). Apparent lack of integration of bovine papilloma virus DNA in virus-induced equine and bovine tumor cells and virus transformed mouse cells. Virology 708, 251-255. Law, M.-F.. Lowy, D. R.. Dvoretzky, J., and Howley. P. M. (1981). Mouse cells transformed by bovine papilloma virus contain only extrachromosomd viral DNA sequences. Proc Nat. Acad. Sci. USA 78. 2727-2731. Law, M. F., Byrne, J. C., and Howley, P. M. (1983). A stable bovine pepilloma virus hybrid plasmid that expresses a dominant selective trait. Mol. Cell. Biol. 3, 211 O-21 15. Lowy, D. R., Dvoretzky, J., Shaber, R., Law, M.-F., Engel, L., and Howley, P. M. (1980). In vitro tumorigenic transformation by a defined subgenomic fragment of bovine papilloma virus DNA. Nature 287, 72-74. Luciw, P. A., Bishop, J. M., Varmus, H. E., and Capecchi. M. R. (1983). Location and function of retroviral and SV40 sequences that enhance biochemical transformation after microinjection of DNA. Cell 33, 705-716. Lusky, M., and Botchan, M. (1981). Inhibition of SV40 replication cells by specific pBR322 DNA sequences. Nature 293, 79-81.

in simian

Lusky, M., and Hobom, G. (1979). lnceptor and origin of DNA replication in lambdoid coli phages. II. The A DNA maximal replication system. Gene 6, 173-192. Lusky, M., Berg, L., Weiher, H., and Botchan, M. (1983). Bovine papilloma virus contains an activator of gene expression at the distal end of the early transcription unit. Mol. Cell. Biol. 3. 1108-l 122. Matthias, P. D., Bernard, H. U., Scott, A., Brady, G., Hashimoto-Gotoh. T.. and SchiXz, G. (1983). A bovine papilloma virus vector with a dominant resistance marker replicates extrachromosomally in mouse and E. coli cells. EMBO J. 2. 1487-1492. Moar, M. H., Campo, M. S., Laird, H., and Garrett, W. F. H. (1981). Persistence of non-integrated viral DNA in bovine cells transformed in vitro by bovine papilloma virus type 2. Nature 293, 749-751. Moore, D. D., Denniston-Thompson, K., Kruger, K. E., Furth, M. E., Williams, B. G., Daniels, D. L., and Blattner, F. R. (1979). Dissection and comparative anatomy of the origin of replication of lambdoid phages. Cold Spring Harbor Symp. Ouant. Biol. 32, 155-163. Nakabayashi, Y., Chattopadhyay. S. K.. and Lowy, D. R. (1983). The transforming function of bovine papilloma virus DNA. Proc. Nat. Acad. Sci. 80,5832-5836. Peden, K. W. C., Pipas, Y. M.. Pearson-White, S., and Nathans, D. (1980). Isolation of mutants of an animal virus in bacteria. Science 203, 13921396. Perucho, M., Hanahan, D., and Wigler, M. (1980). Genetic and physical linkage of exogenous sequences in transformed cells. Cell 22, 309-317. Rambach, A. (1973). Replicator mutants of bacteriophage tion of two subclasses. Virology 54. 270-271.

X: characteriza-

Robins, D.. M., Ripley, S.. Henderson, A. S., and Axel, R. (1981). Transforming DNA integrates into the host chromosome. Cell 23, 29-39. R&l, F.. Waldeck, W.. and Sauer. G. (1983). Isolation of episomal bovine papillomavirus chromatin and identiiication of a DNasel-hypersensitive region. J. Virol. 46, 567-574. Sarver, N., Byrne, Y. C., and Howley, P. M. (1982). Transformation and replication in mouse cells of a bovine papilloma virus-pMl2 plasmid vector that can be rescued in bacteria. Proc. Nat. Acad. Sci. USA 79, 7147-7151, Southern, P. J.. and Berg, P. (1982). Transfonation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J. Mol. App. Genet. 1, 327-341. Struhl, K., Stinchcomb. D. T.. Scherer, S.. and Davis, R. W. (1979). High frequency transformation of yeast: autonomous replication of hybrid DNA molecules. Proc. Nat. Acad. Sci. USA 76, 1035-1039. Thomas, P. S. (1980). Hybridization fragments transferred to nitrocellulose. 5202.

of denatured RNA and small DNA Proc. Nat. Acad. Sci. USA 77, 5201-

Thomas, C. A., Berns. K. J., Jr., and Kelly, T., Jr. (1966). Isolation of high molecular weight DNA from bacteria and cell nuclei. In Procedures in Nucleic Acid Research, G. L. Cantoni and D. R. Davies, eds. (New York: Harper and Row), p. 535. Turek, L. P., Byrne, J. C., Lowy, D. R., Dvoretzky, I., Friedman, R. M., and Howley, P. M. (1982). Interferon induces morphologic reversion with eliminatlon of extrachromosomal viral genomes in bovine papilloma virus-transformed mouse cells. Proc. Nat. Acad. Sci. USA 79, 7914-7918. Wahl, G. M.. Stern, M., and Stark. (1979). Efficient transfer of large DNA fragments from agarose gels to Diazobenzyloxymethyl-paper and rapid hybridization by using dextran sulfate. Proc. Nat. Acad. Sci. USA 76, 36833687. Wigler, M. A., Pelicer, A., Silverstein. S., and Axel, R. (1978). Biochemical transfer of single-copy eucaryotic genes using total cellular DNA as donor. Cell 14. 729-731. Zur Hausen, H. (1980). Papillomaviruses. In DNA Tumor Viruses, J. Tooze, ed. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 371-382.

Note Added

in Praof

The BPV PMS sequences will maintain the neo’ marker in a stable plasmid state in BPV-transformed mouse LTK- cells. However, they do not function without the presence of viral genomes in these cells. Therefore the apparent requirement for BPV gene products in Cl27 cells is extended to a noncontact-inhibited transformed cell line.