Characterization of the developmental regulator FlbE in Aspergillus fumigatus and Aspergillus nidulans

Fungal Genetics and Biology 47 (2010) 981–993

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Characterization of the developmental regulator FlbE in Aspergillus fumigatus and Aspergillus nidulans Nak-Jung Kwon a, Kwang-Soo Shin b, Jae-Hyuk Yu a,⇑ a b

Department of Bacteriology and Genetics, University of Wisconsin, Madison, WI 53706, USA Department of Microbiology and Biotechnology, Daejeon University, Daejeon 300-716, Republic of Korea

a r t i c l e

i n f o

Article history: Received 9 April 2010 Accepted 24 August 2010 Available online 9 September 2010 Keywords: Fungi Aspergillus Asexual development FlbE Autolysis and cell death

a b s t r a c t Several upstream developmental activators control asexual development (conidiation) in Aspergillus. In this study, we characterize one of such activators called flbE in Aspergillus fumigatus and Aspergillus nidulans. The predicted FlbE protein is composed of 222 and 201 aa in A. fumigatus and A. nidulans, respectively. While flbE is transiently expressed during early phase of growth in A. nidulans, it is somewhat constitutively expressed during the lifecycle of A. fumigatus. The deletion of flbE causes reduced conidiation and delayed expression of brlA and vosA in both species. Moreover, FlbE is necessary for saltinduced development in liquid submerged culture in A. fumigatus. The A. nidulans flbE null mutation is fully complemented by A. fumigatus flbE, indicating a functional conservancy of FlbE in Aspergillus. Both the deletion and overexpression of flbE in A. nidulans result in developmental defects, enhanced autolysis, precocious cell death, and delayed expression of brlA/vosA, suggesting that balanced activity of FlbE is crucial for proper growth and development. Importantly, the N-terminal portion of FlbE exhibits the trans-activation ability in yeast, whereas the C-terminal half negatively affects its activity. Site-directed mutagenesis of certain conserved N-terminal amino acids abolishes the ability of trans-activation, overexpression-induced autolysis, and complementing the null mutation. Finally, overexpression of flbD, but not flbB or flbC, restores conidiation in A. nidulans DflbE, generally supporting the current genetic model for developmental regulation. Ó 2010 Elsevier Inc. All rights reserved.

1. Introduction Asexual sporulation is a common reproductive mode for many filamentous fungi including Aspergillus species. The asexual reproductive cycle in Aspergillus can be simplified into growth and development. The growth phase involves germination of an asexually derived spore called a conidium followed by the formation of an undifferentiated network of interconnected hyphal cells that form the mycelium. After a certain period of vegetative growth, under appropriate conditions, some of the hyphal cells stop normal growth and begin to form specialized reproductive structures called conidiophores that bear multiple chains of conidiospores (reviewed in Adams et al., 1998; Yu et al., 2006). Asexual development (conidiation) in Aspergillus is precisely timed and genetically programmed sequence of events. An essential step for conidiation in Aspergillus is the activation of brlA, which encodes a C2H2 zinc finger transcription factor (TF) (Adams et al., 1988; Chang and Timberlake, 1992; Mah and Yu, 2006; Yamada et al., 1999). Together with two additional developmental regula⇑ Corresponding author. Address: Department of Bacteriology and Genetics, 1550 Linden Drive, Madison, WI 53706, USA. Fax: +1 608 262 9865. E-mail address: [email protected] (J.-H. Yu). 1087-1845/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2010.08.009

tors abaA and wetA, these three genes have been proposed to define a central regulatory pathway that coordinates conidiation-specific gene expression in A. nidulans (Adams and Timberlake, 1990; Andrianopoulos and Timberlake, 1994; Marshall and Timberlake, 1991; Prade and Timberlake, 1994; Sewall et al., 1990). The novel regulator VosA plays a role in spore maturation and negative feedback regulation of brlA in A. nidulans (Fig. 1A; Ni and Yu, 2007; Ni et al., 2010). Efforts to dissect the early events leading to activation of conidiation have resulted in the identification of six genes (fluG, flbA, flbB, flbC, flbD, and flbE) required for normal activation of brlA (Wieser et al., 1994; reviewed in Adams et al., 1998). Among these, mutational inactivation of flbB, flbC, flbD or flbE gives rise to mutants that exhibit fluffy delayed conidiation phenotypes (Wieser et al., 1994). The FlbB, FlbC and FlbD proteins contain a b-zip, two C2H2 zinc fingers and a cMyb-DNA binding domain, respectively, and are thought to be potential TFs that act on the activation of brlA expression (reviewed in Adams et al., 1998; Etxebeste et al., 2008, 2009; Garzia et al., 2010; Wieser and Adams, 1995). Recent studies demonstrated that FlbB is necessary for the expression of flbD, and FlbB and FlbD activate brlA in a cooperative manner (Garzia et al., 2010). The A. nidulans flbE gene is predicted to encode a 201 aa-length polypeptide with two conserved yet uncharacter-

982

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

Fig. 1. Synopsis of flbE. (A) Current model for the action of FlbE, FlbB, FlbD and FlbC on brlA activation and conidiation. (B) A phylogenetic tree of FlbE identified in various fungal species (from top to bottom: Magnaporthe grisea, Aspergillus fumigatus, Neosartorya fischeri, Aspergillus clavatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Coccidioides immitis, Ajellomyces capsulatus, Phaeosphaeria nodorum, and Pyrenophora tritici). The putative FlbE proteins were retrieved from NCBI BlastX (http:// blast.ncbi.nlm.nih.gov/Blast.cgi) using A. nidulans FlbE. Phylogenetic tree of 11 FlbE proteins was created by TreeTop software (http://www.genebee.msu.su/services/ phtree_reduced.html) using the alignment data (http://align.genome.jp/). The phylogenetic tree is constructed based on the matrix of pair-wise distances between sequences. Numbers indicate the computed distances given the residue substitution weights from the alignment data. (C and D) mRNA levels of flbE during the lifecycles of A. nidulans (C; FGSC4) and A. fumigatus (D; AF293). C and AS indicate conidia (asexual spores) and ascospores (sexual spores in A. nidulans). Numbers indicate the time (h) of incubation in liquid MMG (vegetative) or after transfer to solid MMG glucose under the conditions favoring asexual development (asexual) or sexual development (sexual). Equal loading of total RNA was evaluated by the ethidium bromide staining of rRNA.

ized domains, and it was demonstrated that FlbE and FlbB are functionally inter-dependent, physically interact in vivo, and co-localized at the hyphal tip in an actin cytoskeleton-dependent manner (Garzia et al., 2009). An updated model for activation of conidiation where FlbE and FlbB function at the same level and FlbD functions downstream of FlbB has been proposed by Garzia et al. (2010) (Fig. 1A). In this study, we further characterize flbE in the model fungus A. nidulans and in the opportunistic human pathogen Aspergillus fumigatus, and present the evidence that FlbE is crucial for developmental regulation in both aspergilli. Modified yeast one hybrid assay reveals that the N-terminal region of FlbE exhibits trans-activation ability in yeast. As FlbE is a key element for the activation of conidiation in Aspergillus, the deletion of flbE results in reduced and delayed sporulation in both aspergilli. The A. nidulans DflbE mutant is fully complemented by A. fumigatus flbE+. Both deletion and overexpression of flbE cause proliferation of vegetative cells followed by enhanced autolysis and precocious cell death in A. nidulans, implying the importance of balanced levels of FlbE in normal growth and development. Genetic epistatic analyses further support the model that FlbD functions downstream of FlbE, whereas FlbB and FlbE function at the same level and FlbC in a separate pathway (see Fig. 1A).

2. Materials and methods 2.1. Culture conditions for A. nidulans (Ani), A. fuminatus (Afu), yeast and bacterium Aspergillus strains used in this study are listed in Table 1. Glucose minimal medium (MMG) or MMG with 0.5% (w/v) yeast

extract (MMG + YE) with supplements was used for general culture of fungal strains (Pontecorvo et al., 1953; Käfer, 1977). Minimal medium with 100 mM threonine (MMT) or MMT with 0.5% (w/v) yeast extract (MMT + YE) was used for the overexpression of selected genes including flbE. For instance, to overexpress AniflbE under the control of the alcA promoter, strains were inoculated in liquid MMG, incubated at 37 °C, 220 rpm for 12 h, and the mycelial aggregates were collected, rinsed with liquid MMT, transferred into liquid (or solid) MMT, and further incubated at 37 °C, 220 rpm. Samples were collected and total RNA was isolated from each strain. Saccharomyces cerevisiae L40 was used to check the trans-activation activity of FlbE fused with a DNA binding domain (Invitrogen) using a modified yeast one hybrid system. The L40 strain was grown in the synthetic dropout minimal medium (SD) [20 g glucose, 6.7 g of yeast nitrogen base (Difco), 50 ml of 20 dropout solution] with or without 10 ml of 100 nutrient solution (10 g/l leucine, 2 g/l tryptophan, and 2 g/l histidine) (Sherman, 1991), and incubated at 30 °C for 2–3 d. Escherichia coli DH5a and DH10B were grown in LB medium with ampicillin (50 lg/ml; Sigma) or zeocin (20 lg/ml; Invitrogen) for plasmid amplification. To test the effects of DflbE in A. fumigatus development in liquid submerged culture, wild type (WT), DAfuflbE and AfuflbE complemented strains were cultured in liquid MMG with 0.1% YE (YM) for 18 h at 37 °C and the mycelial aggregates were transferred into liquid MMG (control), –C (MM without carbon source), –N (MMG without nitrogen source) and MMG with 0.6 M KCl medium. We microscopically observed the phenotypes of three individual strains under these conditions. For Northern blot analyses, samples from liquid submerged and developmentally induced cultures were collected at designated time points. Approximately 106 conidia of WT (FGSC4 and

983

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993 Table 1 Aspergillus strains used in this study. Strain

Genotype

Source FGSCa FGSCa FGSCa N.P. Keller P. Weglenski This study This study Kwon et al., 2010 This study This study Kwon et al., 2010 This study This study This study This study This study This study This study

TNJ83 TNJ84 TNI16.2 TJW113

veA+ (wild type) biA1; veA1 (wild type) biA1; pyroA4; veA1 pyrG89; pyroA4; veA+ biA1; argB2; metG1; veA1 biA1; argB2; metG1; flbE::argB+ veA1 biA1; pyroA4::alcA(p)::flbE::Flag::pyroAb; veA1 pyrG89; pyroA4; flbC::AfupyrG+; veA+ pyrG89; pyroA4; flbE::AfupyrG+; veA+ pyrG89; pyroA4; veA+ AfupyrG+ pyrG89; pyroA::alcA(p)::flbC::Flag::pyroAb; veA+ pyrG89; pyroA::AfuflbE::pyroA4b; flbE::AfupyrG+; veA+ pyrG89; pyroA::alcA(p)::flbB::Flag::pyroAb; flbE::AfupyrG+; veA+ pyrG89; pyroA::alcA(p)::flbC::Flag::pyroAb; flbE::AfupyrG+; veA+ pyrG89; pyroA::alcA(p)::flbD::Flag::pyroAb; flbE::AfupyrG+; veA+ pyrG89; pyroA::alcA(p)::flbD::Flag::pyroAb; veA+ pyrG89; pyroA::alcA(p)::flbE::Flag::pyroAb; flbE::AfupyrG+; veA+ pyrG89; pyroA::alcA(p):: flbEGFRWPR?AAAAAA::Flag::pyroAb; flbE::AfupyrG+; veA+ pyroA::alcA(p)::flbEGFRWPR?AAAAAA::FLAG::pyroAb; veA+ pyrG89; pyroA::alcA(p)::flbE::Flag::pyroAb; veA+ biA1; alcA(p)::flbB::pyroA+ biA1; methG1 flbB::argB+

A. fumigatus AF293 AF293.1 TKSS6.07 FNJ11

Wild type pyrG1 AfuflbE::AnipyrG+; pyrG1 AfuflbE::AnipyrG+; pyrG1; AfuflbE+; hygB+

Brookman and Denning, 2000 Xue et al., 2004 This study This study

A. nidulans FGSC4 FGSC26 FGSC33 RJMP1.59 PW1 TNJ15 TNJ17 TNJ31 TNJ32 TNJ36 TNJ41 TNJ44 TNJ48 TNJ49 TNJ50 TNJ80 TNJ81 TNJ82

a b

This study This study Etxebeste et al., 2008 Kellner and Adams, 2002

Fungal genetics stock center. The 3=4 pyroA marker in pHS causes the targeted integration at the pyroA locus.

AF293) and relevant Ani and Afu mutant strains were inoculated in 100 ml liquid YM in 250 ml flask and incubated at 37 °C, 220 rpm. Individual mycelial samples were collected, squeeze dried and stored 80 °C until needed for total RNA isolation. For induction of asexual (and sexual) development, 16 h vegetatively grown mycelia were transferred onto solid MM and the plates were air exposed for asexual developmental induction or tightly sealed from air and light for sexual developmental induction of A. nidulans. 2.2. Nucleic acid isolation and manipulation To verify the ORF of Aspergillus nidulans flbE coding region was PCR-amplified from an A. nidulans cDNA library (provided by K.-Y. Jahng, Chunbuk University, Jeonju, Korea) with the primer pair oNK-112 and oNK-113 (see Table 2 for oligonucleotides). The resulting amplicon was sequenced. Isolation of genomic DNA and total RNA was carried out as described (Yu et al., 2004). For Northern blot analyses individual probes were prepared by PCR-amplification of the coding regions of AniflbE (oNK-112, oNK-113), AnibrlA (oNK-269, oNK-270), AnivosA (oNK-14, oNK-15), AfuflbE (oKS-54 and oKS-55), AfubrlA (oNK-594, oNK-595) and AfuvosA (oNK-596, oNK-597) from A. nidulans cDNA library or A. fumigatus genomic DNA, restively. To examine the effects of the deletion or overexpression of flbE on mRNA levels of developmental genes, total RNA of WT, DAniflbE, DAfuflbE and alcA(p)::AniflbE strains was isolated from the samples mentioned above. Approximately 10 lg per lane of total RNA was separated by electrophoresis using 1.1% agarose gel containing 6% formaldehyde and ethidium bromide and the nucleic acids were transferred to Hybond-N+ membrane (0.45 lm, Amersham, NY). Probes for brlA and vosA mRNA examination were prepared by amplifying coding regions of individual genes from genomic DNA of WT A. fumigatus (AF293) and A. nidulans (FGSC4), respectively. Individual amplicons were labeled with 32P–dCTP and used for Northern blot hybridization as described (Yu and Leonard, 1995).

2.3. Deletion, overexpression and complementation of flbE The A. nidulans and A. fumigatus flbE deletion mutants were generated using DJ-PCR (Yu et al., 2004). Briefly, 50 - and 30 -flanking regions of the flbE ORFs were amplified using the primer pairs of oNK106;oNK-109 (Ani50 with AniargB tail), oNK-107;oNK-108 (Ani30 with AniargB tail), oNK-106;oNK-457 (Ani50 with AfupyrG tail), oNK-107;oNK-456 (Ani30 with AfupyrG tail), oNK-183;oNK-184 (Afu50 with AnipyrG tail) and oNK-182;oNK-185 (Afu30 with AnipyrG tail), respectively. Genomic DNA of A. nidulans (FGSC4) or A. fumigatus (AF293) was used as a template. The AniargB, AnipyrG and AfupyrG markers were amplified with oNK-104;oNK-105, oBS-08;oBS09 and oJH-83;oJH-86, respectively. The final deletion constructs were amplified with oNK-110;oNK-111 (A. nidulans) and oKS29;oKS-30 (A. fumigatus). The amplified deletion cassettes were used to transform PW1 (P. Wieglenski) and RJMP1.59 (N.P. Keller) for A. nidulans and AF293.1 (Xue et al., 2004) for A. fumigatus using the Vinoflow FCE lysing enzyme (Novo Nordisk; Szewczyk et al., 2006). The transformants were checked for the deletion of flbE using PCR by the primer pairs oNK-184;oNK-185 (Afu) and oNK106;oNK-107 (Ani) followed by restriction enzyme analyses of the amplicons as described (Yu et al., 2004). To generate the A. nidulans flbB, flbC, flbD and flbE overexpression (OE) mutants, individual ORFs were amplified as follows; flbB (oNK-503;oNK-504, then cut with EcoRI/NotI), flbC (oNK-102;oNK217, EcoRI/HindIII), flbD (oNK-505;oNK-506, EcoRI/HindIII) and flbE (oNK-112;oNK-218, EcoRI/HindIII) from an A. nidulans cDNA library. The amplicons were digested with restriction enzymes as indicated, and ligated between the alcA promoter and the trpC terminator in pHS3 (Park and Yu, unpublished). This cloning vector is designed for simple construction of overexpression cassette and it contains the 3=4 pyroA gene (Osmani et al., 1999), the alcA promoter (Gwynne et al., 1987), a FLAG (DYKDDDDK) tag and the trpC terminator (Yelton et al., 1983). The final plasmid was expected to have

984

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

Table 2 Oligonucleotides used in this study. Name

Sequence (50 ? 30 )

Purpose

oNK-182 oNK-183 oNK-184 oNK-185 oBS-08 oBS-09 oKS-29 oKS-30 oKS-54 oKS-55 oNK-104 oNK-105 oNK-106 oNK-107 oNK-108 oNK-109 oNK-110 oNK-111 oNK-456 oNK-457 oJH-83 oJH-86 oNK-112 oNK-113 oNK-273 oNK-274 oNK-218 oNG-87 oNG-88 oNK-483 oNK-484 oNK-485 oNK-486 oNK-548 oNK-549 oNK-594 oNK-595 oNK-596 oNK-597 oNK-503 oNK-504 oNK-102 oNK-217 oNK-505 oNK-506 oNK-269 oNK-270 oNK-14 oNK-15

TTTGTAGGCTTTGGGCTGTTCACAA AGCGATGGATCGGTCACTATATC CTGATCTACCCCTTGGAACGCAGCA AGATAAACGGCAATACATTAC TCTACACGCGTCAAGCCTATTG AGGTCGGCATGTCTGACCATCATG GCAATGTAAAGCTAACGTGCGTG TGCCTTTAAGCTTCGGGTAGAG CGAGGTTGTCAAGAGAGCCGA GTGACGCAGATATGGATGTCTC ATATGGTACCATGCCTGTATATATGGTCCACGGCT ATATGCGGCCGCCGGGGAATCGAGCCTTAAATGTGCC ACACTTCAAAGGAGCGACGCTGTTG TCGACCTACAGCCATTGCGAAACCTC ACCACAGAGTTAGCGCATTGTAC ACTAGTGAGACCTACCAGCAATAC AGTCAAATGAGGCCTCTAAACTGGTCAAGACTGGCATGGTAAGGCGACGAC AGCCAAGGTAGATCCAGGCCTAACACATGATGCGTTGAGTATGTACTAATC TGAATTGCCTCGAGGTATGCTAG TGGTCGCTTCAGTAGGAAGCATTC GCTTTGGCCTGTATCATGACTTCA AGCATGTAGACTGGCATGGTAAG ATCGACCGAACCTAGGTAGGGTA TGCGTTGAGTATGTACTAATCGTTG GGATGTATCGTGACTGGCCTTCGG TAATTCGCGGCATACGGTGTCTAA ATATGAATTCATGCCAGTCTACATGCTCTACG ATATCTCGAGTTAGTACATACTCAACGCATCATC ATATGAATTCATACCCGAGGCAGGGTCTCCTAAT ATATCTCGAGATCGGTATTCCAGGAGCTCCCTG ATATAAGCTTGTACATACTCAACGCATCATCAAC GTGTGGAATTGTGAGCGGAT CTGCAGGAATTCGATATCAAGC AGCGTTAACGGCCAGGCAACAAG AGCTGCGGCCGCTGCGGCGGCGTAGAGCATGTAGACTGGCATGAA TCTACGCCGCCGCAGCGGCCGCAGCTGGTTTTACCGGAATCCGGGTC TTCGCCCGGAATTAGCTTGGCTGC ATATGAATTCTCTACACGCGTCAAGCCTATTGAC ATATGCGGCCGCATGCGAATGTCGACACCGAGCTG TGAGATCCCAGGGTAATATGTCTG TACTCATCCCATTCCATACTGATC TGCATGAGTAGACACTACCTACAG TGCGCAGCAACGTAAGCAGAGATTC ATATGAATTCATGACTTCGATCAGTAGTAGGCC ATATGCGGCCGCTGAATACATCGTCTCATCAGCATG ATATGAATTCATGACGATGGTTATTGAGAACCAG ATATAAGCTTCTCTTCGTCATCGCCTGAACCTC ATATGAATTCATGGCTCCAACACACCGTCGTGG ATATAAGCTTGTTCAAGAGGTTGTCGAGGCCCATC ATGCGAAATCAGTCCAGCCTGTC TCATCCCAGCCGTCCAGGCTCAT ATATGAATTCATGAGTGCGGCGAACTATCCAG ATATGTCGACTCACCGAGGAGTTCCGTTCGCTG

50 30 50 30 50 30 50 30 50 30 50 30 50 30 50 30 50 30 50 30 50 30 50 30 50 30 30 50 30 50 30 50 30 50 50 50 30 50 30 50 30 50 30 50 30 50 30 50 30

single copy integration at the pyroA locus in A. nidulans developmentally WT (FGSC33) or DAniflbE (TNJ32) strain. Single copy integration and overexpression of each gene was confirmed by PCR and Northern blot analyses, respectively. For the complementation of the A. fumigatus flbE null mutation, two PCR amplicons, the AfuflbE gene region including its presumed promoter and terminator (amplified by oNK-548;oNK-549) and the marker for hygromycin resistance (amplified by oNG-87;oNG-88), were co-introduced into a DAfuflbE strain (TKSS6.07). To test the ability of AfuflbE to complement DAniflbE, an AfuflbE genomic DNA fragment including the promoter, ORF and terminator was amplified by oNK-548 and oNK-549, cloned into pHS7 (Park and Yu, unpublished) containing the 3=4 pyroA gene and the resulting plasmid was introduced into an A. nidulans flbE deletion strain (TNJ32) to give rise to TNJ44.

AfuflbE with AnipyrG tail AfuflbE with AnipyrG tail flanking region of AfuflbE flanking region of AfuflbE AnipyrG marker AnipyrG marker nested of AfuflbE nested of AfuflbE AfuflbE with KpnI AfuflbE with NotI AniargB marker AniargB marker flanking region of AniflbE flanking region of AniflbE AniflbE with AniargB tail AniflbE with AniargB tail nested of AniflbE nested of AniflbE AniflbE with AfupyrG tail AniflbE with AfupyrG tail AfupyG marker AfupyG marker AniflbE with EcoRI AniflbE with XhoI AniflbE-C with EcoRI AniflbE-N with XhoI AniflbE with HindIII hygromycinB hygromycinB AniflbE GFRWPR mutation AniflbE GFRWPR mutation AniflbE GFRWPR mutation AniflbE GFRWPR mutation AfuflbE with EcoRI for comp. AfuflbE with NotI for comp. AfubrlA probe AfubrlA probe AfuvosA probe AfuvosA probe AniflbB with EcoRI AniflbB with NotI AniflbC with EcoRI AniflbC with HindIII AniflbD with EcoRI AniflbD with HindIII AnibrlA probe AnibrlA probe AnivosA probe AnivosA probe

and 30 regions of GFRWPR in the flbE ORF were amplified from cDNA library using oNK-483;oNK-484 and oNK-485;oNK-486 primer pairs, respectively, which introduce the GFRWPR to AAAAAA change to each amplicon. These two mutated 50 and 30 amplicons were fused as described (Yu et al., 2004) and the fused product was further amplified by oNK-112;oNK-113 to give rise to the full-length flbEGFRWPR?AAAAAA allele. The final PCR product was digested then with EcoRI and XhoI, and cloned into the pTLex vector, sequence-verified and used to check for its trans-activation activity. For the overexpression of flbEGFRWPR?AAAAAA, the fused PCR product was amplified by primers oNK-112:oNK-218, digested with EcoRI and HindIII, and cloned into the pHS3 vector. The resulting plasmid was sequenced-verified and introduced into FGSC33 to give rise to TNJ47 (see Table 1), which was tested for the phenotypes. 2.5. Autolysis and cell death assays

2.4. Site-directed mutagenesis of FlbE To change the conserved GFRWPR sequence to AAAAAA at the end of N-terminus in A. nidulans FlbE, single-joint PCR method was employed (Yu et al., 2004). Two overlapping amplicons covering 50

About 106/ml conidia of A. nidulans WT, DflbE or OEflbE strains were cultured in liquid MMG for 12 h at 37 °C, 220 rpm and then either transferred into liquid MMT (OEflbE) or continued to be cultured in liquid MMG (MMT) up to 7 d. Dry weight of the mycelium

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

was determined as described (Yamazaki et al., 2007; Shin et al., 2009). The cell viability was determined by the percent reduction of Alamar Blue (AB). Briefly, aliquots (0.5 ml) of liquid medium containing mycelial aggregates were collected into 10 ml test tubes, 1 ml of fresh liquid medium and 150 ll of AlamarBlueÒ (AbD Serotec) added into each tube, and further incubated for 6 h at 37 °C. The supernatants excluding mycelial aggregates were transferred into a 96 wells plate, and checked for absorbance at A570 and A600 by Synergy HT (BIO-TEK) using the KC4™ v3.1 software. The percentage of AB reduction was determined, and calculated as follows: (117,216  A570 of sample – 80,586  A600 of sample)/(155,677  A600 of media – 14,652  A570 of media)  100 (McBride et al., 2005; Shin et al., 2009). 2.6. Mapping an activation domain in FlbE To generate constructs to test the trans-activation ability of FlbE, we employed the pTLexA vector (Cho et al., 2003; kindly provided by Suhn-Kee Chae, Paichai University, Daejeon, Korea), which contains a LexA DNA binding domain (Brent and Ptashne, 1985) modified from pHybLex/Zeo (Invitrogen). The full-length ORF (1st–201st aa, amplified with oNK-112;oNK-113), the N-terminal half covering 1st–108th aa (amplified with oNK-112;oNK274) and the C-terminal half covering 93rd–201st aa (amplified with oNK-273;oNK-113) of FlbE were amplified from A. nidulans cDNA library. Individual amplicons were digested with EcoRI and XhoI, and ligated under the LexA DNA binding domain in the pTLexA vector. The plasmids were introduced into S. cerevisiae L40 using lithium acetate-polyethylene glycol-mediated yeast transformation (Ito et al., 1983). The yeast transformants were selected on SD medium in the absence of tryptophan and uracil. The transformants were inoculated on medium containing several dosages of 3-AT (3-amino-1,2,4-triazole, Sigma) or X-Gal (5-bromo-4chloro-3-indolyl-b-d-galactopyranoside; 40 lg/ml; Sigma), and the growth and coloration of the colonies were examined as described (Lee et al., 1999). To confirm and quantify the trans-activation activity, five transformants per construct were tested for b-galactosidase activity (Lee et al., 1999) using a yeast b-galactosidase assay kit (Pierce). 2.7. Microscopy The colony photographs were taken using a Sony DSC-T30 digital camera. Photomicrographs were taken using a Zeiss M2Bio microscope equipped with AxioCam and AxioVision digital imaging software. 3. Results 3.1. Summary of the Ani and Afu flbE genes A. nidulans FlbE (AN0721.3; 222 aa) was previously reported by Garzia et al. (2009) and Wieser (1997). In this study, we newly isolated the flbE ORF in A. fumigatus (CAF32111). As reported, FlbE is highly conserved in many filamentous fungal species including M. grisea, A. fumigatus, A. niger, C. immitis, A. capsulatus, P. nodorum and P. tritici (Fig. 1B). The length of the FlbE-like proteins varies from 168 to 288 aa. Importantly, the N-terminal half of FlbE appears to be highly conserved in filamentous fungi (Garzia et al., 2009), which shows high levels of similarity with FlbE-like proteins found in Sclerotinia sclerotiorum, Gibberella zeae, Neurospora crassa and Chaetomium globosum (data not shown). We examined mRNA levels of flbE in both aspergilli by Northern blot analyses, and found that AniflbE mRNA accumulates at low level in conidia, increases at 6 and 12 h of vegetative growth, and becomes undetectable during the rest of the lifecycle. On the contrary, AfuflbE mRNA is present at

985

relatively constant levels throughout the lifecycle of A. fumigatus except in conidia and during late asexual developmental phases (Fig. 1C and D). 3.2. FlbE is required for proper development in A. fumigatus In order to verify the role of FlbE as an upstream developmental activator (Garzia et al., 2009) multiple flbE deletion mutant strains of A. nidulans and A. fumigatus were generated via replacing the FlbE ORF with the AniargB or AfupyrG and AnipyrG marker, respectively. As FlbE is crucial for normal conidiation in Aspergillus, the deletion of flbE in A. fumigatus resulted in the colony exhibiting increased mass of vegetative hyphae and reduced formation of conidiophores (Fig. 2A center panel). However, different from A. nidulans (shown in Fig. 4A), the deletion of flbE in A. fumigatus resulted in a reduction, but not a delay, of conidiation in the growing margins of the colony. The developmental defects caused by DAfuflbE were complemented by introducing the WT AfuflbE allele (Fig. 2A D/+), indicating the phenotypes were due to the absence of AfuflbE. Previous studies reported that brlA is essential for conidiation in A. fumigatus (Mah and Yu, 2006) and that VosA (viability of spore) is crucial for spore maturation and trehalose biogenesis in spores in both A. nidulans and A. fumigatus (Ni and Yu, 2007). We examined whether the deletion of flbE affected the expression patterns of these two key regulators in A. fumigatus via Northern blot analyses. As shown in Fig. 2B, the deletion of flbE caused about 6 h delayed accumulation of AfubrlA and AfuvosA mRNA during asexual development. Moreover, the DAfuflbE mutant exhibited high level accumulation of brlA even at 48 h post developmental induction, i.e., 24 h delay to turn off brlA expression compared to WT. These results indicate that FlbE is necessary for proper control of conidiation, and brlA/vosA expression in A. fumigatus. 3.3. Differential requirement of FlbE in A. fumigatus development It has been shown that limitation of nutrients or the presence of other stresses could induce A. nidulans conidiation in liquid submerged culture conditions (reviewed in Adams et al. (1998) and references therein). We investigated a potential role of AfuFlbE in developmentally responding to salt stress and starvation in liquid submerged culture conditions. Conidia of WT (AF293), DAfuflbE (TKSS6.07) and complemented (FNJ11) strains were inoculated in liquid MMG and shake-cultured for 18 h, and individual mycelial aggregates were transferred into liquid MMG, MMG + 0.6 M KCl (KCl), MM without carbon (–C) or nitrogen (–N) source, and further incubated. Noticeably, as shown in Fig. 3, the DAfuflbE mutant failed to elaborate conidiophores in the presence of 0.6 M KCl until 48 h post shift (not shown), whereas WT and complemented (D/+) strains produced conidiophores abundantly at 12 h. In A. nidulans, it has been shown that the absence of glucose causes highly reduced conidiophores with elongated metulae and incomplete development of phialides (Skromne et al., 1995). In A. fumigatus, the absence of carbon source causes formation of simple conidiophores with elongated phialides lacking conidia (marked by arrowheads in Fig. 3) in WT and complemented strains, but not in the DAfuflbE mutant. However, while slightly delayed and reduced compared to WT and complemented strains, the DAfuflbE mutant produced conidiophores in liquid MM without N source (–N). These results indicate that FlbE is necessary for development induced by salt stress and C-starvation, but is dispensable for the developmental response to N-starvation in A. fumigatus. 3.4. FlbE is functionally conserved in two aspergilli In agreement with previous studies (Wieser, 1997; Garzia et al., 2009), all A. nidulans flbE deletion (DAniflbE) strains showed highly

986

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

Fig. 2. The deletion of flbE in A. fumigatus causes delayed conidiation. (A) Wild type (AF293), DAfuflbE (TKSS6.07) and DAfuflbE; AfuflbE+ (FNJ11) strains in A. fumigatus were point inoculated on solid MMG + 0.1% YE, and incubated at 37 °C for 3 d. Photographs of colony (upper column) and close-up views (lower column) are shown. (B) mRNA levels of brlA and vosA in A. fumigatus WT (AF293) and DAfuflbE (TKSS6.07) strains during the lifecycle. Numbers indicate the time (h) in liquid submerged culture or post asexual developmental induction. C indicates conidia. The putative A. fumigatus c-actin gene (Afu6g04740) identified by A. nidulans c-actin (Fidel et al., 1988), and ethidium bromide stained rRNA were used to evaluate equal loading of total RNA and Northern blot hybridization.

delayed and restricted sporulation with a reduced number of conidia, regardless of the presence of the veA+ (Fig. 4A) or veA1 (colony not shown) alleles. To check the functional conservancy of FlbE, we tested whether AfuflbE+ could complement DAniflbE. As shown in Fig. 4A, introduction of one copy AfuflbE at the pyroA locus fully restored development in the DAniflbE mutant (TNJ44), indicating that the function(s) of FlbE in conidiation is conserved in both species. Moreover, similar to that observed in A. fumigatus, the DAniflbE mutant exhibited delayed (about 12 h), but prolonged (until 120 h post developmental induction) accumulation of brlA mRNA. Although delayed, levels of brlA mRNA were quite high during 24–48 h post developmental induction and remained reasonably high even at 120 h. These results indicate that the lack of FlbE function perturbs proper regulation of brlA expression, and that FlbE is necessary for both activation and (likely indirect) feedback regulation of brlA expression. In this regard, it is important to note that accumulation of vosA mRNAs (two transcripts) is delayed (36– 60 h) and low in the DAniflbE mutant (Fig. 4B, see Section 4). We also examined the effects of DflbE in balancing asexual and sexual development in A. nidulans. When grown on solid MMG in the dark with limited air (enhancing sexual development), the DAniflbE (veA1; TNJ15) mutant predominantly produced sexual fruiting bodies (cleistothecia) and Hülle cells (Ellis et al., 1973) with very few conidia, whereas WT (FGSC26, veA1) formed a high number of conidia (Fig. 4C). We further examined the number of cleistothecia produced by FGSC4 (WT, veA+), TNJ32 (DAniflbE; veA+), FGSC26 (WT, veA1) and TNJ15 (DAniflbE; veA1) colonies and found that the absence of flbE results in highly elevated forma-

tion of sexual fruiting bodies, but blocked conidiation, regardless of the veA+ and veA1 alleles (note the CT numbers in Fig. 4D). These results indicate that FlbE is necessary for balanced progression of sexual and asexual development during the lifecycle. 3.5. The roles of AniflbE in autolysis and cell death We observed that, under liquid submerged culture conditions, the DAniflbE mutant appeared to proliferate better than WT during the first 24 h period and began to show disorganization of mycelium from days 2 to 6 (Fig. 5A), implying an altered growth pattern. To examine the effects of DAniflbE in vegetative growth, autolysis and cell death, we measured hyphal dry weights and Alamar Blue (AB) reduction rates (Shin et al., 2009). As shown in Fig. 5B, DAniflbE strain (TNJ32) showed the highest dry weight at day 1 and began to exhibit loss of hyphal mass at day 2, whereas WT (TNJ36) showed maximum dry weight at day 2 and began to lose hyphal mass at day 3. Overall dry weights of DAniflbE strain were slightly lower than those of WT. Dry weights between WT and DAniflbE strains at days 2 and 3 are statistically different with p-values of 0.040 and 0.029, respectively. These indicate that the lack of FlbE function results in accelerated autolysis in A. nidulans. As apoptotic cell death and autolysis are separate biological processes regulated independently (Shin et al., 2009), we checked whether the absence of flbE would influence cell death by determining AB reduction rates, which represent the activity of the living cells’ mitochondria. As presented in Fig. 5C, the DAniflbE mutant cells exhibited about 41% and 31% AB reduction rates at days 6 and 7, respectively,

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

987

Fig. 3. Differential requirement of FlbE in A. fumigatus development. A. fumigatus wild type (AF293), DAfuflbE (TKSS6.07) and complemented (DAfuflbE AfuflbE+; D/+ FNJ11) strains were inoculated in the YM liquid, and cultured for 18 h (Veg – 18 h) at 37 °C, 220 rpm. The mycelial pellets were then washed and transferred into the following liquid medium: MMG (MM), MMG with 0.6 M KCl (KCl), MM without C-source (–C), and MMG without N-source (–N). Photomicrographs were taken under a stereo-microscope at 12 h incubation after transfer. Arrowheads indicate complete (0.6 M KCl) and simple conidiophores (–C) produced by WT and complemented (D/+) strains. Bar = 20 lm.

whereas WT retained about 80% and 65% AB reduction rates at the same time points. Fig. 5D presents a clear color difference in AB reduction at day 6. These results suggest that FlbE is necessary for normal progression of autolysis and cell death in A. nidulans. 3.6. The effects of overexpression of AniflbE To further examine FlbE’s role, we generated multiple flbE overexpression (OEflbE) strains where the flbE ORF (derived from cDNA) is fused in-between the alcA promoter and the trpC terminator. Different from what were observed by previous study (Garzia et al., 2009), when these OEflbE strains were grown on the inducing medium they all exhibited the fluffy phenotype with highly restricted conidiation (one strain shown in Fig. 6A). Furthermore, OEflbE mutant colonies began to show disintegration of hyphae (autolysis) from 3 d after point inoculation, suggesting that balanced FlbE activity in the fungal cells might be crucial for proper progression of development in A. nidulans. We then investigated the effects of OEflbE on expression of brlA and vosA during asexual development in A. nidulans. In WT, as shown in Fig. 6B, brlA mRNA began to accumulate at 6 h post transfer of the mycelium onto solid MMT (to induce alcA and asexual development concurrently), remained at high levels during 6– 36 h, then became undetectable at 48 h and thereafter. However, in OEflbE strain, accumulation of brlA mRNA was detectable from 48 h to 96 h, i.e., about a 40 h delay in brlA mRNA accumulation compared to WT. In addition, vosA started to accumulate at 24 h, reached maximum at 36 h, and then decreased to certain level thereafter in WT. However, in OEflbE strain, low level accumulation of vosA mRNA was detectable at 48 h and thereafter. These results

suggest that FlbE plays a complex role in regulating growth and development in A. nidulans, which might be related with its physical and functional interactions with the b-zip TF FlbB (Etxebeste et al., 2008; Garzia et al., 2009) (see Section 4). Finally, to check the effects of OEflbE on autolysis and cell death in submerged culture conditions, both WT and OEflbE strains were initially grown in liquid MMG for 12–14 h and the mycelium was transferred to liquid MMT, further cultured, and subject to the measurement of dry weights and AB reduction rates every 24 h interval. As shown in Fig. 6C and D, upon induction of alcA(p)::flbE, OEflbE strain exhibited precocious and accelerated autolysis (starting at 3 d) and cell death (starting at 4 d). At 6 d, OEflbE strain displayed about one thirds of WT dry weights and AB reduction rates. In conjunction with the DflbE data (Fig. 5B–D), these results indicate that balanced levels of FlbE are crucial for proper maintenance of cell viability and integrity in A. nidulans. On the contrary, in A. fumigatus, neither overexpression nor deletion of AfuflbE caused elevated vegetative proliferation, or accelerated autolysis/cell death (data not shown), suggesting that the (indirect) effects of FlbE in two aspergilli might be different. 3.7. Further analyses of FlbE The 201 aa AniFlbE protein has two highly conserved regions separated by a linker sequence (Garzia et al., 2009). We tested whether these conserved domains had the trans-activation ability employing a modified yeast one hybrid system (Fig. 7). Full length, the N-terminal half (1st–108th aa: FlbE N-term), and the C-terminal half (93rd–201st aa: FlbE C-term) of FlbE were fused with the LexA DNA binding domain (LexA DBD) in the pTLexA vector and

988

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

Fig. 4. Phenotypes of the A. nidulans flbE deletion mutant. (A) Colonies of A. nidulans WT (FGSC4), flbE deletion (DAniflbE; TNJ32) and DAniflbE; AfuflbE+ (TNJ44) strains grown on solid MMG, 3 d at 37 °C. Note that one copy of AfuflbE+ could restore conidiation in the DAniflbE mutant. (B) mRNA levels of brlA and vosA in A. nidulans WT (FGSC26) and DflbE (TNJ15) strains induced for asexual development. Numbers indicate the time (h) post asexual developmental induction. Equal loading of total RNA was confirmed by ethidium bromide staining of rRNA. (C) A. nidulans WT (FGSC26) and DflbE (TNJ15) strains grown on solid MMG under the dark and air-limited condition for 2 d. Photomicrographs were taken under a stereo-microscope. CP: conidiophores, CT: cleistothecium, C: conidia, HC: Hülle cells. (D) Photomicrographs of colony surface in FGSC4 (WT, veA+), TNJ32 (DAniflbE; veA+), FGSC26 (WT, veA1) and TNJ15 (DAniflbE; veA1) under the dark and air-limited condition for 2 d. CT indicates the number of cleistothecia per cm2. Bar = 500 lm.

the ability of individual fusion constructs to trans-activate the HIS3 and b-galactosidase reporters in yeast was tested. As shown in Fig. 7A, only those yeast colonies expressing the LexADBD::FlbEN-term protein exhibited blue color on the X-gal SD medium lacking uracil. Quantification of the b-galactosidase activity of each construct in yeast using o-nitrophenyl-galactosidase (ONPG) further demonstrated that the N-terminal half of FlbE showed high levels of trans-activation activity in yeast, about 70% of that of the well known transcriptional activator AflR (Fig. 7B; Ni and Yu, 2007; Yu et al., 1996b). Furthermore, when five independent yeast strains were grown on the medium in the presence of 2 mM 3-AT (to validate the HIS3 reporter) without uracil and histidine, only those yeast strains expressing the N-terminal region of FlbE and AflR could grow (Fig. 7C). These results indicate that the highly conserved N-terminal region exhibits trans-activation activity in the budding yeast and the C-terminal half of FlbE might negatively affect such activity of FlbE. We further investigated a potential importance of the highly conserved GFRWPR motif present in the N-terminal region of FlbE (Fig. 7D), by substituting GFRWPR to AAAAAA through a site-

directed mutagenesis (Yu et al., 2004). The mutated construct was then cloned under the alcA promoter in pHS3 (Park and Yu, unpublished) or pTLexA and examined for its ability to cause autolysis upon overexpression in A. nidulans or to trans-activate b-galactosidase in yeast. As shown in Fig. 7E, the GFRWPR to AAAAAA substitution abolished the overexpression-induced autolysis in the presence of WT flbE. Moreover, the mutant FlbE failed to activate b-galactosidase (Fig. 7F), suggesting a potential importance of the conserved GFRWPR domain in the trans-activation ability and for the functionality of FlbE in vivo. Furthermore, complementation studies demonstrate that, while introduction of WT flbE restores a high level conidiation in the DflbE mutant, the flbE GFRWPR to AAAAAA mutant allele fails to do so (Fig. 7G), implying that this motif might be crucial for the functionality of FlbE. 3.8. Genetic position of FlbE Finally, we investigated the genetic position of FlbE in relation to flbB, flbC and flbD via generating various double mutants and assessing their developmental phenotypes. As shown in Fig. 8A,

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

989

Fig. 5. A potential role of flbE in autolysis and cell death in A. nidulans. (A) A. nidulans WT (TNJ36) and DAniflbE (TNJ32) strains were cultured in liquid MMG at 37 °C, and photographs were taken at 6 d. (B) Dry weights of WT and DflbE strains under submerged culture conditions. (C) AB reduction rates of WT and DflbE strains under submerged culture conditions. (D) Differences in AB reduction of WT and DflbE strains were visualized in color. Note that the color of DAniflbE strain stays in blue at day 6. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

the DflbE;OEflbB double mutant exhibited the fluffy delayed/reduced conidiation phenotype, which supports the idea that FlbE and FlbB are functionally inter-dependent and function at the same level (Etxebeste et al., 2009; Garzia et al., 2009). As FlbD functions downstream of flbE, the DflbE;OEflbD mutant restored conidiation upon overexpression of flbD, consistent with the model proposed by Garzia et al. (2010). Furthermore, flbD mRNA is not detected in the deletion and/or overexpression mutants of flbB and flbE (Fig. 8B). As FlbC and FlbE function in different routes, overexpression of flbC in the absence of flbE exhibits both phenotypes, fluffy and restricted hyphal growth (Kwon et al., 2010). It appears that accumulation of flbD mRNA was decreased in DflbC, and increased in OEflbC compared to WT (Fig. 8B). 4. Discussion In this report, we characterized the upstream developmental regulator FlbE in A. fumigatus and A. nidulans. While the resulting phenotypes were somewhat different in two species, the deletion of flbE resulted in severely reduced conidiation in both A. fumigatus and A. nidulans, implying functional conservation of FlbE for development in Aspergillus species. The observation that both DflbE mutants exhibited enhanced proliferation of vegetative cells in conjunction with reduced production of conidiophores supports the idea that FlbE may be an important part of the machinery gov-

erning the morphogenetic transition and balancing fungal growth and development. AfuFlbE plays a differential role in responding to various environmental factors in A. fumigatus. While AfuFlbE is not required for conidiation caused by the lack of N-source, it was necessary for conidiophore formation in response to 0.6 M KCl and the C-limited production of simple conidiophores (Fig. 3). In A. nidulans, FlbE was reported to be required for salt-induced development only (Garzia et al., 2009). Importantly, AfuflbE mRNA accumulates at relatively high levels throughout the lifecycle, whereas the AniflbE transcript is detectable specifically during the early phase (6–12 h) of vegetative growth (Fig. 1C and D). These indicate that, whereas functionally conserved, FlbE may affect different genes acting in diverse timing and transducing environmental signals during growth and development in Aspergillus. It appears that, in addition to activating conidiation, FlbE is (likely indirectly) associated with other biological processes including sexual fruiting, vegetative growth, cell death and autolysis. As shown in Fig. 4C, the A. nidulans DflbE mutant predominantly produced cleistothecia (sexual fruiting bodies) and Hülle cells (specialized structures supporting sexual fruiting; Ellis et al., 1973) under the conditions favoring sexual development. This was observed even in the presence of the veA1 allele, which generates a partially functional VeA (Kim et al., 2002). The VeA protein is an essential activator for sexual development, which in turn inhibits conidiation. The veA1 allele lacks the N-terminal NLS and results

990

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

Fig. 6. Overexpression of AniflbE causes enhanced autolysis and cell death in A. nidulans. (A) A. nidulans WT (FGSC26) and flbE overexpression (OEflbE; veA1; TNJ17) strains were point inoculated on solid non-inducing (MMG) and inducing (MMT + 0.5% YE) medium and observed for 4 d. The overexpression of flbE caused the lack of conidiation followed by hyphal disintegration at 4 d. (B) Changes in mRNA accumulation of brlA and vosA resulting from OEflbE in A. nidulans. Total RNA was isolated from A. nidulans WT (FGSC26) and OEflbE (TNJ17) strains induced for conidiation and overexpression of flbE on MMT after 12 h vegetative growth, and hybridized with the brlA and vosA probes. Equal loading of RNA was evaluated by ethidium bromide staining of rRNA. (C) Dry weights of WT (FGSC26) and OEflbE (TNJ17) strains grown under MMT + 0.5% YE submerged culture conditions at 37 °C, 220 rpm. Photographs of the cultures at day 6 are shown. (D) AB reduction rates of WT (FGSC26) and OEflbE (TNJ17) cells grown under submerged culture conditions at 37 °C, 220 rpm. Note that the color of OEAniflbE strain stays in blue at day 5, whereas that of WT turns into pink. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

in enhanced asexual development and highly reduced sexual fruiting (Kim et al., 2002). Thus, the absence of flbE at least partially suppresses the defects in sexual fruiting caused by veA1, indicating that proper activation of FlbE-dependent conidiation is required for balancing asexual and sexual development in A. nidulans. Furthermore, examination of mRNA levels of brlA and vosA suggests that FlbE is needed for the proper activation and deactivation of these genes. As shown in Fig. 4B, brlA and vosA mRNA was delayed and maintained until the late phase of conidiation in DAniflbE. This is different from what was observed by Garzia et al. (2009). While we do not know the reason for the differences in brlA expression, our results leads to a speculation that that low expression of vosA in the DAniflbE mutant may fail to confer the negative feedback control on brlA expression and, as a consequence, brlA mRNA accumulates at high levels for a prolonged period in the DAniflbE mutant. In addition, the absence of flbE resulted in accelerated hyphal growth followed by precocious hyphal disintegration and cell death (Fig. 5B–D). As flbA (Lee and Adams, 1994) mRNA accumulates at the same level until 3 d post asexual developmental

induction in both WT and DAniflbE (data not shown), altered autolysis and cell death caused by DflbE may be distinct from those resulting from DflbA. Interestingly, similar to DflbE, overexpression of flbE resulted in enhanced and precocious autolysis and cell death, but did not cause conidiophore development (Fig. 6A–D), distinct from the previous report (Garzia et al., 2009). These imply that FlbE is necessary for normal progression of vegetative growth and development during the lifecycle of A. nidulans. The FlbE protein is specific to filamentous fungi, not found in yeasts or higher eukaryotes (Garzia et al., 2009). While FlbE has no known domains, when aligned with putative homologs of FlbE, it is evident that the N-terminal region of FlbE is highly conserved (Garzia et al., 2009; see Fig. 7D). Our data suggest that this conserved N-terminal region of FlbE may have the transcriptional activation ability in yeast. As shown in Fig. 7, while the full-length FlbE protein and the C-terminal portion of FlbE failed to trans-activate the reporters, the N-terminal half (1st–108th aa) of FlbE clearly showed the ability to activate the HIS3 and b-galactosidase reporters in yeast. Moreover, the highly conserved GFRWPR motif may be

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

991

Fig. 7. Further analyses of FlbE. (A) Colony photographs of yeast strains expressing AflR (positive control; Ni and Yu, 2007; Yu et al., 1996b), pTLex vector (negative control; LexA DNA binding domain only), the full-length FlbE (FlbE full; 1–201 aa), the N-terminal region (1–108 aa; FlbE N-term), and the C-terminal region (93–201 aa; FlbE C-term) of FlbE on the X-Gal medium without uracil (–U/X-gal). (B) Quantitative analyses of b-galactosidase activities using ONPG in yeast strains shown in A. (C) Individual yeast strains were spotted on MM without uracil (–U) or without uracil and histidine (–UH), and incubated at 30 °C for 3 d. (D) The conserved GFRWPR motif at the N-terminal region of FlbE proteins is marked with , and subjected to the AAAAAA substitution in AniFlbE. (E) Phenotypes of overexpression of the flbE mutant (GFRWPR?AAAAAA) allele under the alcA promoter. Note that the mutant allele no longer causes the autolytic phenotype under inducing condition. (F) b-galactosidase activities in yeast strains expressing FlbE full (F), FlbE N-term (N) and FlbE mutant allele (Mut) including positive (+) and negative () controls. Note the lack of trans-activation activity in the mutant allele. (G) Phenotypes of colonies of WT (TNJ36), DAniflbE, DAniflbE alcA(p)::AniflbE and DflbE alcA(p)::AniflbEGFRWPR?AAAAAA strains grown on solid MMG for 3 d at 37 °C. Note that the mutant allele fails to restore conidiation in DflbE.

crucial for the functionality of FlbE in Aspergillus (Fig. 7G). These results leads a simple speculation that the N-terminal region of FlbE may be associated with activation of downstream (developmental) genes and the C-terminal half of FlbE may be involved in modulation of such activity. However, thus far, there is no documented evidence for the nuclear localization of FlbE and/or the identifica-

tion of any gene under the direct control of FlbE in Aspergillus. Further studies for the potential role of FlbE as a putative TF remain to be carried out. FlbB is a putative b-zip TF conserved in filamentous fungi (Etxebeste et al., 2008). While FlbB is necessary for brlA expression, overexpression of flbB inhibits conidiation, too. Recent study by

992

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993

regulators may form a complex that is located at the hyphal apex. It was further demonstrated that the absence of FlbE resulted in miss-localization and partial degradation of FlbB, indicating a potential role of FlbE in allowing proper localization and function of FlbB at or near the Spitzenkörper (Garzia et al., 2009). In addition, through extracellular complementation and double mutant genetic analyses, it was further proposed that FlbE and FlbB might be associated with the production of the same diffusible extracellular signal(s), and that FlbE and FlbB might function at the same genetic level downstream of FluG (Garzia et al., 2009). In conjunction with these observations, our flbE overexpression and deletion studies led us to speculate that a quantitative balance between FlbE and FlbB is critical for normal growth and development, and overexpression of any one of these regulators may result in the perturbation of balanced relationships between FlbE and FlbB, likely leading to the impairment in subsequent developmental functions and improper activation of flbD (Garzia et al., 2010). Results of our double mutant analyses are generally in agreement with the proposed genetic position of FlbE, FlbB, FlbC and FlbD on activating conidiation and brlA (Garzia et al., 2009, 2010; Kwon et al., 2010). However, it appears that FlbE might have a role upstream of FlbB. As shown in Fig. 8, the OEflbD;DflbE mutant could produce conidiophores near WT level upon induction of flbD overexpression, whereas the overexpression of flbD in the absence of flbB failed to restore conidiation (Garzia et al., 2010). Moreover, the removal of the key repressor of conidiation sfgA could bypass the requirement of flbE, but not flbB, for conidiation (Seo et al., 2006). Further genetic and genomic studies would be necessary to dissect the potential distinct roles of FlbE, FlbB and other developmental regulators. Acknowledgments We thank our lab members for helpful discussions, and Ellin Doyle for critically reviewing the manuscript. This work was supported by National Science Foundation (IOS-0640067 and IOS0950850) and UW Food Research Institute Grants to J.H.Y. The work carried out at Daejeon University was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2010-0007836). References

Fig. 8. Genetic epistasis among upstream developmental regulators. (A) WT (TNJ36), DflbE, DflbE OEflbB, DflbE OEflbC, DflbE OEflbD and OEflbD strains grown on solid MMG and MMT + 0.5% YE for 3 d at 37 °C. Note that DflbE OEflbD and OEflbD strains exhibit the identical phenotype, i.e., flbD is epistatic to flbE. The DflbE OEflbC double mutant exhibits both the DflbE and OEflbC (restricted growth; Kwon et al., 2010) phenotypes, further confirming that FlbE and FlbC function in separate pathways. (B) mRNA levels of AniflbD in WT (FGSC4), DAniflbB (TJW113), DAniflbC (TNJ31), DAniflbE (TNJ32), OEflbB (TNI16.2), OEflbC (TNJ41) and OEflbE (TNJ84) strains. Individual deletion mutant and WT strains were cultured in liquid MMG 220 rpm, 37 °C for 18 h then subject to total RNA isolation. Overexpression and WT strains were cultured in liquid MMG 220 rpm, 37 °C for 12 h, transferred to liquid MMT, further cultured 220 rpm, 37 °C for 6 h, then subject to total RNA isolation. The putative A. fumigatus c-actin gene (Afu6g04740) and ethidium bromide stained rRNA were used to evaluate equal loading of total RNA and Northern blot hybridization.

Garzia and colleagues (2009) demonstrated that FlbE and FlbB are functionally inter-dependent and these two developmental

Adams, T.H., Timberlake, W.E., 1990. Upstream elements repress premature expression of an Aspergillus developmental regulatory gene. Mol. Cell Biol. 10, 4912–4919. Adams, T.H., Boylan, M.T., Timberlake, W.E., 1988. BrlA is necessary and sufficient to direct conidiophore development in Aspergillus nidulans. Cell 54, 353–362. Adams, T.H., Wieser, J.K., Yu, J.H., 1998. Asexual sporulation in Aspergillus nidulans. Microbiol. Mol. Biol. Rev. 62, 35–54. Andrianopoulos, A., Timberlake, W.E., 1994. The Aspergillus nidulans abaA gene encodes a transcriptional activator that acts as a genetic switch to control development. Mol. Cell Biol. 14, 2503–2515. Brent, R., Ptashne, M., 1985. A eukaryotic transcriptional activator bearing the DNA specificity of a prokaryotic repressor. Cell 43, 729–736. Brookman, J.L., Denning, D.W., 2000. Molecular genetics in Aspergillus fumigatus. Curr. Opin. Microbiol. 3, 468–474. Chang, Y.C., Timberlake, W.E., 1992. Identification of Aspergillus brlA response elements (BREs) by genetic selection in yeast. Genetics 133, 29–38. Cho, J.H., Yun, S.S., Jang, Y.K., Cha, M.J., Kwon, N.J., Chae, S.K., 2003. Identification and cloning of jipA encoding a polypeptide that interacts with a homolog of yeast Rad6, UVSJ in Aspergillus nidulans. J. Microbiol. 41, 46–51. Ellis, T.T., Reynolds, D.R., Alexopoulos, C.J., 1973. Hülle cells development in Emericella nidulans. Mycologia 65, 1029–1035. Etxebeste, O., Ni, M., Garzia, A., Kwon, N.J., Fischer, R., Yu, J.H., Espeso, E.A., Ugalde, U., 2008. Basic-zipper-type transcription factor FlbB controls asexual development in Aspergillus nidulans. Eukaryot. Cell 7, 38–48. Etxebeste, O., Herrero-García, E., Araújo-Bazán, L., Rodríguez-Urra, A.B., Garzia, A., Ugalde, U., Espeso, E.A., 2009. The bZIP-type transcription factor FlbB regulates distinct morphogenetic stages of colony formation in Aspergillus nidulans. Mol. Microbiol. 73, 775–789.

N.-J. Kwon et al. / Fungal Genetics and Biology 47 (2010) 981–993 Fidel, S., Doonan, J.H., Morris, N.R., 1988. Aspergillus nidulans contains a single actin gene which has unique intron locations and encodes a gamma-actin. Gene 70, 283–293. Garzia, A., Etxebeste, O., Herrero-Garcia, E., Fischer, R., Espeso, E.A., Ugalde, U., 2009. Aspergillus nidulans FlbE is an upstream developmental activator of conidiation functionally associated with the putative transcription factor FlbB. Mol. Microbiol. 71, 172–184. Garzia, A., Etxebeste, O., Herrero-García, E., Ugalde, U., Espeso, E.A., 2010. The concerted action of bZip and cMyb transcription factors FlbB and FlbD induces brlA expression and asexual development in Aspergillus nidulans. Mol. Microbiol. 75, 1314–1324. Gwynne, D.I., Buxton, F.P., Sibley, S., Davies, R.W., Lockington, R.A., Scazzocchio, C., Sealy-Lewis, H.M., 1987. Comparison of the cis-acting control regions of two coordinately controlled genes involved in ethanol utilization in Aspergillus nidulans. Gene 51, 205–216. Ito, H., Fukuda, Y., Murata, K., Kimura, A., 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153, 163–168. Käfer, E., 1977. Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv. Genet. 19, 33–131. Kellner, E.M., Adams, T.H., 2002. Mutations in sfdA and sfdB suppress multiple developmental mutations in Aspergillus nidulans. Genetics 160, 159–168. Kim, H.S., Han, K.Y., Kim, K.J., Han, D.M., Jahng, K.Y., Chae, K.S., 2002. The veA gene activates sexual development in Aspergillus nidulans. Fung. Genet. Biol. 37, 72–80. Kwon, N.J., Garzia, A., Espeso, E.A., Ugalde, U., Yu, J.H., 2010. FlbC is a putative nuclear C2H2 transcription factor regulating development in Aspergillus nidulans. Mol. Microbiol. 77, 1203–1219. Lee, B.N., Adams, T.H., 1994. Overexpression of flbA, an early regulator of Aspergillus asexual sporulation leads to activation of brlA and premature initiation of development. Mol. Microbiol. 14, 323–334. Lee, K.H., Na, D.S., Kim, J.W., 1999. Calcium-dependent interaction of annexin I with annexin II and mapping of the interaction sites. FEBS Lett. 442, 143–146. Mah, J.H., Yu, J.H., 2006. Upstream and downstream regulation of asexual development in Aspergillus fumigatus. Eukaryot. Cell 5, 1585–1595. Marshall, M.A., Timberlake, W.E., 1991. Aspergillus nidulans wetA activates sporespecific gene expression. Mol. Cell Biol. 11, 55–62. McBride, J., Ingram, P.R., Henriquez, F.L., Roberts, C.W., 2005. Development of colorimetric microtiter plate assay for the assessment of antimicrobials against Acanthamoeba. J. Clin. Microbiol. 43, 629–634. Ni, M., Yu, J.H., 2007. A novel regulator couples sporogenesis and trehalose biogenesis in Aspergillus nidulans. PLoS ONE 2, e970. Ni, M., Gao, N., Kwon, N.J., Shin, K.S., Yu, J.H., 2010. Regulation of Aspergillus conidiation. In: Borkovich, K.A., Ebbole, D.J. (Eds.), Cellular and Molecular Biology of Filamentous Fungi. ASM Press, Washington, DC, pp. 559–576. Osmani, A.H., May, G.S., Osmani, S.A., 1999. The extremely conserved pyroA gene of Aspergillus nidulans is required for pyridoxine synthesis and is required indirectly for resistance to photosensitizers. J. Biol. Chem. 274, 23565–23569. Pontecorvo, G., Roper, J.A., Hemmons, L.M., Macdonald, K.D., Bufton, A.W., 1953. The genetics of Aspergillus nidulans. Adv. Genet. 5, 141–238.

993

Prade, R.A., Timberlake, W.E., 1994. The Penicillium chrysogenum and Aspergillus nidulans wetA developmental regulatory genes are functionally equivalent. Mol. Gen. Genet. 244, 539–547. Seo, J.A., Guan, Y., Yu, J.H., 2006. FluG-dependent asexual development in Aspergillus nidulans occurs via derepression. Genetics 172, 1535–1544. Sewall, T.C., Mims, C.W., Timberlake, W.E., 1990. AbaA controls phialide differentiation in Aspergillus nidulans. Plant Cell 2, 731–739. Sherman, F., 1991. Getting started with yeast. Methods Enzymol. 194, 3–21. Shin, K.S., Kwon, N.J., Kim, Y.H., Park, H.S., Kwon, G.S., Yu, J.H., 2009. Differential roles of the ChiB chitinase in autolysis and cell death of Aspergillus nidulans. Eukaryot. Cell 8, 738–746. Skromne, I., Sanchez, O., Aguirre, J., 1995. Starvation stress modulates the expression of the Aspergillus nidulans brlA regulatory gene. Microbiology 141, 21–28. Szewczyk, E., Nayak, T., Oakley, C.E., Edgerton, H., Xiong, Y., Taheri-Talesh, N., Osmani, S.A., Oakley, B.R., 2006. Fusion PCR and gene targeting in Aspergillus nidulans. Nat. Protoc. 1, 3111–3120. Wieser, J., 1997. Genetic requirements for initiation of Aspergillus nidulans conidiophore development. PhD Dissertation, Texas A&M University. Wieser, J., Adams, T.H., 1995. FlbD encodes a Myb-like DNA-binding protein that coordinates initiation of Aspergillus nidulans conidiophore development. Genes Dev. 9, 491–502. Wieser, J., Lee, B.N., Fondon 3rd, J., Adams, T.H., 1994. Genetic requirements for initiating asexual development in Aspergillus nidulans. Curr. Genet. 27, 62–69. Xue, T., Nguyen, C.K., Romans, A., Kontoyiannis, D.P., May, G.S., 2004. Isogenic auxotrophic mutant strains in the Aspergillus fumigatus genome reference strain AF293. Arch. Microbiol. 182, 346–353. Yamada, O., Lee, B.R., Gomi, K., Iimura, Y., 1999. Cloning and functional analysis of the Aspergillus oryzae conidiation regulator gene brlA by its disruption and misscheduled expression. J. Biosci. Bioeng. 87, 424–429. Yamazaki, H., Yamazaki, D., Takaya, N., Takagi, M., Ohta, A., Horiuchi, H., 2007. A chitinase gene, chiB, involved in the autolytic process of Aspergillus nidulans. Curr. Genet. 51, 89–98. Yelton, M.M., Hamer, J.E., de Souza, E.R., Mullaney, E.J., Timberlake, W.E., 1983. Developmental regulation of the Aspergillus nidulans trpC gene. Proc. Natl. Acad. Sci. USA 80, 7576–7580. Yu, J.H., Leonard, T.J., 1995. Sterigmatocystin biosynthesis in Aspergillus nidulans requires a novel type I polyketide synthase. J. Bacteriol. 177, 4792–4800. Yu, J.H., Butchko, R.A., Fernandes, M., Keller, N.P., Leonard, T.J., Adams, T.H., 1996. Conservation of structure and function of the aflatoxin regulatory gene aflR from Aspergillus nidulans and A. Flavus. Curr. Genet. 29, 549–555. Yu, J.H., Hamari, Z., Han, K.H., Seo, J.A., Reyes-Domínguez, Y., Scazzocchio, C., 2004. Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet. Biol. 41, 973–981. Yu, J.H., Mah, J.H., Seo, J.A., 2006. Growth and developmental control in the model and pathogenic aspergilli. Eukaryot. Cell 5, 1577–1584.