- Email: [email protected]
Characterization of the Eimeria maxima sporozoite surface protein IMP1
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS Veterinary Parasitology xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Characterization of the Eimeria maxima sporozoite surface protein IMP1 M.C. Jenkins a,∗ , R. Fetterer a , K. Miska b , W. Tuo a , O. Kwok a , J.P. Dubey a a b
Animal Parasitic Diseases Laboratory, Beltsville Agricultural Research Center, ARS, USDA, Beltsville, MD 20705, USA Animal Bioscience & Biotechnology Laboratory, Beltsville Agricultural Research Center, ARS, USDA, Beltsville, MD 20705, USA
a r t i c l e
i n f o
Article history: Received 26 January 2015 Received in revised form 6 May 2015 Accepted 9 May 2015 Keywords: Eimeria Immunoprotective protein Gene expression
a b s t r a c t The purpose of this study was to characterize Eimeria maxima immune-mapped protein 1 (IMP1) that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transcription levels at 6–12 h of sporulation with a considerable downregulation thereafter. Alignment of IMP1 coding sequence from Houghton, Weybridge, and APU-1 strains of E. maxima revealed single nucleotide polymorphisms that in some instances led to amino acid changes in the encoded protein sequence. The E. maxima (APU-1) IMP1 cDNA sequence was cloned and expressed in 2 different polyHis Escherichia coli expression vectors. Regardless of expression vector, recombinant E. maxima IMP1 (rEmaxIMP1) was fairly unstable in non-denaturing buffer, which is consistent with stability analysis of the primary amino acid sequence. Antisera specific for rEmaxIMP1 identified a single 72 kDa protein or a 61 kDa protein by nonreducing or reducing SDS-PAGE/immunoblotting. Immunofluorescence staining with anti-rEmaxIMP1, revealed intense surface staining of E. maxima sporozoites, with negligible staining of merozoite stages. Immuno-histochemical staining of E. maxima-infected chicken intestinal tissue revealed staining of E. maxima developmental stages in the lamnia propia and crypts at both 24 and 48 h post-infection, and negligible staining thereafter. The expression of IMP1 during early stages of in vivo development and its location on the sporozoite surface may explain in part the immunoprotective effect of this protein against E. maxima infection. Published by Elsevier B.V.
1. Introduction Preventing outbreaks of avian coccidiosis involves medicating poultry feed with ionophore drugs or synthetic chemicals, or vaccination of newly hatched chicks with a mixture of live or attenuated Eimeria oocysts (for review see Shirley et al., 2007). Although these two approaches have been generally effective in controlling the disease, drug resistance in Eimeria and the lack of uniformity in vaccination have prompted the search for subunit vaccines. Numerous reports exist in the literature on the ability of recombinant Eimeria proteins to elicit strong cellular immune responses that confer some level of protection against Eimeria challenge infection (Yin et al., 2013, 2014; Zhang et al., 2014). These recombinant Eimeria proteins have been generated in a variety of bacterial and eukaryotic expression vectors, and even as transgenic Eimeria, and have been delivered to the avian immune system by different routes (Huang et al., 2011). However, reproducible and complete protec-
∗ Corresponding author. Tel.: +1 301 504 8054; fax: +1 301 504 5306. E-mail address: [email protected] (M.C. Jenkins).
tion against clinical parameters has not been reported to date for any recombinant Eimeria protein (McDonald and Shirley, 2009). One possible explanation, assuming that a single recombinant protein can elicit immune-mediated resistance, is that all antigens tested so far are not the primary target of protective immunity induced during a natural Eimeria infection. In a recent paper, a putative E. maxima protective antigen, termed immune-mapped protein 1 (IMP1), was identified through amplified fragment length polymorphism (AFLP) analysis of E. maxima strains (Houghton (H) and Weybridge (W)) that elicit negligible cross-immunity against one another in chickens (Blake et al., 2006, 2011). These authors further demonstrated that inoculation of chickens with E. maxima H strain sporozoites expressing E. maxima W strain IMP-1 could reduce oocysts shedding after a low dose E. maxima W challenge infection. The mechanism by which IMP1 elicits protection in chickens against E. maxima infection is unknown. However, in a recent study, it was shown that an IMP1 homologue in Eimeria tenella, expressed as a full-length protein or a C-terminal derivative, can elicit specific antibodies and IFN-␥ responses in chickens and confer partial protection against E. tenella challenge (Yin et al., 2013, 2014). The purpose of this paper was to characterize E. maxima
http://dx.doi.org/10.1016/j.vetpar.2015.05.009 0304-4017/Published by Elsevier B.V.
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
2
IMP1 protein by identifying the respective native protein, localize it in E. maxima sporozoites, merozoites, and observe its expression in tissue sections of chickens infected with E. maxima. 2. Materials & methods 2.1. Expression of Eimeria maxima IMP1 mRNA during oocyst sporulation E. maxima (APU-1) was propagated in susceptible chickens housed in a poultry building used only for E. maxima. All chicken studies were approved by the Beltsville Area Animal Care and Use Committee in accordance with American Association for Laboratory Animal Science standards. Purity of each E. maxima propagation was confirmed by microscopy and PCR analysis of DNA extracted from the oocysts using standard procedures (Jenkins et al., 2006). The isolation of E. maxima oocysts followed a standard protocol (Fetterer and Barfield, 2003) by processing fecal droppings 6 days after inoculation, and suspended the purified oocysts in 2.5% K2 Cr2 O7 in a 500 ml Erlenmeyer flask. Sporulation was accomplished by aerating the oocysts suspension in a shaking 28 ◦ C water bath. Aliquots of the E. maxima oocysts suspension were removed at 0, 6, 12, 18, 30, and 42 h, and pelleted by centrifugation at 3000 g for 10 min at 4 ◦ C. The recovered E. maxima oocysts were washed 2 times by repeated suspension in cold deionized H2 O and centrifugation, followed by treatment with 5% sodium hypochlorite (bleach) for 10 min on ice. The oocysts were then washed 5 times by repeated suspension in cold deionized H2 O and centrifugation. Oocyst RNA was prepared by suspending the oocysts in Trizol (Life Technologies, Carlsbad CA) and disrupting the oocysts by vortexing 3 times for 1 min/vortex. The quantity of RNA was measured using the NanoDrop 2000 Spectrophotometer (Thermo Scientific, Waltham, MA), and quality of RNA was determined with a BioAnalyzer 2100 (Agilent Technologies, Santa Clara, CA) instrument using a nano chip following procedures recommended by the manufacturer. Contaminating DNA was removed by treating the RNA sample with Turbo DNase (Invitrogen) for 30 min at 37 ◦ C. Complementary DNA (cDNA) was synthesized from 1 g of total RNA using the iScript Advanced cDNA synthesis kit (Bio-Rad Hercules, CA) according to the manufacturer’s protocol. As a control for possible genomic DNA contamination, a separate set of reactions were prepared for each RNA by performing reverse transcription (RT) in the absence of reverse transcriptase. E. maxima IMP1 transcript levels were measured by qRT-PCR using 1 l cDNA, 0.5 uM forward and reverse primer, and the SsoAdvanced SYBR green supermix (Bio-Rad) on a Mx3000P thermocycler (Agilent Technologies, Santa Clara, CA). Amplification of E. maxima IMP1 was conducted using EmaxIMP1-forward (5 GGTGATGCAGCATTTG 3 ) and EmaxIMP1reverse (5 TCAATCTTGCGACAC 3 ) primers. Amplification of the GAPDH house-keeping gene was conducted using GAPDH-forward (5 GAGGAAGTCGTCTCTCAGGA3 ) and GAPDH-reverse (5 TCTGTTGGAGTATCCCCACT 3 ) primers. The amplification conditions were 95 ◦ C for 30 s, followed by 35 cycles of 95 ◦ C for 30 s, 56 ◦ C for 1 min, 72 ◦ C for 1 min. Transcript levels relative to the nonsporulated controls (0 h timepoint) were estimated using the Ct method (Livak and Schmittgen, 2001) that uses the GAPDH housekeeping gene transcript to adjust for minor differences in total RNA between samples. 2.2. Cloning and expression of Eimeria maxima IMP1 The E. maxima IMP1 coding sequence (GenBank Accession Nos. FN813227 and FN813228) was amplified by RT-PCR using RNA from sporulating E. maxima (APU-1) oocysts. Primers for expression cloning were designed by first aligning the E. maxima
Weybridge (FN813227) and Houghton (FN813228) sequences to determine if nucleotide sequences downstream of the 5 ATG start site and upstream of the 3 TAG stop codon were identical. The forward EmaxrIMP1-F primer (5 ATTACTCGAGATGGGGGCCGCTT 3 ) contained a XhoI restriction site (underlined); the reverse EmaxrIMP1-R (5 ACAGGTACCTCAATCTTGCGACAC 3 ) contained a KpnI restriction site (underlined). RT-PCR conditions were identical to those described above for E. maxima IMP1 RT-PCR. The RT-PCR products were analyzed by gel electrophoresis in 7.5% nondenaturing acrylamide gels, followed by ethidium bromide (EtBr) staining, and visualization and capture on a GelLogic 200 Imaging System (Kodak). The remaining RT-PCR amplification products were purified using a QIA Quick PCR Purification Kit (Qiagen, Valencia, CA). The E. maxima IMP1 RT-PCR product and the plasmid expression vectors pTrcHis and pBad (Invitrogen) were digested with XhoI and KpnI (New England Biolabs, Ipswich, MA) for 2 h at 37 ◦ C, followed by agarose gel electrophoresis, EtBr staining, and visualization and capture on a GelLogic 200 Imaging System (Kodak). Restriction enzyme-digested E. maxima IMP1 cDNA sequence and expression plasmids pTrcHis and pBad were isolated using a QIA Quick Gel Purification kit (Qiagen), followed by ligation of insert to plasmid using T4 DNA ligase (NEB), and transformation into Escherichia coli DH5 using standard transformation methods (Hanahan, 1983). Recombinant pTrcHis and pBad plasmids containing E. maxima IMP1 cDNA were then transformed into E. coli BL21 or E. coli Top10 cells. Optimal expression of recombinant E. maxima IMP1 (rEmaxIMP1) was achieved at 37 ◦ C for 4 h from pTrcHis with 1 mM IPTG and from pBad with 0.2% arabinose. After a 4 h induction, E. coli expressing rE maxIMP1 were harvested by centrifugation, and serial extraction in native and denaturing binding buffers using procedures supplied by the manufacturer (Invitrogen). Recombinant EmaxIMP1was purified by NiNTA affinity chromatography (Qiagen) under native or denaturing conditions. 2.3. Preparation of polyclonal anti-recombinant Eimeria maxima IMP1 protein. Peak eluates from native and denaturing NiNTA purification were dialyzed overnight against PBS, and then reduced to 100 l volume using an Amicon Ultra-4 concentrator (Merck Millipore Ltd., Tullagreen, Ireland). Polyclonal antisera were prepared against rEmaxIMP1 protein by a commercial company (Pacific Immunology, Ramona, CA) by immunizing 2 rabbits over the course of 2 months with the primary immunization in Complete Freund’s Adjuvant, and 3 booster immunizations in Incomplete Freund’s Adjuvant. 2.4. Analysis of recombinant and native Eimeria maxima IMP1 protein Recombinant EmaxIMP1 or non-recombinant (from vector only controls) proteins were analyzed by SDS-PAGE followed by immunoblotting or Coomassie Blue staining. Native E. maxima oocysts protein was obtained by bead-beating fully sporulated oocysts for 2 min in 10 mM Tris pH8, 1 mM MgCl2 containing protease inhibitors (Pierce Chemical Co., Rockford, IL). Recombinant or native E. maxima protein was suspended in SDS-PAGE sample buffer (Laemmeli, 1970) with or without dithiothreitol (DTT), heated on a boiling H2 O bath for 1 min, pelleted by centrifugation for 5 min at 10,000 g to remove particulates, and electrophoresed by SDS-PAGE, followed by Coomassie Blue staining or transfer to Immobilon membrane (Millipore, Billerica, MA). In the latter, blots were washed briefly with phosphate-buffered saline (PBS), immersed in blocking solution (PBS containing 2% non-fat dry milk (PBS-NFDM)) for 30 min at room temperature (RT), and then incubated with polyclonal rabbit antisera specific for rEmaxIMP1
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
3
Fig 1. Alignment of DNA and predicted amino acid sequences using Clustal analysis of Eimeria maxima IMP1 cDNA sequences from 3 strains of E. maxima- APU1, Weybridge, and Houghton. Amino acids in bold type reflect missense mutations in the nucleic acid sequence.
protein or control sera (pre-immunization sera or rabbit antisera prepared against an irrelevant polyHis recombinant protein) at 1:1000 dilution in PBS containing 0.05% Tween 20 (PBS-Tw). Separate immunoblots of rEmaxIMP1 were probed with mouse anti-His
monoclonal antibodies (Invitrogen). After 2 h incubation at RT, the blots were probed with either biotin-labeled goat anti-rabbit IgG or anti-mouse IgG (Sigma Chemical Co., St. Louis, MO) followed by alkaline phosphatase-labeled avidin (Sigma), followed by NBT-
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7 4
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
BCIP substrate (Pierce Chemical Co.). All blots were washed 3 times between each incubation step with PBS-Tw.
2 1
2.5. Analysis of Eimeria maxima IMP1 stability Log2 Fold Change
Aqueous-soluble (native buffer) and denaturing soluble (6 M urea) rEmaxIMP1 protein was purified by NiNTA-affinity chromatography and incubated at 4 ◦ C for various lengths of time. In order to study recombinant protein breakdown over time, aliquots from NiNTA-purified aqueous soluble and denaturing soluble eluates were removed at 1, 3, 7, 13, and 27 weeks and mixed with an equal volume of SDS-PAGE sample buffer containing DTT to stabilize protein integrity. The time-course samples were analyzed by SDS-PAGE/immunoblotting followed by staining with mouse anti-His antibodies using the procedure described above.
0 -1 -2 -3 -4 -5 -6 0
6
12
18
30
42
Sporulation Time (hr)
2.6. Immunofluorescence staining Eimeria maxima sporozoites and merozoites E. maxima (APU-1) sporozoites and merozoites were isolated using described procedures (Fetterer et al., 2013). In brief, E. max-
Fig. 2. Time-course expression of Eimeria maxima IMP1 mRNA during sporulation of E. maxima oocysts as measured by RT-PCR analysis using primers directed to E. maxima IMP1 and Eimeria GAPDH. Transcript levels are expressed as relative to the 0 h (non-sporulated) timepoint using the Ct method.
Fig. 3. Immunoblotting analysis of recombinant Eimeria maxima IMP1 stability over time (A) and recognition of native E. maxima IMP1 protein using antisera specific for rEmaxIMP1 protein (B). Panel A, NiNTA-purified rEMaxIMP1 protein in denaturing soluble (6 M urea, DS) for incubated for 1 or 27 weeks or native soluble (NS) buffer incubated for 0, 3, 7, 13, and 27 wks at refrigeration temperature. Panel B, immunostaining Western blots of SDS-PAGE fractionated native E. maxima oocyst/sporozoite protein in the absence (−DTT) or presence (+DTT) of a reducing agent probed with anti-recombinant EmaxIMP1 protein (␣-Emax IMP1), preimmunization serum (PB), or antisera to an irrelevant recombinant His-tag protein (␣-HisrAg).
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
5
Fig. 4. Immunofluorescence staining of untreated (A–C) or methanol-treated (D) Eimeria maxima sporozoites with anti-recombinant EmaxIMP1 protein (A, D), preimmunization serum (B), or antisera to an irrelevant recombinant His-tag protein (C). Arrow points to surface staining. Bar = 15 M.
ima sporozoites were prepared by suspending sporulated oocysts in Hanks balanced salt solution (HBSS, Invitrogen, Carlsbad, CA) and grinding on ice in a 15 ml glass tube with a Teflon pestle until most of the oocysts were broken, and free sporocysts were visible by microscopy. The suspension was pelleted by centrifugation at 2500 g for 10 min., and the sporocysts-containing pellet was suspended in excystation medium (4% [w/v] sodium taurodeoxycholate (Sigma) and 0.25% trypsin (Sigma) in HBSS. Excystation was conducted at 41 ◦ C for approximately 1 h, and released E. maxima sporozoites were pelleted by centrifugation, resuspended in HBSS and purified by passage through a cellulose filter pad (Fuller and McDougald, 2001). For preparation of merozoites, outbred broiler chickens (Heritage breed, Longeneckers Hatchery) at 3 weeks of age were inoculated with 5000 E. maxima (APU-1) oocysts, and killed at 96 h post-inoculation. The mid-intestine (from the caudal end of the duodenal loop to Merckel’s diverticulum) was excised, rinsed with PBS, cut open longitudinally, rinsed gently with PBS to remove any excess digestate, and cut into 5 cm sections. The intestinal tissue was immersed in mucosal digestion medium (HBSS, 0.50% sodium taurodeoxycholate (Sigma), 97% TLC (Sigma), 0.25% trypsin (Sigma)) that had been pre-warmed to 41 ◦ C. The suspension was gently agitated for 20 min to allow for merozoite release. The tissue suspension containing released merozoites was passed through 4 layers of cheesecloth, and the filtrate was pelleted by centrifugation at 2500 g for 10 min. followed by suspension in HBSS. Merozoites were purified by passage through a cellulose filter pad using a procedure similar to sporozoite isolation. E. maxima sporozoites or merozoites were distributed to individual wells of 8-well microscope slides (Tekdon, Inc. Myakka City, FL) at 104 parasites/well, and allowed to air dry. The slides were either left untreated or were immersed in cold methanol for 5 min to permeabilize membranes followed by air drying. Individual wells were first treated with PBS-NFDM for 30 min at RT, then incubated
for 2 h at RT with a 1:5000 dilution of polyclonal rabbit antisera specific for rEmaxIMP1 protein or control sera similar to above, followed by a 1 h incubation at RT with a 1:100 dilution of FITClabeled goat anti-rabbit IgG (Sigma). The wells were washed 3 times between each step by immersing the entire slide in PBS and allowing wells to drain dry. Each well received 5 l Vectashield (Vector Laboratories, Burlingame, CA), overlaid with a coverslip, and examined by epifluorescence microscopy on a Zeiss microscope at 400–1000× magnification. Images were captured using a Zeiss AxioScope camera and AxioVision imaging software.
2.7. Immunohistochemical staining of Eimeria maxima-infected tissues Outbred broiler chickens (Heritage breed, Longeneckers Hatchery) at 3 weeks of age were inoculated with either 200,000 or 25,000 E. maxima (APU-1) oocysts. Intestinal tissues within 1 cm of Merckel’s diverticulum were harvested from high dose groups at 24 and 48 h and from the low dose group at 72, 96, and 120 h postinoculation. A high E. maxima dose was used for earlier timepoints because intracellular parasite numbers were found in previous studies to be extremely low due to insufficient merogonic development at 24 and 48 h. The intestinal tissue was immediately fixed in 10 % formalin for 30 min at RT, and stored in 100% ethanol until 10 m paraffin sections were prepared (Histoserve Inc. Gaithersburg, Maryland). Sections were deparaffinized and then treated with pepsin to expose reactive epitopes using a standard procedure (Dubey, 2010). After pepsin treatment, the sections were immunostained with a 1:500 dilution of rabbit anti-rEmaxIMP1 protein followed by Dako (Glostrup, Denmark) Envision with 3-amino-9-ethylcarbazole (AEC) as the substrate chromogen following manufacturer’s recommendation.
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
6
Fig. 5. Immunohistochemical staining of Eimeria maxima-infected chicken ileum tissue with antiserum specific for recombinant EmaxIMP1 protein (A–D) or a mixture of preimmunization serum and antiserum to an irrelevant recombinant His-tag protein (E, F). Ileum tissue harvested at 24 h (A, B, E) or 48 h (C, D, F) post-E. maxima oocyst inoculation. Arrow points to one of many intracellular stages reacting with anti-rEmaxIMP1 serum as indicated by dark brown staining.
3. Results and discussion Aligning the E. maxima Houghton and Weybridge IMP1 (Accession Nos. FN813227 and FN813228) and APU-1 IMP1 (Accession No. KP642747) sequences revealed 7 single nucleotide polymorphisms (SNP) among the sequences (Fig. 1). Of these SNPs, 4 were missense mutations resulting in changes to the encoded amino acid, while 3 were silent mutations. Applying Chou and Fasman Secondary Structure Prediction Software (Chou and Fasman, 1974) to the 3 IMP1 sequences showed that the conversion at amino acid residue 176 from a phenylalanine in the APU1 and Weybridge sequence to a valine in the Houghton sequence may alter the secondary structure of the IMP1 protein. Whether this explains the lack of cross-protection between the Houghton and Weybridge strains (Blake et al., 2006), and whether APU-1 can immunize against the Weybridge strain requires further study. Expression of E. maxima IMP1 mRNA was highest between 6 and 12 h, and decreased at 18–42 h sporulation (Fig. 2). Of note is that relative to the 0 h timepoint, IMP1 transcription was downregulated at 18 h sporulation and beyond (Fig. 2). It is possible that a fraction of E. maxima oocysts had already initiated sporulation because of the time expended between oocysts shedding and pro-
cessing of oocysts. However, our microscopic observation during sporulation of the E. maxima oocysts in this study revealed very few (<1%) sporulated oocysts before 30 h. Cloning EmaxIMP1 in 2 different polyHis fusion vectors resulted in a 65 kDa recombinant protein that was present in both native and denaturing extracts of the E. coli host. Unlike most recombinant proteins generated in E. coli, rEmaxIMP1 appeared to be somewhat unstable in aqueous, non-denaturing buffer. Immunoblotting and Coomassie blue staining of SDS-PAGE fractionated rEmaxIMP1 showed that by 27 weeks no 65 kDa rEmaxIMP1 protein was present (Fig. 3A). This degradation was probably not due to protease-mediated breakdown because incubating NiNTA-purified rEmaxIMP1 in the presence or absence of protease inhibitors showed no difference in the stability of the protein (unpublished observations). For reasons unknown, rEmaxIMP1 was stable in buffer containing 6 M urea (denaturing buffer) because no decrease in the amount of recombinant protein was observed over the same time period (Fig. 3A). Consistent with this observation is the calculated instability index equal to 56.3; proteins with an instability index greater than 40 are considered unstable (Guruprasad et al., 1990). What biological function this has in the E. maxima life cycle or induction of immunity to E. maxima is unknown.
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
Polyclonal antisera specific for rEmaxIMP1 identified a 72 kDa protein in non-reducing SDS-PAGE immunoblots and a 61 kDa protein in reducing SDS-PAGE immunoblots of native E. maxima sporozoite protein (Fig. 3B). It is unclear why under both reducing and non-reducing conditions, native E. maxima migrates at a considerably higher relative mass (Mr) than 40 kDa as predicted by the primary amino acid sequence. Searching of the EmaxIMP1 sequence revealed a single well supported Nglycosylation site (residues 268–270) (NetNGlyc 1.0, 2015) and numerous O-glycosylation sites (YinOYang 1.2, 2014). Thus, Nand O-glycosylation of the native E. maxima IMP1 protein may increase its apparent Mr as observed by SDS-PAGE. The difference in observed Mr under non-reducing and reducing SDS-PAGE suggests that folding of EmaxIMP1 involves disulfide bonds between 2 of the 3 cysteines present in the protein. Immunofluorescence staining with anti-rEmaxIMP1 serum revealed intense surface staining in both dried and methanoltreated E. maxima APU-1 sporozoites (Fig. 4A, D), but not in E. maxima merozoites (data not shown). The similarity in IFA staining of dried and methanol-treated E. maxima sporozoites suggests that the IMP1 protein is associated with the parasite surface and not with internal structures because internal staining would be expected with methanol-permeabilized parasites. Preimmunization serum or antiserum to an irrelevant polyHis recombinant protein showed extremely light staining of sporozoites which was restricted to the apical tip of the parasites (Fig. 4 B, C). Somewhat perplexing is that analysis of the amino acid sequence failed to identify any signal sequence or transmembrane region. Immunohistochemical staining of ilea tissue sections from E. maxima APU1-infected chickens revealed E. maxima developmental stages at 24 and 48 h post-infection (Fig. 5). Similar to previous observations (Riley and Fernando, 1988), early developmental stages of E. maxima were present in both the lamnia propria and crypts of the intestinal villi at both timepoints (Fig. 5A–D). Very faint staining of intracellular stages was observed at later timepoints (72–120 h, data not shown). Expression of an immunoreactive protein during early stages of development may explain in part the protective role IMP1 plays in acquired resistance to E. maxima since natural immunity is believed to be directed at early developmental stages (Jeffers and Long, 1985; Jenkins et al., 1993, 1997). Conflict of interest The authors report no conflict of interest. Acknowlckedgements The authors acknowledge the technical assistance of Carolyn Parker in the study. This project was solely funded by the USDA-ARS CRIS project “Development and Control of Intervention Strategies for Avian Coccidiosis”- Project No. 1265-31320-0076-00D.
7
References Blake, D.P., Billington, K.J., Copestake, S.L., Oakes, R.D., Quail, M.A., Wan, K.L., Shirley, M.W., Smith, A.L., 2011. Genetic mapping identifies novel highly protective antigens for an apicomplexan parasite. PLoS Pathog. 7, 1–13. Blake, D.P., Shirley, M.W., Smith, A.L., 2006. Genetic identification of antigens protective against coccidia. Parasite Immunol. 28, 305–314. Chou, P.Y., Fasman, G.D., 1974. Prediction of protein conformation. Biochem. 13, 222-245. CFSSP- Chou and Fassaman Secondary Structure Prediction Software http://www.biogem.org/tool/chou-fasman/ (accessed 05.05.15.). Dubey, J.P., 2010. Toxoplasmosis of Animals and Humans, 2nd ed. CRC Press, Boca Raton, FL, 313p. Fetterer, R.H., Barfield, R.C., 2003. Characterization of a developmentally regulated oocyst protein from Eimeria tenella. J. Parasitol. 89, 553–564. Fetterer, R.H., Schwarz, R.S., Miska, K.B., Jenkins, M.C., Barfield, R.C., Murphy, C., 2013. Characterization and localization of an Eimeria-specific protein in Eimeria maxima. Parasitol. Res. 112, 3401–3408. Guruprasad, K., Reddy, B.V.B., Pandit, M.W., 1990. Correlation between stability of a protein and its dipeptide composition: a novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Eng. 4, 155–161. Hanahan, D., 1983. Studies on the transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580. Huang, X., Zou, J., Xu, H., Ding, Y., Yin, G., Liu, X., Suo, X., 2011. Transgenic Eimeria tenella expressing enhanced yellow fluorescent protein targeted to different cellular compartments stimulated dichotomic immune responses in chickens. J. Immunol. 187, 3595–3602. Jeffers, T.K., Long, P.L., 1985. Eimeria tenella: immunogenicity of arrested sporozoites in chickens. Exp. Parasitol. 60, 175–180. Jenkins, M.C., Chute, M.B., Danforth, H.D., 1997. Protection against coccidiosis in outbred chickens elicited by gamma-irradiated Eimeria maxima. Avian Dis. 41, 702–708. Jenkins, M.C., Miska, K., Klopp, S., 2006. Improved polymerase chain reaction technique for determining the species composition of Eimeria in poultry litter. Avian Dis. 50, 632–635. Jenkins, M.C., Seferian, P.G., Augustine, P.C., Danforth, H.D., 1993. Protective immunity against coccidiosis elicited by radiation-attenuated Eimeria maxima sporozoites that are incapable of asexual development. Avian Dis. 37, 74–82. Laemmeli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−Ct Method. Methods 25, 402–408. McDonald, V., Shirley, M.W., 2009. Past and future: vaccination against Eimeria. Parasitology 136, 1477–1489. NetNGlyc 1.0 (2015) Center for Biological Sequence Analysis.
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
ARTICLE IN PRESS Veterinary Parasitology xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Characterization of the Eimeria maxima sporozoite surface protein IMP1 M.C. Jenkins a,∗ , R. Fetterer a , K. Miska b , W. Tuo a , O. Kwok a , J.P. Dubey a a b
Animal Parasitic Diseases Laboratory, Beltsville Agricultural Research Center, ARS, USDA, Beltsville, MD 20705, USA Animal Bioscience & Biotechnology Laboratory, Beltsville Agricultural Research Center, ARS, USDA, Beltsville, MD 20705, USA
a r t i c l e
i n f o
Article history: Received 26 January 2015 Received in revised form 6 May 2015 Accepted 9 May 2015 Keywords: Eimeria Immunoprotective protein Gene expression
a b s t r a c t The purpose of this study was to characterize Eimeria maxima immune-mapped protein 1 (IMP1) that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transcription levels at 6–12 h of sporulation with a considerable downregulation thereafter. Alignment of IMP1 coding sequence from Houghton, Weybridge, and APU-1 strains of E. maxima revealed single nucleotide polymorphisms that in some instances led to amino acid changes in the encoded protein sequence. The E. maxima (APU-1) IMP1 cDNA sequence was cloned and expressed in 2 different polyHis Escherichia coli expression vectors. Regardless of expression vector, recombinant E. maxima IMP1 (rEmaxIMP1) was fairly unstable in non-denaturing buffer, which is consistent with stability analysis of the primary amino acid sequence. Antisera specific for rEmaxIMP1 identified a single 72 kDa protein or a 61 kDa protein by nonreducing or reducing SDS-PAGE/immunoblotting. Immunofluorescence staining with anti-rEmaxIMP1, revealed intense surface staining of E. maxima sporozoites, with negligible staining of merozoite stages. Immuno-histochemical staining of E. maxima-infected chicken intestinal tissue revealed staining of E. maxima developmental stages in the lamnia propia and crypts at both 24 and 48 h post-infection, and negligible staining thereafter. The expression of IMP1 during early stages of in vivo development and its location on the sporozoite surface may explain in part the immunoprotective effect of this protein against E. maxima infection. Published by Elsevier B.V.
1. Introduction Preventing outbreaks of avian coccidiosis involves medicating poultry feed with ionophore drugs or synthetic chemicals, or vaccination of newly hatched chicks with a mixture of live or attenuated Eimeria oocysts (for review see Shirley et al., 2007). Although these two approaches have been generally effective in controlling the disease, drug resistance in Eimeria and the lack of uniformity in vaccination have prompted the search for subunit vaccines. Numerous reports exist in the literature on the ability of recombinant Eimeria proteins to elicit strong cellular immune responses that confer some level of protection against Eimeria challenge infection (Yin et al., 2013, 2014; Zhang et al., 2014). These recombinant Eimeria proteins have been generated in a variety of bacterial and eukaryotic expression vectors, and even as transgenic Eimeria, and have been delivered to the avian immune system by different routes (Huang et al., 2011). However, reproducible and complete protec-
∗ Corresponding author. Tel.: +1 301 504 8054; fax: +1 301 504 5306. E-mail address: [email protected] (M.C. Jenkins).
tion against clinical parameters has not been reported to date for any recombinant Eimeria protein (McDonald and Shirley, 2009). One possible explanation, assuming that a single recombinant protein can elicit immune-mediated resistance, is that all antigens tested so far are not the primary target of protective immunity induced during a natural Eimeria infection. In a recent paper, a putative E. maxima protective antigen, termed immune-mapped protein 1 (IMP1), was identified through amplified fragment length polymorphism (AFLP) analysis of E. maxima strains (Houghton (H) and Weybridge (W)) that elicit negligible cross-immunity against one another in chickens (Blake et al., 2006, 2011). These authors further demonstrated that inoculation of chickens with E. maxima H strain sporozoites expressing E. maxima W strain IMP-1 could reduce oocysts shedding after a low dose E. maxima W challenge infection. The mechanism by which IMP1 elicits protection in chickens against E. maxima infection is unknown. However, in a recent study, it was shown that an IMP1 homologue in Eimeria tenella, expressed as a full-length protein or a C-terminal derivative, can elicit specific antibodies and IFN-␥ responses in chickens and confer partial protection against E. tenella challenge (Yin et al., 2013, 2014). The purpose of this paper was to characterize E. maxima
http://dx.doi.org/10.1016/j.vetpar.2015.05.009 0304-4017/Published by Elsevier B.V.
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
2
IMP1 protein by identifying the respective native protein, localize it in E. maxima sporozoites, merozoites, and observe its expression in tissue sections of chickens infected with E. maxima. 2. Materials & methods 2.1. Expression of Eimeria maxima IMP1 mRNA during oocyst sporulation E. maxima (APU-1) was propagated in susceptible chickens housed in a poultry building used only for E. maxima. All chicken studies were approved by the Beltsville Area Animal Care and Use Committee in accordance with American Association for Laboratory Animal Science standards. Purity of each E. maxima propagation was confirmed by microscopy and PCR analysis of DNA extracted from the oocysts using standard procedures (Jenkins et al., 2006). The isolation of E. maxima oocysts followed a standard protocol (Fetterer and Barfield, 2003) by processing fecal droppings 6 days after inoculation, and suspended the purified oocysts in 2.5% K2 Cr2 O7 in a 500 ml Erlenmeyer flask. Sporulation was accomplished by aerating the oocysts suspension in a shaking 28 ◦ C water bath. Aliquots of the E. maxima oocysts suspension were removed at 0, 6, 12, 18, 30, and 42 h, and pelleted by centrifugation at 3000 g for 10 min at 4 ◦ C. The recovered E. maxima oocysts were washed 2 times by repeated suspension in cold deionized H2 O and centrifugation, followed by treatment with 5% sodium hypochlorite (bleach) for 10 min on ice. The oocysts were then washed 5 times by repeated suspension in cold deionized H2 O and centrifugation. Oocyst RNA was prepared by suspending the oocysts in Trizol (Life Technologies, Carlsbad CA) and disrupting the oocysts by vortexing 3 times for 1 min/vortex. The quantity of RNA was measured using the NanoDrop 2000 Spectrophotometer (Thermo Scientific, Waltham, MA), and quality of RNA was determined with a BioAnalyzer 2100 (Agilent Technologies, Santa Clara, CA) instrument using a nano chip following procedures recommended by the manufacturer. Contaminating DNA was removed by treating the RNA sample with Turbo DNase (Invitrogen) for 30 min at 37 ◦ C. Complementary DNA (cDNA) was synthesized from 1 g of total RNA using the iScript Advanced cDNA synthesis kit (Bio-Rad Hercules, CA) according to the manufacturer’s protocol. As a control for possible genomic DNA contamination, a separate set of reactions were prepared for each RNA by performing reverse transcription (RT) in the absence of reverse transcriptase. E. maxima IMP1 transcript levels were measured by qRT-PCR using 1 l cDNA, 0.5 uM forward and reverse primer, and the SsoAdvanced SYBR green supermix (Bio-Rad) on a Mx3000P thermocycler (Agilent Technologies, Santa Clara, CA). Amplification of E. maxima IMP1 was conducted using EmaxIMP1-forward (5 GGTGATGCAGCATTTG 3 ) and EmaxIMP1reverse (5 TCAATCTTGCGACAC 3 ) primers. Amplification of the GAPDH house-keeping gene was conducted using GAPDH-forward (5 GAGGAAGTCGTCTCTCAGGA3 ) and GAPDH-reverse (5 TCTGTTGGAGTATCCCCACT 3 ) primers. The amplification conditions were 95 ◦ C for 30 s, followed by 35 cycles of 95 ◦ C for 30 s, 56 ◦ C for 1 min, 72 ◦ C for 1 min. Transcript levels relative to the nonsporulated controls (0 h timepoint) were estimated using the Ct method (Livak and Schmittgen, 2001) that uses the GAPDH housekeeping gene transcript to adjust for minor differences in total RNA between samples. 2.2. Cloning and expression of Eimeria maxima IMP1 The E. maxima IMP1 coding sequence (GenBank Accession Nos. FN813227 and FN813228) was amplified by RT-PCR using RNA from sporulating E. maxima (APU-1) oocysts. Primers for expression cloning were designed by first aligning the E. maxima
Weybridge (FN813227) and Houghton (FN813228) sequences to determine if nucleotide sequences downstream of the 5 ATG start site and upstream of the 3 TAG stop codon were identical. The forward EmaxrIMP1-F primer (5 ATTACTCGAGATGGGGGCCGCTT 3 ) contained a XhoI restriction site (underlined); the reverse EmaxrIMP1-R (5 ACAGGTACCTCAATCTTGCGACAC 3 ) contained a KpnI restriction site (underlined). RT-PCR conditions were identical to those described above for E. maxima IMP1 RT-PCR. The RT-PCR products were analyzed by gel electrophoresis in 7.5% nondenaturing acrylamide gels, followed by ethidium bromide (EtBr) staining, and visualization and capture on a GelLogic 200 Imaging System (Kodak). The remaining RT-PCR amplification products were purified using a QIA Quick PCR Purification Kit (Qiagen, Valencia, CA). The E. maxima IMP1 RT-PCR product and the plasmid expression vectors pTrcHis and pBad (Invitrogen) were digested with XhoI and KpnI (New England Biolabs, Ipswich, MA) for 2 h at 37 ◦ C, followed by agarose gel electrophoresis, EtBr staining, and visualization and capture on a GelLogic 200 Imaging System (Kodak). Restriction enzyme-digested E. maxima IMP1 cDNA sequence and expression plasmids pTrcHis and pBad were isolated using a QIA Quick Gel Purification kit (Qiagen), followed by ligation of insert to plasmid using T4 DNA ligase (NEB), and transformation into Escherichia coli DH5 using standard transformation methods (Hanahan, 1983). Recombinant pTrcHis and pBad plasmids containing E. maxima IMP1 cDNA were then transformed into E. coli BL21 or E. coli Top10 cells. Optimal expression of recombinant E. maxima IMP1 (rEmaxIMP1) was achieved at 37 ◦ C for 4 h from pTrcHis with 1 mM IPTG and from pBad with 0.2% arabinose. After a 4 h induction, E. coli expressing rE maxIMP1 were harvested by centrifugation, and serial extraction in native and denaturing binding buffers using procedures supplied by the manufacturer (Invitrogen). Recombinant EmaxIMP1was purified by NiNTA affinity chromatography (Qiagen) under native or denaturing conditions. 2.3. Preparation of polyclonal anti-recombinant Eimeria maxima IMP1 protein. Peak eluates from native and denaturing NiNTA purification were dialyzed overnight against PBS, and then reduced to 100 l volume using an Amicon Ultra-4 concentrator (Merck Millipore Ltd., Tullagreen, Ireland). Polyclonal antisera were prepared against rEmaxIMP1 protein by a commercial company (Pacific Immunology, Ramona, CA) by immunizing 2 rabbits over the course of 2 months with the primary immunization in Complete Freund’s Adjuvant, and 3 booster immunizations in Incomplete Freund’s Adjuvant. 2.4. Analysis of recombinant and native Eimeria maxima IMP1 protein Recombinant EmaxIMP1 or non-recombinant (from vector only controls) proteins were analyzed by SDS-PAGE followed by immunoblotting or Coomassie Blue staining. Native E. maxima oocysts protein was obtained by bead-beating fully sporulated oocysts for 2 min in 10 mM Tris pH8, 1 mM MgCl2 containing protease inhibitors (Pierce Chemical Co., Rockford, IL). Recombinant or native E. maxima protein was suspended in SDS-PAGE sample buffer (Laemmeli, 1970) with or without dithiothreitol (DTT), heated on a boiling H2 O bath for 1 min, pelleted by centrifugation for 5 min at 10,000 g to remove particulates, and electrophoresed by SDS-PAGE, followed by Coomassie Blue staining or transfer to Immobilon membrane (Millipore, Billerica, MA). In the latter, blots were washed briefly with phosphate-buffered saline (PBS), immersed in blocking solution (PBS containing 2% non-fat dry milk (PBS-NFDM)) for 30 min at room temperature (RT), and then incubated with polyclonal rabbit antisera specific for rEmaxIMP1
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
3
Fig 1. Alignment of DNA and predicted amino acid sequences using Clustal analysis of Eimeria maxima IMP1 cDNA sequences from 3 strains of E. maxima- APU1, Weybridge, and Houghton. Amino acids in bold type reflect missense mutations in the nucleic acid sequence.
protein or control sera (pre-immunization sera or rabbit antisera prepared against an irrelevant polyHis recombinant protein) at 1:1000 dilution in PBS containing 0.05% Tween 20 (PBS-Tw). Separate immunoblots of rEmaxIMP1 were probed with mouse anti-His
monoclonal antibodies (Invitrogen). After 2 h incubation at RT, the blots were probed with either biotin-labeled goat anti-rabbit IgG or anti-mouse IgG (Sigma Chemical Co., St. Louis, MO) followed by alkaline phosphatase-labeled avidin (Sigma), followed by NBT-
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7 4
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
BCIP substrate (Pierce Chemical Co.). All blots were washed 3 times between each incubation step with PBS-Tw.
2 1
2.5. Analysis of Eimeria maxima IMP1 stability Log2 Fold Change
Aqueous-soluble (native buffer) and denaturing soluble (6 M urea) rEmaxIMP1 protein was purified by NiNTA-affinity chromatography and incubated at 4 ◦ C for various lengths of time. In order to study recombinant protein breakdown over time, aliquots from NiNTA-purified aqueous soluble and denaturing soluble eluates were removed at 1, 3, 7, 13, and 27 weeks and mixed with an equal volume of SDS-PAGE sample buffer containing DTT to stabilize protein integrity. The time-course samples were analyzed by SDS-PAGE/immunoblotting followed by staining with mouse anti-His antibodies using the procedure described above.
0 -1 -2 -3 -4 -5 -6 0
6
12
18
30
42
Sporulation Time (hr)
2.6. Immunofluorescence staining Eimeria maxima sporozoites and merozoites E. maxima (APU-1) sporozoites and merozoites were isolated using described procedures (Fetterer et al., 2013). In brief, E. max-
Fig. 2. Time-course expression of Eimeria maxima IMP1 mRNA during sporulation of E. maxima oocysts as measured by RT-PCR analysis using primers directed to E. maxima IMP1 and Eimeria GAPDH. Transcript levels are expressed as relative to the 0 h (non-sporulated) timepoint using the Ct method.
Fig. 3. Immunoblotting analysis of recombinant Eimeria maxima IMP1 stability over time (A) and recognition of native E. maxima IMP1 protein using antisera specific for rEmaxIMP1 protein (B). Panel A, NiNTA-purified rEMaxIMP1 protein in denaturing soluble (6 M urea, DS) for incubated for 1 or 27 weeks or native soluble (NS) buffer incubated for 0, 3, 7, 13, and 27 wks at refrigeration temperature. Panel B, immunostaining Western blots of SDS-PAGE fractionated native E. maxima oocyst/sporozoite protein in the absence (−DTT) or presence (+DTT) of a reducing agent probed with anti-recombinant EmaxIMP1 protein (␣-Emax IMP1), preimmunization serum (PB), or antisera to an irrelevant recombinant His-tag protein (␣-HisrAg).
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
5
Fig. 4. Immunofluorescence staining of untreated (A–C) or methanol-treated (D) Eimeria maxima sporozoites with anti-recombinant EmaxIMP1 protein (A, D), preimmunization serum (B), or antisera to an irrelevant recombinant His-tag protein (C). Arrow points to surface staining. Bar = 15 M.
ima sporozoites were prepared by suspending sporulated oocysts in Hanks balanced salt solution (HBSS, Invitrogen, Carlsbad, CA) and grinding on ice in a 15 ml glass tube with a Teflon pestle until most of the oocysts were broken, and free sporocysts were visible by microscopy. The suspension was pelleted by centrifugation at 2500 g for 10 min., and the sporocysts-containing pellet was suspended in excystation medium (4% [w/v] sodium taurodeoxycholate (Sigma) and 0.25% trypsin (Sigma) in HBSS. Excystation was conducted at 41 ◦ C for approximately 1 h, and released E. maxima sporozoites were pelleted by centrifugation, resuspended in HBSS and purified by passage through a cellulose filter pad (Fuller and McDougald, 2001). For preparation of merozoites, outbred broiler chickens (Heritage breed, Longeneckers Hatchery) at 3 weeks of age were inoculated with 5000 E. maxima (APU-1) oocysts, and killed at 96 h post-inoculation. The mid-intestine (from the caudal end of the duodenal loop to Merckel’s diverticulum) was excised, rinsed with PBS, cut open longitudinally, rinsed gently with PBS to remove any excess digestate, and cut into 5 cm sections. The intestinal tissue was immersed in mucosal digestion medium (HBSS, 0.50% sodium taurodeoxycholate (Sigma), 97% TLC (Sigma), 0.25% trypsin (Sigma)) that had been pre-warmed to 41 ◦ C. The suspension was gently agitated for 20 min to allow for merozoite release. The tissue suspension containing released merozoites was passed through 4 layers of cheesecloth, and the filtrate was pelleted by centrifugation at 2500 g for 10 min. followed by suspension in HBSS. Merozoites were purified by passage through a cellulose filter pad using a procedure similar to sporozoite isolation. E. maxima sporozoites or merozoites were distributed to individual wells of 8-well microscope slides (Tekdon, Inc. Myakka City, FL) at 104 parasites/well, and allowed to air dry. The slides were either left untreated or were immersed in cold methanol for 5 min to permeabilize membranes followed by air drying. Individual wells were first treated with PBS-NFDM for 30 min at RT, then incubated
for 2 h at RT with a 1:5000 dilution of polyclonal rabbit antisera specific for rEmaxIMP1 protein or control sera similar to above, followed by a 1 h incubation at RT with a 1:100 dilution of FITClabeled goat anti-rabbit IgG (Sigma). The wells were washed 3 times between each step by immersing the entire slide in PBS and allowing wells to drain dry. Each well received 5 l Vectashield (Vector Laboratories, Burlingame, CA), overlaid with a coverslip, and examined by epifluorescence microscopy on a Zeiss microscope at 400–1000× magnification. Images were captured using a Zeiss AxioScope camera and AxioVision imaging software.
2.7. Immunohistochemical staining of Eimeria maxima-infected tissues Outbred broiler chickens (Heritage breed, Longeneckers Hatchery) at 3 weeks of age were inoculated with either 200,000 or 25,000 E. maxima (APU-1) oocysts. Intestinal tissues within 1 cm of Merckel’s diverticulum were harvested from high dose groups at 24 and 48 h and from the low dose group at 72, 96, and 120 h postinoculation. A high E. maxima dose was used for earlier timepoints because intracellular parasite numbers were found in previous studies to be extremely low due to insufficient merogonic development at 24 and 48 h. The intestinal tissue was immediately fixed in 10 % formalin for 30 min at RT, and stored in 100% ethanol until 10 m paraffin sections were prepared (Histoserve Inc. Gaithersburg, Maryland). Sections were deparaffinized and then treated with pepsin to expose reactive epitopes using a standard procedure (Dubey, 2010). After pepsin treatment, the sections were immunostained with a 1:500 dilution of rabbit anti-rEmaxIMP1 protein followed by Dako (Glostrup, Denmark) Envision with 3-amino-9-ethylcarbazole (AEC) as the substrate chromogen following manufacturer’s recommendation.
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
6
Fig. 5. Immunohistochemical staining of Eimeria maxima-infected chicken ileum tissue with antiserum specific for recombinant EmaxIMP1 protein (A–D) or a mixture of preimmunization serum and antiserum to an irrelevant recombinant His-tag protein (E, F). Ileum tissue harvested at 24 h (A, B, E) or 48 h (C, D, F) post-E. maxima oocyst inoculation. Arrow points to one of many intracellular stages reacting with anti-rEmaxIMP1 serum as indicated by dark brown staining.
3. Results and discussion Aligning the E. maxima Houghton and Weybridge IMP1 (Accession Nos. FN813227 and FN813228) and APU-1 IMP1 (Accession No. KP642747) sequences revealed 7 single nucleotide polymorphisms (SNP) among the sequences (Fig. 1). Of these SNPs, 4 were missense mutations resulting in changes to the encoded amino acid, while 3 were silent mutations. Applying Chou and Fasman Secondary Structure Prediction Software (Chou and Fasman, 1974) to the 3 IMP1 sequences showed that the conversion at amino acid residue 176 from a phenylalanine in the APU1 and Weybridge sequence to a valine in the Houghton sequence may alter the secondary structure of the IMP1 protein. Whether this explains the lack of cross-protection between the Houghton and Weybridge strains (Blake et al., 2006), and whether APU-1 can immunize against the Weybridge strain requires further study. Expression of E. maxima IMP1 mRNA was highest between 6 and 12 h, and decreased at 18–42 h sporulation (Fig. 2). Of note is that relative to the 0 h timepoint, IMP1 transcription was downregulated at 18 h sporulation and beyond (Fig. 2). It is possible that a fraction of E. maxima oocysts had already initiated sporulation because of the time expended between oocysts shedding and pro-
cessing of oocysts. However, our microscopic observation during sporulation of the E. maxima oocysts in this study revealed very few (<1%) sporulated oocysts before 30 h. Cloning EmaxIMP1 in 2 different polyHis fusion vectors resulted in a 65 kDa recombinant protein that was present in both native and denaturing extracts of the E. coli host. Unlike most recombinant proteins generated in E. coli, rEmaxIMP1 appeared to be somewhat unstable in aqueous, non-denaturing buffer. Immunoblotting and Coomassie blue staining of SDS-PAGE fractionated rEmaxIMP1 showed that by 27 weeks no 65 kDa rEmaxIMP1 protein was present (Fig. 3A). This degradation was probably not due to protease-mediated breakdown because incubating NiNTA-purified rEmaxIMP1 in the presence or absence of protease inhibitors showed no difference in the stability of the protein (unpublished observations). For reasons unknown, rEmaxIMP1 was stable in buffer containing 6 M urea (denaturing buffer) because no decrease in the amount of recombinant protein was observed over the same time period (Fig. 3A). Consistent with this observation is the calculated instability index equal to 56.3; proteins with an instability index greater than 40 are considered unstable (Guruprasad et al., 1990). What biological function this has in the E. maxima life cycle or induction of immunity to E. maxima is unknown.
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009
G Model VETPAR-7632; No. of Pages 7
ARTICLE IN PRESS M.C. Jenkins et al. / Veterinary Parasitology xxx (2015) xxx–xxx
Polyclonal antisera specific for rEmaxIMP1 identified a 72 kDa protein in non-reducing SDS-PAGE immunoblots and a 61 kDa protein in reducing SDS-PAGE immunoblots of native E. maxima sporozoite protein (Fig. 3B). It is unclear why under both reducing and non-reducing conditions, native E. maxima migrates at a considerably higher relative mass (Mr) than 40 kDa as predicted by the primary amino acid sequence. Searching of the EmaxIMP1 sequence revealed a single well supported Nglycosylation site (residues 268–270) (NetNGlyc 1.0, 2015) and numerous O-glycosylation sites (YinOYang 1.2, 2014). Thus, Nand O-glycosylation of the native E. maxima IMP1 protein may increase its apparent Mr as observed by SDS-PAGE. The difference in observed Mr under non-reducing and reducing SDS-PAGE suggests that folding of EmaxIMP1 involves disulfide bonds between 2 of the 3 cysteines present in the protein. Immunofluorescence staining with anti-rEmaxIMP1 serum revealed intense surface staining in both dried and methanoltreated E. maxima APU-1 sporozoites (Fig. 4A, D), but not in E. maxima merozoites (data not shown). The similarity in IFA staining of dried and methanol-treated E. maxima sporozoites suggests that the IMP1 protein is associated with the parasite surface and not with internal structures because internal staining would be expected with methanol-permeabilized parasites. Preimmunization serum or antiserum to an irrelevant polyHis recombinant protein showed extremely light staining of sporozoites which was restricted to the apical tip of the parasites (Fig. 4 B, C). Somewhat perplexing is that analysis of the amino acid sequence failed to identify any signal sequence or transmembrane region. Immunohistochemical staining of ilea tissue sections from E. maxima APU1-infected chickens revealed E. maxima developmental stages at 24 and 48 h post-infection (Fig. 5). Similar to previous observations (Riley and Fernando, 1988), early developmental stages of E. maxima were present in both the lamnia propria and crypts of the intestinal villi at both timepoints (Fig. 5A–D). Very faint staining of intracellular stages was observed at later timepoints (72–120 h, data not shown). Expression of an immunoreactive protein during early stages of development may explain in part the protective role IMP1 plays in acquired resistance to E. maxima since natural immunity is believed to be directed at early developmental stages (Jeffers and Long, 1985; Jenkins et al., 1993, 1997). Conflict of interest The authors report no conflict of interest. Acknowlckedgements The authors acknowledge the technical assistance of Carolyn Parker in the study. This project was solely funded by the USDA-ARS CRIS project “Development and Control of Intervention Strategies for Avian Coccidiosis”- Project No. 1265-31320-0076-00D.
7
References Blake, D.P., Billington, K.J., Copestake, S.L., Oakes, R.D., Quail, M.A., Wan, K.L., Shirley, M.W., Smith, A.L., 2011. Genetic mapping identifies novel highly protective antigens for an apicomplexan parasite. PLoS Pathog. 7, 1–13. Blake, D.P., Shirley, M.W., Smith, A.L., 2006. Genetic identification of antigens protective against coccidia. Parasite Immunol. 28, 305–314. Chou, P.Y., Fasman, G.D., 1974. Prediction of protein conformation. Biochem. 13, 222-245. CFSSP- Chou and Fassaman Secondary Structure Prediction Software http://www.biogem.org/tool/chou-fasman/ (accessed 05.05.15.). Dubey, J.P., 2010. Toxoplasmosis of Animals and Humans, 2nd ed. CRC Press, Boca Raton, FL, 313p. Fetterer, R.H., Barfield, R.C., 2003. Characterization of a developmentally regulated oocyst protein from Eimeria tenella. J. Parasitol. 89, 553–564. Fetterer, R.H., Schwarz, R.S., Miska, K.B., Jenkins, M.C., Barfield, R.C., Murphy, C., 2013. Characterization and localization of an Eimeria-specific protein in Eimeria maxima. Parasitol. Res. 112, 3401–3408. Guruprasad, K., Reddy, B.V.B., Pandit, M.W., 1990. Correlation between stability of a protein and its dipeptide composition: a novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Eng. 4, 155–161. Hanahan, D., 1983. Studies on the transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580. Huang, X., Zou, J., Xu, H., Ding, Y., Yin, G., Liu, X., Suo, X., 2011. Transgenic Eimeria tenella expressing enhanced yellow fluorescent protein targeted to different cellular compartments stimulated dichotomic immune responses in chickens. J. Immunol. 187, 3595–3602. Jeffers, T.K., Long, P.L., 1985. Eimeria tenella: immunogenicity of arrested sporozoites in chickens. Exp. Parasitol. 60, 175–180. Jenkins, M.C., Chute, M.B., Danforth, H.D., 1997. Protection against coccidiosis in outbred chickens elicited by gamma-irradiated Eimeria maxima. Avian Dis. 41, 702–708. Jenkins, M.C., Miska, K., Klopp, S., 2006. Improved polymerase chain reaction technique for determining the species composition of Eimeria in poultry litter. Avian Dis. 50, 632–635. Jenkins, M.C., Seferian, P.G., Augustine, P.C., Danforth, H.D., 1993. Protective immunity against coccidiosis elicited by radiation-attenuated Eimeria maxima sporozoites that are incapable of asexual development. Avian Dis. 37, 74–82. Laemmeli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−Ct Method. Methods 25, 402–408. McDonald, V., Shirley, M.W., 2009. Past and future: vaccination against Eimeria. Parasitology 136, 1477–1489. NetNGlyc 1.0 (2015) Center for Biological Sequence Analysis.
Please cite this article in press as: Jenkins, M.C., et al., Characterization of the Eimeria maxima sporozoite surface protein IMP1. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.05.009