Characterization of the feline thyroglobulin promoter

Domestic Animal Endocrinology 20 (2001) 185–201

Characterization of the feline thyroglobulin promoter L. Blackwood,* D.E. Onions, D.J. Argyle Molecular Therapeutics Research Group, Division of Small Animal Clinical Studies, Faculty of Veterinary Medicine, University of Glasgow, Bearsden Road, Glasgow, G61 1QH UK Received 11 September 2000; accepted 24 January 2001

Abstract The feline thyroglobulin promoter was identified by a combination of standard polymerase chain reaction (PCR) techniques, using primers designed according to regions of homology in published sequences from other species, then adaptor ligated PCR. A 310 bp fragment of the feline thyroglobulin promoter was generated, including 8 nucleotides of adaptor sequence at the 5⬘ end and, based on the putative transcription start site, 36 nucleotides of the thyroglobulin mRNA (untranslated portion). The homology between the feline promoter sequence (from 193 bp upstream to the putative cap site) and canine, bovine and human sequences was 89%, 81% and 78%, respectively. Transient transfection studies, using reporter constructs in which the feline promoter controlled expression of chloramphenicol acetyl transferase, demonstrated promoter activity in thyroid cells, but no activity in non-thyroid cells. The data presented here demonstrate that the feline thyroglobulin promoter may provide a targeting mechanism for somatic gene therapy of feline thyroid disease. © 2001 Elsevier Science Inc. All rights reserved.

1. Introduction Feline hyperthyroidism (thyrotoxicosis) was first reported in 1979 by Cotter [1] and by Peterson et al. [2], and is now the most common endocrine disorder in the cat. The mean age of onset is 13 to 14 years of age, with a range of 6 to 21.3 years [3,4,5]. There is no sex predisposition, and any breed may be affected. Ninety-seven to ninety-nine percent of cases of hyperthyroidism in cats are due to nodular adenomatous hyperplasia of the thyroid gland, while the remaining one to three percent are caused by functional malignant tumours

* Corresponding author. Tel.: ⫹44-141-330-5700; fax: ⫹44-141-942-7215. E-mail address: [email protected] (L. Blackwood). 0739-7240/01/$ – see front matter © 2001 Elsevier Science Inc. All rights reserved. PII: S 0 7 3 9 - 7 2 4 0 ( 0 1 ) 0 0 0 9 3 - 5

186

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

[3,6,7,8]. Thus clinical hyperthyroidism due to malignant thyroid neoplasia is rare in the cat, as in humans [9]. The treatment options for hyperthyroidism in both cats and humans include radiation therapy with iodine 131, surgical thyroidectomy, or long term medical management with anti-thyroid drugs, all of which have advantages and disadvantages. Radioiodine treatment is generally the treatment of choice in human medicine, and has a sound biological basis, specifically targeting the hyperfunctioning thyroid tissue, but is potentially hazardous to personnel exposed to urine and saliva from treated cats and, in the United Kingdom, requires post-treatment hospitalisation in an isolation facility for 28 days. Other methods of targeting therapy to the thyroid gland, such as the use of targeted gene therapy, may offer advantages over radioiodine in both feline and human patients. There are a number of methods by which gene therapy may target thyroid cells. Favoured methods include targeting of the gene therapy vector (e.g. receptor based approaches) so that the transgene is delivered to only target cells, and transcriptional targeting using cell type or tumour specific promoters which are functionally active in target cells only, so the transgene is expressed only in these target cells. The use of many cell type specific promoters has been investigated, including the tyrosinase and tyrosinase related protein 1 promoters in melanoma [10,11,12], the amylase promoter in pancreatic tumours [13], and the ␤-lactoglobulin promoter in mammary tissue [14,15]. Similarly, many tumour specific promoters have been investigated including the carcinoembryonic antigen (CEA) promoter in colorectal, lung and pancreatic cancers [16,17,18]; MUC1/DF3 in mammary and gastrointestinal tumours [19,20] and prostate specific antigen (PSA) in prostatic carcinoma [21,22]. The thyroglobulin promoter has been characterised in the human [23], canine [24] and bovine species [25] and in the rat [26] and mouse [27]. The cell type specific activity of the thyroglobulin promoter was first demonstrated in vitro by Musti et al. [26], investigating the rat promoter. Subsequently, the specificity of the thyroglobulin promoter has been repeatedly demonstrated in transgenic mice, in studies where the bovine promoter has been used to drive expression of reporter genes [28] then various oncogenes and growth factor receptors [29,30,31,32,33]. None of these studies reported any evidence of transgene expression in non-thyroid tissue. Thus there is a large body of experimental evidence that the thyroglobulin promoter is tissue specific. The data presented here demonstrate that the feline thyroglobulin promoter exhibits tissue specific activity and may provide a tool for the transcriptional targeting of gene therapy to the feline thyroid gland as an alternative treatment modality in hyperthyroidism.

2. Materials and methods 2.1. PCR, identification of promoter and cycle sequencing Initially, a 246 bp fragment of the 5⬘ flanking sequence of the feline thyroglobulin gene was amplified from feline genomic DNA using upstream primer 5⬘-GGAACAGACGCAG GTGGAGGAC-3⬘ and downstream primer 5⬘-AACTTAGCAAAGATGTTGGCGGAT ACC-3⬘, based on known bovine sequence [25]. Following initial denaturation at 94°C for 5 minutes (mins), PCR conditions were 94°C for 15 seconds (s), 62°C for 15s, and 72°C for

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

187

15s for 30 cycles, then 72°C for 10 mins. Next, the sequence 5⬘ to this was identified using the Universal GenomeWalker™ Kit (Clontech), an adaptor ligated, nested, touchdown PCR method [34], as per the manufacturer’s instructions. In the first round of amplification, adaptor primer 1 (AP-1, provided in the kit) and gene specific primer GSP-1, identical to the downstream primer above (5⬘-AACTTAGCAAAGATGTTGGCGGATACC-3⬘) were used, then in the second round adaptor primer 2 (AP-2, also provided in the kit) and internal primer GSP-2 (5⬘-ATACCAAGCAGGCTGAGCCCAGCAGA-3⬘) were used. GSP-2 was selected from the known feline sequence proximal (5⬘) to GSP-2, and had a similar annealing temperature to AP-2. Reactions were carried out in duplicate, DMSO being added to a final concentration of 5% in the second set to facilitate PCR. Primary PCR conditions were 94°C for 2s, 70°C for 3 mins for 7 cycles, and 94°C for 2s, 65°C for 3 mins for 32 cycles, then 65°C for 4 mins. Duplicate reactions containing 5% DMSO were cycled for 36 rather than 32 cycles, as DMSO reduces the rate of dNTP incorporation in PCR. Primary PCR products were diluted 50-fold, and 1 ␮l was used as a template for the secondary, nested PCR. Secondary PCR conditions were 94°C for 2s, 70°C for 3 mins for 5 cycles, and 94°C for 2s, 65°C for 3 mins for 20 cycles, then 65°C for 4 mins. The duplicate reactions containing 5% DMSO were cycled through 24 rather than 20 cycles. Southern blotting of the secondary PCR products was carried out according to standard procedures [35], using a 30 nucleotide oligo probe, selected from the previously determined feline sequence, (CTCTATAAAGGCTCCCTGGCCAGAGCCTAG) end-labelled with [␥32P]ATP using T4 polynucleotide kinase (New England Biolabs) according to the manufacturer’s instructions. Identified PCR products were cloned into pCR™2.1 (Invitrogen) using the Original TA Cloning Kit (Invitrogen), and cycle sequencing performed using IRD41-labelled primers (MWG-Biotech) and the ThermoSequenase Fluorescent Labelled Primer Cycle Sequencing Kit with 7-deaza-dGTP (Amersham Life Science), with data recording on a Li-Cor model 4000DNA sequencer (MWG-Biotech). 2.2. Plasmid constructs pBLCAT6 is a pUC18 derived ampicillin resistant plasmid designed for analysis of promoter and enhancer sequences in mammalian cells [36]. pfetgp5CAT6 was constructed by digesting the cloned GenomeWalking™ product from pCR™2.1 with SmaI and ApaI (both New England Biolabs), to cleave the adaptor primer from the 5⬘ end and to remove the thyroglobulin ATG from the 3⬘ end. These restriction sites were identified by analyses of the DNA sequence using the GCG package (Wisconsin Package Version 9.1, Genetics Computer Group (GCG), Madison, Wisconsin). The ApaI generated cohesive ends were then converted to blunt ends using T4 DNA polymerase (Gibco BRL) and the fragment cloned into pBLCAT6. The correct orientation was checked by digestion with NciI and restriction mapping, and the promoter sequence verified by sequencing. There was one point mutation (G in the original PCR product to C in the plasmid vector) at position ⫹22 bp from the cap site. As this mutation is in the untranslated region between the cap site and the ATG it was not considered significant. The cytomegalovirus immediate early enhancer/promoter (CMV/IE) promoter (756 bp) was digested from pCI-neo (Promega) by restriction enzyme digest using BglII and HindIII

188

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

Table 1 Plasmids used in transient transfection experiments investigating the activity and tissue specificity of the feline thyroglobulin promoter Plasmid

Promoter

Reporter Gene

pBLCAT6 pfetgp5CAT6 pCMVCAT6 pBLCAT17 pBLdTgW pHTgW pMV12

None Feline thyroglobulin promoter, ⫺266 to ⫹36 bp Cytomegalovirus intermediate early promoter/enhancer Bovine thyroglobulin promoter, ⫺2036 to ⫹9 bp Canine thyroglobulin promoter, ⫺175 to ⫹8 bp Human thyroglobulin promoter, ⫺181 to ⫹16 bp Cytomegalovirus immediate early promoter/enhancer

CAT CAT CAT CAT CAT CAT lacZ/␤-galactosidase

(Gibco BRL). The 5⬘ and 3⬘ protruding ends were then filled in or removed using T4 DNA polymerase (Gibco BRL) and the blunt fragments ligated into pBLCAT6 to generate plasmid pCMVCAT6. The correct orientation was identified by restriction mapping with HincII (Gibco BRL). Plasmids pBLCAT17, pBLdTgW and pHTgW have a pBLCAT3 backbone [37], and were kindly donated by Dr. Daniel Christophe, Universite´ Libre de Bruxelles. The plasmid pBLCAT17 contains the bovine thyroglobulin promoter from ⫺2036 to ⫹9 bp [28,38], pBLdTgW contains the canine promoter from ⫺175 to ⫹8 bp [24], and pHTgW contains the human promoter from ⫺181 to ⫹16 bp relative to the transcription start site [39]. Plasmid pMV12 was kindly donated by Dr. Derek Bain, University of Glasgow, and contains the ␤-galactosidase gene under the control of the CMV/IE promoter/enhancer. Plasmids are summarised in Table 1. 2.3. Preparation of plasmid DNA Recombinant bacteria were generated by transformation of E. coli Subcloning Efficiency DH5␣ (Gibco BRL) according to the manufacturer’s instructions. Sequencing grade plasmid DNA was prepared from exponentially growing overnight culture (in LB broth [Gibco BRL]) of identified recombinant bacteria, using the PerfectPrep™ Plasmid DNA Kit (Flowgen), and transfection grade DNA was prepared using the QIAGEN EndoFree Plasmid Purification Maxi kit. 2.4. Eukaryotic cell lines The FRTL-5 cell line (ECACC Ref No 91030711) is a rat thyroid cell line that maintains highly differentiated thyroid functions [40]. Some batches of these cells were kindly donated by Dr Darren Foster, University of Edinburgh. PETCAT 1 cells are a feline thyroid cell line established from a hyperthyroid cat [41], kindly donated by Dr. Hans Gerber, Chemisches Zentrallabor der Universitaetskliniken Inselpital, Berne. CRFK cells are a feline renal epithelial cell line (ECACC Ref. No. 86093002) [42], and CCC cell are derived from CRFK cells, kindly donated by Dr. Brian Willett, Department of Veterinary Pathology, University of Glasgow. FEA cells are a feline fibroblast cell line derived from whole feline embryos

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

189

[43]. Skin fibroblasts were low passage number fibroblasts derived from primary culture of feline skin fibroblasts (SF) from specific pathogen free cats [44], kindly donated by Dr. Normal Flynn, Department of Veterinary Pathology, University of Glasgow. Thyroid cell lines (FRTL-5 and PETCAT-1) were maintained in 6H medium, consisting of F12 Coon’s modification (Sigma) supplemented with 5% FCS, somatostatin 10 ng/ml (CalBiochem/ NovaBiochem), GHL acetate 20 ng/ml (Sigma), hydrocortisone 10 nM (Sigma), insulin 10 ␮g/ml, transferrin 5 ␮g/ml (Gibco BRL) and TSH 1 mU/ml (National Institute for Biological Standards and Controls). Skin fibroblasts were maintained in ␣-MEM (Gibco BRL) supplemented with 10% FCS, 2mM L-glutamine (Gibco BRL), and 10 ng/ml human recombinant epidermal growth factor (Sigma). All other cell lines were maintained in DMEM with GLUTAMAX I™ (Gibco BRL) supplemented with 10% FCS. All maintenance media contained 100 units/ml streptomycin and 100 units/ml penicillin (Gibco BRL). 2.5. DNA transfections All transfections were carried out in duplicate, and reagents used according to the manufacturer’s instructions. FRTL-5 cells (which had been passaged less than 15 times) were seeded at a density of 3 ⫻ 106 cells per 25 cm2 (T25) flask, and PETCAT1 cells at a density of 1.6 ⫻ 106 per T25, 16 to 24 hours prior to transfection. Cells were approximately 60 –70% confluent at the time of transfection. Thyroid cells were transfected using 5 ␮g of DNA per T25 flask complexed with TransFast™ (Promega) at a ratio of 2:1 TransFast™:DNA. For transfections comparing pfetgp5CAT6 and the thyroglobulin promoter constructs from other species, 4 ␮g of the DNA of interest and 1 ␮g of pMV12 per flask were complexed with the reagent, again at a ratio of 2:1. Non-thyroid cell lines were transfected using LIPOFECTAMINE™ (Gibco BRL). CCC and FEA cells were seeded at a density of 1.5 ⫻ 105 cells per 35 mm well of a six-well plate, CRFK cells at 1.6 ⫻ 105 cells per well, and skin fibroblasts at 2 ⫻ 105 cells per well, in antibiotic free medium 16 to 24 hours prior to transfection. Cells were approximately 40 – 60% confluent at the time of transfection. Transfections were carried out as per the manufacturer’s instructions, using 2 ␮g of DNA of interest and 0.5 ␮g of pMV12 per well. Mock transfections were carried out in some experiments, where the transfection process was carried out as above but no DNA was complexed with the reagents. 2.6. Analysis of CAT activity and assessment of transfection efficiency CAT concentrations were determined using the CAT ELISA kit (Boehringer Mannheim) as per the manufacturer’s instructions. Cells were lysed 48 hours after transfection, and lysate snap frozen in a dry ice/ethanol bath and stored at ⫺70°C. Protein concentration was determined using the method of Bradford [45]. The lysate samples were diluted to 250 ␮g/ml of protein, or lower, to give absorbance readings (405 nm) on the linear part of the calibration

190

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

Fig. 1. Autoradiograph of a Southern blot of products amplified from feline genomic DNA by genome walking, hybridised with a 30 bp oligonucleotide probe. Reactions 1 to 5 were generated from libraries generated by digesting with DraI (1), EcoRV (2), PvuII (3), ScaII (4) and StuI (5). The B reactions were cycled without DMSO, while the D reactions contained DMSO. The probe hybridised with PCR products 3B, 5B, 4D and 5D, and the original 246 bp PCR product from feline genomic DNA, included as a positive control.

curve. In each ELISA, duplicate blanks and CAT standards were included. To determine transfection efficiency, ␤-galactosidase expression was assayed by fixing and staining cells transfected with pMV12 with X-Gal (5-bromo-4-chloro-3-indoyl-␤-D-galactoside).

3. Results 3.1. Isolation of the feline thyroglobulin promoter Initial PCR from genomic DNA generated a 246 bp fragment of the 5⬘ flanking sequence of the feline thyroglobulin gene. Amplification of the 5⬘ region flanking the original PCR product from genomic DNA by genome-walking generated several small, specific products on secondary PCR. On Southern blotting, four products were found to hybridise to the sequence specific oligo probe (Figure 1). The smallest products were not investigated further. After cloning and sequencing, it was found that the product 3B contained several deletions compared to 5B and 5D, which were identical. The consensus sequence of clones from reactions 5B and 5D is shown in Figure 2. The product was 397 bases long. After digestion from plasmid pCR™2.1, removing the primers and the thyroglobulin start codon (ATG), a 310 bp fragment of the feline thyroglobulin promoter was generated, including 8 nucleotides of the adaptor sequence at the 5⬘ end and 36 nucleotides of the thyroglobulin mRNA (untranslated portion), based on the putative transcription site. A comparison of the feline sequence with published sequences is shown in Figure 3. The homology between the feline promoter sequence (from ⫺193 bp to the putative cap site) and canine and bovine promoters is 89% and 81%, respectively, while homology with the human sequence is 78%. Homology of the feline promoter with the rat promoter over this region is only 48%, but over promoter regions A/A⬘, B/D and K homology is 72%. The feline promoter also shows 75% homology with the mouse promoter as shown, up to the cap site.

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

191

Fig. 2. PCR product amplified by the second round of genome-walking PCR, showing primers AP-2 and GSP-2. The adaptor sequence at the 5⬘ end of the product is underlined. SmaI and ApaI were used to excise the promoter from the cloning vector, resulting in a product containing 8 bp of adaptor sequence at the 5⬘ end, but from which the 3⬘ thyroglobulin ATG had been removed.

3.2. Demonstration of activity of the feline thyroglobulin promoter FRTL-5 cells were transfected with pfetgp5CAT6, pCMVCAT6 (positive control) and pBLCAT6 (promoterless negative control). Readily measurable amounts of CAT were produced by transfection with pfetgp5CAT6, despite extremely low transfection efficiencies (less than 0.01% based on pMV12 transfection and X-Gal staining). High levels of expression of CAT resulted from transfection with pCMVCAT6, while no CAT was detected after transfection with pBLCAT6. This preliminary experiment was carried out in duplicate, twice. The results are summarised in Figure 4. Next, plasmids containing the feline (pfetgpCAT6), canine (pBLdTgW) and bovine (pBLCAT17) thyroglobulin promoters were transfected into FRTL-5 cells, with cotransfection with pMV12 to allow correction for variations in transfection efficiency between wells. Positive and negative controls were as above. Transfections were carried out in duplicate: one set were used for determination of CAT concentrations and the other for determination of transfection efficiency. For each experiment, the CAT concentrations were corrected for transfection efficiency, and expressed as a percentage of the CAT concentration in the lysate of the cells transfected with pCMVCAT6 (Figure 5). The overall average level of CAT

192

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

expression by the feline thyroglobulin promoter (fetgp) in both sets of experiments, compared to the CMV promoter, was 18%. From these data, it is clear that the sequence identified shows promoter activity. In

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

193

Fig. 3. Comparison of feline thyroglobulin promoter with that of other species. Figures in parenthesis give the position in the feline promoter relative to the putative feline cap site. The transcription factor binding sites of bovine [55], canine [24] and rat [56] promoters are shown in colour (the A and C sites in red, the B sites in green, and the K site in magenta). The D motifs investigated by Donda et al. [39] are underlined. (The D motifs and B regions refer to the same region of the promoter). The CACCC sequence is shown in blue, and the motif conserved with the glucocorticoid receptor is underlined and in italics (note that this is within the C region in the rat sequence). The 5⬘ homologous region of the feline and canine promoters is shown in bold type. The TATA box is highlighted in red, and the ATG in magenta. 4™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™

addition, the activity of the feline thyroglobulin promoter is comparable to, if not greater than, the well characterised canine and bovine promoters. There was no detectable background CAT expression from the promoterless pBLCAT6 construct. 3.3. Investigation of the activity of the feline thyroglobulin promoter in feline thyroid cells To compare the activity of the feline promoter with that of other promoters in feline cells, the feline thyroid cell line PETCAT 1 was transfected with pfetgp5CAT6, pBLdTgW, pBLCAT17, with pCMVCAT6 and pBLCAT6 as controls, and pMV12 cotransfection to allow comparison of promoters. Transfection efficiency in all wells was approximately 8%. No CAT expression was detected from any of the thyroglobulin promoters. CAT concentration in the lysates from pCMVCAT6 transfected cells was approximately 87 ng/mg protein, which is in keeping with the results from the other transfections.

Fig. 4. Expression of CAT in FRTL-5 cells transfected with pfetgp5CAT6 (feline), pCMVCAT6 (CMV) and pBLCAT6 (promoterless control), illustrating activity of the feline thyroglobulin promoter in rat thyroid cells. Each chart column represents the average of duplicate wells and duplicate experiments. The CAT concentrations are expressed as a percentage of the CAT concentration of the lysate from the pCMVCAT6 transfections.

194

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

Fig. 5. Expression of CAT in FRTL-5 cells transfected with pfetgp5CAT6 (feline), pBLdTgW (canine), pBLCAT17 (bovine), pCMVCAT6 (CMV) and pBLCAT6 (promoterless control), illustrating activities of the thyroglobulin promoters in rat thyroid cells. Each chart column represents the average of duplicate wells and duplicate experiments. The CAT concentrations are expressed as a percentage of the CAT concentration of the lysate from the pCMVCAT6 transfections.

3.4. Investigation of the cell type specificity of the feline thyroglobulin promoter Non-thyroid feline cell lines CCC, CRFK, FEA and skin fibroblast cells were transfected with pfetgp5CAT6, pBLdTgW, pCMVCAT6 and pBLCAT6, as described above. Each cell line was transfected at least three times, except CRFK, which was transfected only once. No expression of CAT was detected from pfetgp5CAT6 in any cell line except FEAs, where similar very low levels of background expression (of approximately 0.02% to 0.03% of CAT expressed from CMV) were detected from pBLdTgW, which contains the canine promoter. The transfection efficiencies achieved in the immortalised non-thyroid cells were very much greater than in FRTL-5 cells (approximately 5% to 30%), though there was variation between experiments and cell lines. (Variations in transfection efficiency between wells were generally small and were corrected for.) These much higher transfection efficiencies mean that even low-level promoter activity in these non-thyroid cells would have been readily detected if present. The skin fibroblasts (established from primary culture) were transfected at lower efficiency than the other cell lines (less than 1%) but this transfection efficiency was still greater than achieved in FRTL-5 cells. These results show that the cloned thyroglobulin promoter fragment, in vitro, is sufficient to direct cell type specific expression.

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

195

4. Discussion 4.1. The feline thyroglobulin promoter sequence The feline thyroglobulin promoter was identified: the promoter fragment generated was 310 base pairs long and included 267 base pairs of feline sequence upstream from the putative cap site. This fragment was sufficient to drive cell type specific expression in vitro. Similarly, transient expression studies in FRTL-5 cells (rat promoter) and canine thyrocytes in primary culture (bovine promoter) have demonstrated that approximately 170 bp of the rat promoter or 250 bp of the bovine promoter can confer thyroid specific expression and proper transcriptional control of thyroglobulin expression [26,38,46]. Additionally, approximately 200 bp fragments of the human, bovine, canine and rat promoters have been shown to properly control expression of a reporter gene in canine thyrocytes [39]. In fact, the first 200 base pairs upstream from the cap site include most of the regulatory elements so far identified. The thyroglobulin promoter binds both ubiquitous transcription factors (TATA binding protein [TBP] and TBP-associated factors [TAFs], and, in the rat at least, ubiquitous factor A [UFA]), and thyroid specific factors. The specific transcription factors interact directly with the promoter and may also interact with the general transcription factors, which are required for the formation of the transcription initiation complex but are insufficient to drive gene expression alone. Three thyroid transcription factors have been identified, TTF-1 and TTF-2, and Pax-8 [46,47,48,49,51,51,52,53]. Thyroid specific transcription of the thyroglobulin gene relies on the co-ordinated activity of these factors, which have a restricted tissue distribution, and is the result of the exact combination of factors being uniquely present in the thyroid cell [54]: only the thyroid cell expresses TTF-1, TTF-2 and Pax-8 at the same time. The regions identified as transcription factor binding sites are designated A (and A⬘, to refer to the sequence 5⬘ to A), B or D, K and C. The positions of these sites are: A, approximately ⫺130 to ⫺165 bp from the cap site; B or D, approximately ⫺104 to ⫺128 bp; K, approximately ⫺80 to ⫺100 bp; and C, ⫺60 to ⫺80 bp [24,39,55,56]. The exact positions of the binding sites vary slightly from species to species, and have not been exactly determined for all sites in all species. The feline promoter shows good overall homology with the known sequences: homology with bovine, canine, human, rat and mouse promoters as shown in Figure 3 is 81%, 89%, 78%, 48% and 75%, respectively. Most importantly, there is conservation of sequence in the A, B/D, K and C regions, which are likely to represent conserved transcription factor binding sites, and which are required for promoter function and tissue specific expression in other species. Previous reports have shown that between approximately 165 bp and 200 bp upstream from the cap site, identity between canine, bovine, human and rat degenerates to only 3% [39]. It is certainly true that there is very little homology between species beyond ⫺200 nucleotides from the cap site. However, comparing the known sequences with the feline sequence, several short regions of conservation can be identified (Figure 3). Firstly, the sequence GTTCTGCT is conserved between feline, canine and bovine between approximately ⫺184 and ⫺195 bp. The sequence (T)GTTCT can be seen in the proximal region of

196

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

the rat thyroglobulin promoter and is also conserved in the binding site for the glucocorticoid receptor, and several other steroid hormones [57,58]. In the region of ⫺164 to ⫺192 bp (relative to the putative feline cap site) there is considerable homology between feline and canine sequences (26 of 30 bases, 87%). In addition, a CACCC sequence was identified within the feline promoter (⫺199 to ⫺204), and this is also present in the bovine, human and rat as shown in Figure 3. Interestingly, the CACCC sequence in the rat is found exactly at the point at which deletions began to reduce promoter activity in the series of experiments carried out by Musti et al. [26]. This element has also been identified in the proximal exon 2 promoter of the rat insulin-like growth factor gene, where it is required for basal promoter activity [59]. Glucocorticoid receptor and CACCC sequences often function synergistically [60,61], and the proximity of these sequences in the thyroglobulin promoters merits further investigation. 4.2. The activity and specificity of the feline thyroglobulin promoter The results presented in this study demonstrate that the 310 bp fragment (from ⫺266 to ⫹36 base pairs from the putative cap site, and including 8 bp of adaptor sequence at the 5⬘ end) of the feline thyroglobulin promoter is a functional promoter, and is able to direct tissue specific expression, in vitro. Predictably, the promoter is less potent than the CMV promoter, its activity being between 8.75% and 31.1% of that of the CMV promoter in transient transfection of FRTL-5 cells. Specific promoters are often relatively inefficient activators of transcription, certainly compared to ubiquitously active cellular or viral promoters like CMV IE, simian virus 40 and Rous sarcoma virus promoters (RSV) [62,63,64,65]. Although the feline thyroglobulin promoter is less potent than the CMV promoter, it appears to be as potent, if not more potent, than the canine and bovine promoters in FRTL-5 cells. This adds support for the fidelity of the identified feline sequence. Also, the bovine promoter has been used to direct expression of the herpes simplex virus thymidine kinase gene (HSV-tk) in the thyroids of transgenic mice, resulting in sufficient transgene expression to cause specific ablation of thyrocytes on administration of ganciclovir [66], suggesting that the feline promoter may also be sufficiently active to drive expression of prodrug activating enzymes for thyroid gene therapy, provided gene transfer was adequate. In transient transfections in FRTL-5 cells, expression levels from the bovine construct were somewhat lower than those from the feline and canine constructs. This may reflect a genuine difference in the activity of the bovine, canine and feline promoters in rat thyroid cells, due to species specific differences in promoter activation, perhaps as a result of factors such as a higher affinity of rat thyroid transcription factors for the binding sites in the feline and canine promoters than equivalent binding sites in the bovine promoter. It is possible that the interactions between heterologous transcription factors and promoters, which have undergone species-specific divergence, may be less effective than homologous interactions, which have evolved together, and that different promoter-transcription factor pairings may be influenced by this to different degrees, resulting in different levels of promoter activation. It has been previously reported that, in heterologous systems, promoter activity may be markedly altered by subtle mutations in the D region, in keeping with the theory that any “mismatch” of promoter and transcription factor may affect promoter activation [39].

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

197

It is interesting that the bovine promoter has the lowest activity, as this construct includes an upstream enhancer element, which the canine and feline promoter sequences lack. This enhancer region (at approximately ⫺1744 bp to ⫺1904 bp) contains three TTF-1 binding sites, two of which are important in transcriptional activation [67,68]. However, previous work has shown that the inclusion of these elements in their natural context does not enhance proximal promoter activity, most likely due to silencing activity of two copies of bovine repetitive DNA, which separate the upstream enhancer element from the proximal thyroglobulin promoter. If the repetitive elements were removed, the enhancer elements markedly increased promoter activity and gene expression [67]. Thus the bovine construct is more difficult to compare exactly with the feline promoter than the canine, as this promoter contains regulatory elements which the feline and canine do not. However, the activities of 250 bp or 3 kb of the intact bovine promoter in primary dog thyrocytes are essentially the same [38], suggesting that the presence of the upstream sequence should have no effect on the proximal promoter. It remains possible that the relative enhancer and silencer activities may be different in FRTL-5 cells compared to canine cells, and that this may also contribute to the lower expression from the bovine construct. Alternatively, the difference in CAT expression from the bovine promoter may simply reflect a difference in transfection efficiency. The canine construct is of very similar size to the feline construct, but the bovine construct is larger, as it encodes approximately 2 kb of promoter, compared to approximately 200 bp in the canine and approximately 310 bp in the feline. The backbone plasmids are of very similar size and construction (pBLCAT3 is 4.5 kb, while pBLCAT6 is 4.25 kb). The larger size of the bovine construct may have resulted in lower transfection efficiency on transfection of this plasmid, which could be responsible for the lower levels of CAT expression recorded with this promoter, and which would not be controlled for by cotransfection with pMV12. In order to investigate the promoter in a homologous system, transfection of the cell line PETCAT 1 was carried out. However, no transgene (CAT) expression was detected upon transfection of these cells with constructs containing the feline, canine and bovine thyroglobulin promoters despite greater transfection efficiencies than had been achieved in FRTL-5 cells. The canine and bovine promoters acted as an internal control, as these constructs are proven [24,39], demonstrating that this failure was not unique to the newly identified feline promoter (data not shown), and supporting the theory that this lack of promoter is a failure of the in vitro system rather than the promoter itself. There are no reports known to the author where PETCAT 1 cells have been transfected with transgenes under the control of a thyroglobulin promoter, and it may be that these cells have lost their ability to activate the thyroglobulin promoter, or that this ability is greatly reduced, due to dedifferentiation in culture. These cells do retain some differentiated functions in common with FRTL-5 cells, such as epithelial morphology, TSH mediated cAMP activation, and pseudofollicle formation under certain conditions, but have not been as well characterised, or as extensively used, as the FRTL-5 cell line [41,69]. PETCAT-1 cells are reported to produce thyroglobulin, as detected by immunocytochemistry [41]. However, positive immunocytochemistry does not confirm ongoing thyroglobulin synthesis. We developed primary cultures from both normal and hyperthyroid feline thyroids during the course of this work, and found that though these cells stained positively for thyroglobulin they were

198

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

negative for thyroglobulin RNA on Northern blotting, suggesting the transcriptional machinery was not functionally active (data not shown, 70). In addition, this failure to demonstrate promoter activity in a homologous in vitro system is not unique to the feline: it has previously proved impossible to demonstrate the activity of the bovine thyroglobulin promoter in bovine thyroid cells [71], despite the fact that this promoter has since been shown to be fully active both in vitro and in vivo [25,29,30,32,33]. The feline thyroglobulin promoter is highly cell type specific in vitro, with no expression in non-thyroid cell lines, despite transfection efficiencies many times greater (up to 100 fold or more) than achieved in FRTL-5 cells. These results are encouraging, and suggest that the feline thyroglobulin promoter will be suitable for transcriptional targeting of gene expression in hyperthyroid cats. However, the low transfection efficiencies achieved in thyroid cells in vitro were disappointing, and will have to be improved for effective gene therapy in vivo. In addition, in the face of low transduction efficiency, the relatively low level of promoter activity is potentially limiting in the clinical situation. In summary, the identified feline thyroglobulin promoter is a functional promoter, with activity comparable to that of other known thyroglobulin promoters, and is highly tissue specific in vitro. These characteristics suggest the promoter will be useful in the transcriptional targeting of gene therapy to the feline thyroid. Acknowledgment This work was funded by the Wellcome Trust, and the authors are very grateful for this support. The authors would also like to thank Dr. Simon Tucker, who was involved in the submission of the original grant application. In addition, the advice of Drs. Allison Armstrong and Brian Willett is gratefully acknowledged. Drs. Daniel Christophe and Darren Foster, and Professor Hans Gerber have been most generous in the donation of materials, as detailed in the text. References [1] Cotter SM. Uncommon disorders in the cat. Proceedings of the American Animal Hospital Association’s 46th Annual Meeting 1979;115–17. [2] Peterson ME, Johnson GF, Andrews LK. Spontaneous hyperthyroidism in the cat. Proceedings of the American College of Veterinary Internal Medicine 1979;108. [3] Peterson ME, Kintzer PP, Cavanagh PG, Fox PR, Ferguson DC, Johnson GF, Becker DV. Feline hyperthyroidism: pretreatment clinical and laboratory evaluation of 131 cases. J Am Vet Med Assoc 1983;183: 103–10. [4] Scarlett JM, Moise NS, Rayl J. Feline hyperthyroidism: a descriptive and case-control study. Preventative Veterinary Medicine 1988;6:295–309. [5] Thoday KL, Mooney CT. Historical, clinical and laboratory features of 126 hyperthyroid cats. Vet Rec 1992;131:257– 64. [6] Leav I, Schiller AL, Rijnberk A, Legg MA, der Kinderen PJ. Adenomas and carcinomas of the canine and feline thyroid. Am J Pathol 1976;83:61–122. [7] Holzworth J, Theran P, Carpenter JL, Harpster NK, Todoroff RJ. Hyperthyroidism in the cat: ten cases. J Am Vet Med Assoc 1980;176:345–53. [8] Hoenig M, Goldschmidt MH, Ferguson DC, Koch K, Eymontt MJ. Toxic nodular goitre in the cat. J Small Anim Pract 1982;23:1–12.

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

199

[9] Peterson ME, Ferguson DC. Thyroid diseases. In: Textbook of Veterinary Internal Medicine: Diseases of the Dog and Cat, Ettinger SJ (ed) 3rd ed. W.B. Saunders, Philadelphia: 1989. p. 1632–75. [10] Hart IR, Vile RG. Targeted gene therapy. Br Med Bull 1995;51:647–55. [11] Vile RG, Hart IR. Use of tissue-specific expression of the herpes simplex thymidine kinase gene to inhibit growth of established murine melanomas following direct intratumoral injection of DNA. Cancer Res 1993;53:3860 – 4. [12] Siders WM, Halloran PJ, Fenton RG. Transcriptional targeting of recombinant adenoviruses to human and murine melanoma cells. Cancer Res 1996;56:5638 – 46. [13] Dematteo RP, McClane SJ, Fisher K, Yeh H, Chu G, Burke C, Raper SE. Engineering tissue-specific expression of a recombinant adenovirus: selective transgene transcription in the pancreas using the amylase promoter. J Surg Res 1997;72:155– 61. [14] Clark AJ, Iwobi M, Cui W, Crompton M, Harold G, Hobbs S, Kamalati T, Knox R, Neil C, Yull F, Gusterson B. Selective cell ablation in transgenic mice expression E. coli nitroreductase. Gene Ther 1997;4:101–10. [15] Anderson LM, Swaminathan S, Zackon I, Tajuddin AK, Thimmapaya B, Weitzman SA. Adenovirusmediated tissue targeted expression of HSVtk for the treatment of breast cancer. Gene Ther 1999;6:854 – 64. [16] Osaki T, Tanio Y, Tachibana I, Hosoe S, Kumagai T, Kawase I, Oikawa S, Kishimoto T. Gene therapy for carcinoembryonic antigen-producing human lung cancer cells by cell type-specific expression of herpes simplex virus thymidine kinase gene. Cancer Res 1994;54:5258 – 61. [17] Crystal RG, Hirschowitz E, Lieberman M, Daly J, Kazam E, Henschke C, Yankelevitz D, Kemeny N, Silverstein R, Ohwada A, Russi T, Mastrangeli A, Sanders A, Cooke J, Harvey BG. Phase I study of direct administration of a replication deficient adenovirus vector containing the E. coli cytosine deaminase gene to metastatic colon carcinoma of the liver in association with the oral administration of the pro-drug 5-fluorocytosine. Hum Gene Ther 1997;8:985–1001. [18] Brand K, Lo¨ser P, Arnold W, Bartels T, Strauss M. Tumor cell-specific transgene expression prevents liver toxicity of the adeno-HSVtk/GCV approach. Gene Ther 1998;5:1363–71. [19] Manome Y, Abe M, Hagen MF, Fine HA, Kufe DW. Enhancer sequences of the DF3 gene regulate expression of the herpes simplex virus thymidine kinase gene and confer sensitivity of human breast cancer cells to ganciclovir. Cancer Res 1994;54:5408 –13. [20] Ring CJ, Blouin P, Martin LA, Hurst HC, Lemoine NR. Use of transcriptional regulatory elements of the MUC1 and ERBB2 genes to drive tumour-selective expression of a prodrug activating enzyme. Gene Ther 1997;4:1045–52. [21] Pang S, Taneja S, Dardashti K, Cohan P, Kaboo R, Sokoloff M, Tso C-L, Dekernion JB, Belldegrun AS. Prostate tissue specificity of the prostate-specific antigen promoter isolated from a patient with prostate cancer. Hum Gene Ther 1995;6:1417–26. [22] Gotoh A, Ko SC, Shirakawa T, Cheon J, Kao C, Miyamoto T, Gardner TA, Ho LJ, Cleutjens CB, Trapman J, Graham FL, Chung LW. Development of prostate-specific antigen promoter-based gene therapy for androgen-independent human prostate cancer. J Urol 1998;160:220 –9. [23] Christophe D, Cabrer B, Bacolla A, Targovnik H, Pohl V, Vassart G. An unusually long poly(purine)poly(pyrimidine) sequence is located upstream from the human thyroglobulin gene. Nucleic Acids Res 1985;13:5127– 44. [24] Donda A, Vassart G, Christophe D. Isolation and characterization of the canine thyroglobulin gene promoter region. Biochim Biophys Acta 1991;1090:235–7. [25] de Martynoff G, Pohl V, Mercken L, van Ommen GJ, Vassart G. Structural organization of the bovine thyroglobulin gene and of its 5⬘-flanking region. Eur J Biochem 1987;164:591–9. [26] Musti AM, Ursini VM, Avvedimento EV, Zimarino V, Di Lauro R. A cell type specific factor recognizes the rat thyroglobulin promoter. Nucleic Acids Res 1987;15:8149 – 66. [27] Bishop JO, al-Shawi R, Wallace H. Method of altering the metabolic state of non-dividing cells and obtained transgenic animals. Patent, University of Edinburgh, EP 049776-A 1, 1992. [28] Ledent C, Parmentier M, Vassart G. Tissue-specific expression and methylation of a thyroglobulinchloramphenicol acetyltransferase fusion gene in transgenic mice. Proc Natl Acad Sci USA 1990;87:6176 – 80.

200

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

[29] Ledent C, Dumont J, Vassart G, Parmentier M. Thyroid adenocarcinomas secondary to tissue-specific expression of simian virus-40 large T-antigen in transgenic mice. Endocrinology 1991;129:1391– 401. [30] Ledent C, Dumont JE, Vassart G, Parmentier M. Thyroid expression of an A2 adenosine receptor transgene induces thyroid hyperplasia and hyperthyroidism. EMBO J 1992;11:537– 42. [31] Ledent C, Marcotte A, Dumont JE, Vassart G, Parmentier M. Differentiated carcinomas develop as a consequence of the thyroid specific expression of a thyroglobulin-human papillomavirus type 16 E7 transgene. Oncogene 1995;10:1789 –97. [32] Rochefort P, Caillou B, Michiels FM, Ledent C, Talbot M, Schlumberger M, Lavelle F, Monier R, Feunteun J. Thyroid pathologies in transgenic mice expressing a human activated Ras gene driven by a thyroglobulin promoter. Oncogene 1996;12:111– 8. [33] Feunteun J, Michiels F, Rochefort P, Caillou B, Talbot M, Fournes B, Mercken L, Schlumberger M, Monier R. Targeted oncogenesis in the thyroid of transgenic mice. Horm Res 1997;47:137–9. [34] Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA. An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res 1995;23:1087– 8. [35] Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Laboratory Press, Cold Spring Harbor, 1982. [36] Boshart M, Kluppel M, Schmidt A, Schutz G, Luckow B. Reporter gene constructs with low background utilising the CAT gene. Gene 1992;110:129 –30. [37] Luckow B, Schutz G. CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res 1987;15:5490. [38] Christophe D, Gerard C, Juvenal G, Bacolla A, Teugels E, Ledent C, Christophe-Hobertus C, Dumont JE, Vassart G. Identification of a cAMP-responsive region in thyroglobulin gene promoter. Mol Cell Endocrinol 1989;64:5–18. [39] Donda A, Javaux F, Van Renterghem P, Gervy-Decoster C, Vassart G, Christophe D. Human, bovine, canine and rat thyroglobulin promoter sequences display species-specific differences in an in vitro study. Mol Cell Endocrinol 1993;90:R23– 6. [40] Ambesi-Impiombato FS, Parks LA, Coon HG. Culture of hormone-dependent functional epithelial cells from rat thyroids. Proc Natl Acad Sci USA 1980;77:3455–9. [41] Gerber H, Peter H, Bosiger J, Studer H, Drews R, Ferguson DC, Peterson ME, Becker DV. Different continuous cell lines from adenomatous feline goiters widely differ in morphologic, functional and growth parameters. In: Progress in Thyroid Research Gordon A, Gross J, Hennemann G (eds). Rotterdam and Brookfield, Balkema, 1991. p. 541– 4. [42] Crandell RA, Fabricant CG, Nelson-Rees WA. Development, characterization, and viral susceptibility of a feline (Felis catus) renal cell line (CRFK). In Vitro 1973;9:176 – 85. [43] Jarrett O, Laird HM, Hay D. Determinants of host range of feline leukaemia viruses. J Gen Virol 1973;20:169 –75. [44] Flynn JN, Cannon CA, Beatty JA, Mackett M, Rigby MA, Neil JC, Jarrett O. Induction of feline immunodeficiency virus-specific cytotoxic T cells in vivo with carrier free synthetic peptide. J Virol 1994;68:5835– 44. [45] Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 1976;72:248 –54. [46] Lee NT, Nayfeh SN, Chae CB. Induction of nuclear protein factors specific for hormone-responsive region during activation of thyroglobulin gene by thyrotropin in rat thyroid FRTL-5 cells. J Biol Chem 1989;264: 7523–30. [47] Zannini M, Francis-Lang H, Plachov D, Di Lauro R. Pax-8, a paired domain-containing protein, binds to a sequence overlapping the recognition site of a homeodomain and activates transcription from two thyroidspecific promoters. Mol Cell Biol 1992;12:4230 – 41. [48] Sinclair AJ, Lonigro R, Civitareale D, Ghibelli L, Di Lauro R. The tissue-specific expression of the thyroglobulin gene requires interaction between thyroid-specific and ubiquitous factors. Eur J Biochem 1990;193:311– 8.

L. Blackwood et al. / Domestic Animal Endocrinology 20 (2001) 185–201

201

[49] Civitareale D, Saiardi A, Falasca P. Purification and characterization of thyroid transcription factor 2. Biochem J 1994;304 (Pt 3):981–5. [50] Fabbro D, Di Loreto C, Beltrami CA, Belfiore A, Di Lauro R, Damante G. Expression of thyroid specific transcription factors TTF-1 and PAX-8 in human thyroid neoplasia. Cancer Res 1994;54:4744 –9. [51] Van Renterghem P, Vassart G, Christophe D. Pax 8 expression in primary cultured dog thyrocyte is increased by cyclic AMP. Biochim Biophys Acta 1996;1307:97–103. [52] Kambe F, Seo H. Mediation of the hormone- and serum-dependent regulation of thyroglobulin gene expression by thyroid transcription factors in rat thyroid FRTL-5 cells. J Endocrinol 1996;150:287–98. [53] Fabbro D, Pellizzari L, Mercuri F, Tell G, Damante G. Pax-8 protein levels regulate thyroglobulin gene expression. J Mol Endocrinol 1998;21:347–54. [54] Francis-Lang H, Zannini M, De Felice M, Berlingieri MT, Fusco A, Di Lauro R. Multiple mechanisms of interference between transformation and differentiation in thyroid cells. Mol Cell Biol 1992;12:5793– 800. [55] Javaux F, Bertaux F, Donda A, Francis-Lang H, Vassart G, DiLauro R, Christophe D. Functional role of TTF-1 binding sites in bovine thyroglobulin promoter. FEBS Lett 1992;300:222– 6. [56] Civitareale D, Lonigro R, Sinclair AJ, Di Lauro R. A thyroid-specific nuclear protein essential for tissue-specific expression of the thyroglobulin promoter. EMBO J 1989;8:2537– 42. [57] Scheidereit C, Geisse S, Westphal HM, Beato M. The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumour virus. Nature 1983;304:749 –52. [58] Zajac JD, Chilco PJ. Transcriptional control and the regulation of endocrine genes. Clin Exp Pharmacol Physiol 1995;22:935– 43. [59] Wang X, Talamantez JL, Adamo ML. A CACCC box in the proximal exon 2 promoter of the rat insulin-like growth factor I gene is required for basal promoter activity. Endocrinology 1998;139:1054 – 66. [60] Schule R, Muller M, Otsuka-Murakami H, Renkawitz R. Cooperativity of the glucocorticoid receptor and the CACCC-box binding factor. Nature 1988;332:87–90. [61] Muller M, Baniahmad C, Kaltschmidt C, Renkawitz R. Multiple domains of the glucocorticoid receptor involved in synergism with the CACCC box factor(s). Mol Endocrinol 1991;5:1498 –503. [62] Rothmann T, Katus HA, Hartong R, Perricaudet M, Franz WM. Heart muscle-specific gene expression using replication defective recombinant adenovirus. Gene Ther 1996;3:919 –26. [63] Guo ZS, Wang LH, Eisensmith RC, Woo SL. Evaluation of promoter strength for hepatic gene expression following adenovirus-mediated gene transfer. Gene Ther 1996;3:802–10. [64] Franz WM, Rothmann T, Frey N, Katus HA. Analysis of tissue-specific gene delivery by recombinant adenovirus containing cardiac-specific promoters. Cardiovasc Res 1997;35:560 – 6. [65] Brand K, Lo¨ser P, Arnold W, Bartels T, Strauss M. Tumor cell-specific transgene expression prevents liver toxicity of the adeno-HSV-tk/GCV approach. Gene Ther 1998;5:1363–71. [66] Wallace H, Ledent C, Vassart G, Bishop JO, al-Shawi R. Specific ablation of thyroid follicle cells in adult transgenic mice. Endocrinology 1991;129:3217–26. [67] Christophe-Hobertus C, Donda A, Javaux F, Vassart G, Christophe D. Identification of a transcriptional enhancer upstream from the bovine thyroglobulin gene. Mol Cell Endocrinol 1992;88:31–7. [68] Christophe-Hobertus C, Christophe D. Two binding sites for thyroid transcription factor 1 (TTF-1) determine the activity of the bovine thyroglobulin gene upstream enhancer element. Mol Cell Endocrinol 1999;149:79 – 84. [69] Kintzer PP, Ferguson DC, Hoenig M, Peterson ME. Heterogeneous effects of growth factors and serum on TSH and forskolin stimulated cAMP levels in continuous cell strains derived from feline toxic nodular goitre [19th Annual Meeting of the European Thyroid Association. Hannover, Germany, August 25–30, 1991. Abstracts]. Ann Endocrinol (Paris) 1991;52:87. [70] Blackwood L. Transcriptional Targeting of Gene Therapy in the Hyperthyroid Cat: Preliminary Investigations. University of Glasgow, PhD, 2000. [71] Roger PP, Christophe D, Dumont JE, Pirson I. The dog thyroid primary culture system: a model of the regulation of function, growth and differentiation expression by cAMP and other well-defined signalling cascades. Eur J Endocrinol 1997;137:578 –9.