Characterization of the hepatitis B virus- and nucleocapsid gene transcriptional regulatory elements

VIROLOGY

191,

31-41 (1992)

Characterization of the Hepatitis 6 Virus X- and Nucleocapsid Gene Transcriptional Regulatory Elements’ PEI ZHANG, ANNEKE K. RANEY, AND ALAN MclACHlAN2 Department

of Molecular

and Experimental

Medicine,

The Scripps Research Institute,

10666 North Torrey Pines Road, La Jolla, California 92037

Received May 26, 1992; accepted July 6, 1992 The regulatory DNA sequence elements that control the expression of the hepatitis B virus X- and nucleocapsid genes in the differentiated human hepatoma cell lines, Huh7, Hep36, PLC/PRF/5, and HepG2, the dedifferentiated human hepatoma cell line, HepG2.1, and the human cervical carcinoma cell line, HeLa S3, were analyzed using transient transfection assays. In this system, the hepatitis B virus enhancer I located between coordinates 1071 (-239) and 1238 (-72) increases transcription from the X-gene promoter located between coordinates 1239 (-71) and 1376 (+67) more than 30-fold in the differentiated hepatoma and the HeLa S3 cell lines. In the dedifferentiated hepatoma cell line, HepG2.1, the enhancer I sequence increases the level of transcription from the X-gene promoter approximately 1 Ofold. The enhancer I subregion between coordinates 1117 (-193) and 1204 (-106) appears to be important for enhancer function only in the differentiated hepatoma cell lines, whereas the enhancer I subregion between coordinates 1222 (-88) and 1238 (-72) is required for enhancer activity in each of the cell lines examined. In all of the cell lines, the X-gene minimal promoter element was within a 138-nucleotide sequence located between coordinates 1239 (-71) and 1378 (+67). The enhancer I sequence increases transcription from the nucleocapsid promoter approximately 3- to lo-fold in the Huh7, Hep3B, PLC/PRF/S, and HeLa S3 cell lines, whereas it had little influence on the level of transcription from this promoter in HepG2 and HepG2.1 ceils. The minimal nucleocapsid promoter element was within a 105 nucleotide sequence located between coordinates 1700 (-85) and 1804 (+20). This indicates that the levels of transcription from the X- and nucleocapsid gene promoters are determined in a cell-type-specific manner, in part, by the o 1992 Academic PWSS, I~C. hepatitis B virus enhancer I and the corresponding minimal promoter sequence.

INTRODUCTION

expression of the 3.5-kb transcripts plays a central role in the HBV life cycle. The regulatory sequence elements that control the expression of the HBV transcripts have been examined in a variety of cell lines. These analyses have suggested that the HBV genome contains two transcriptional enhancer elements in addition to regulatory sequence elements located near the transcription initiation sites of each of the HBV RNAs (Siddiqui et al., 1986, 1987; Raney et a/., 1989, 1990, 1991a,b; Karpen et al., 1988; Honigwachs et al., 1989; Yee, 1988; Pourcel et a/., 1982; De-Medina et al., 1988; Chang et al., 1989; Nakao era/., 1989; Shaul era/, 1986; LopezCabrera era/., 1990; Waisman er al., 1990; Treinin and Laub, 1987; Yaginuma and Koike, 1989). The two enhancer elements, termed enhancer I and enhancer II, are located between the 3’ end of the surface antigen gene open reading frame (ORF) and the 5’ end of the X-gene ORF, and 5’to the nucleocapsid ORF, respectively (Jameel and Siddiqui, 1986; Antonucci and Rutter, 1989; Bulla and Siddiqui, 1988; Faktor et al., 1988; Shaul et al., 1985; Chang et al., 1987; Wang er al., 1990; Yuh and Ting, 1990, 1991; Vannice and Levinson, 1988; Tognoni et al., 1985; Elfassi, 1987; Zhou and Yen, 1990; Lopez-Cabrera et a/., 1991).

The hepatitis B virus (HBV) genome is a 3.2-kb partially double-stranded DNA molecule (Robinson et a/., 1974; Hruska et al., 1977; Landers et al., 1977). It appears that upon infection of hepatocytes with HBV the partially double-stranded DNA molecule is converted to a covalently closed circular DNA molecule which serves as the transcriptional template for the synthesis of the HBV RNAs (Will et al., 1987). The transcripts encoded by the HBV genome are 3.5,2.4,2.1, and 0.7 kb and are translated into the nucleocapsid and polymerase polypeptides, the large surface antigen polypeptide, the middle and major surface antigen polypeptides, and the X-gene polypeptide (Cattaneo et a/., 1983, 1984; Yokosuka et a/., 1986; lmazeki et a/., 1987; Su era/., 1989; Kaneko and Miller, 1988; Ganem and Varmus, 1987). The shortest of the 3.5-kb RNAs serves as the template for replication of the HBV genome by reverse transcription in addition to coding for the core and polymerase polypeptides (Ou et a/., 1990; Nassal et a/,, 1990). Therefore, the regulation of the

’ Publication No. 7410-MEM from The Scripps Research Institute. ’ To whom reprint requests should be addressed. 31

0042-6822/92

$5.00

Copyright Q 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

ZHANG,

32

RANEY, AND MCLACHLAN

The regulatory sequence elements controlling the level of transcription from the nucleocapsid gene promoter have been examined in transient transfection assays (Karpen et al., 1988; Honigwachs et al., 1989; Yee, 1988; L6pez-Cabrera et a/., 1990; Yaginuma and Koike, 1989) and an in vitro transcription system (Waisman et a/., 1990). These studies indicate that the minimal nucleocapsid gene promoter is located between coordinates 1701 (-84 relative to one of the nucleocapsid gene transcription initiation sites (+l) located at coordinate 1785 (Yaginuma et a/., 1987; Sells et a/., 1988; Honigwachs et a/., 1989; Waisman et a/., 1990; Hu and Siddiqui, 1991)) and 1773 (-12) and that its activity may be modulated in a tissue-specific manner by the enhancer I sequence (Karpen et a/., 1988; Antonucci and Rutter, 1989; Yee, 1988). The regulatory sequence elements controlling the level of transcription from the X-gene promoter have also been examined in transient transcription assays (Treinin and Laub, 1987; Trujillo et a/., 1991; Guo et a/., 1991) and have been localized between coordinates 1074 (-236 relative to one of the X-gene transcription initiation sites (+l) located at coordinate 1310 (Siddiqui et a/., 1987; Treinin and Laub, 1987; Hu and Siddiqui, 1991)) and 1355 (+46). This observation suggests that the X-gene promoter and enhancer I sequences are located in the same region of the HBV genome and may not be functionally separable. In the current study, the regulatory sequence elements that control the level of transcription from the Xand nucleocapsid gene promoters were examined in a variety of different cell lines. This analysis was performed in an attempt to characterize further the X- and nucleocapsid minimal promoter sequences and to determine the relative contributions of the HBV enhancer sequences to their transcriptional activity. The characterization of these transcriptional regulatory elements permitted the identification of cell-type-specific regulation of these two transcription units. It also suggested that the enhancer I sequence is separable from the minimal X-gene promoter and can modulate the activity of both the X- and nucleocapsid gene promoters. MATERIALS

AND METHODS

Plasmid constructions The various steps in the cloning of the plasmid constructs used in the transfection experiments were performed by standard techniques (Sambrook et a/., 1989). The HBV sequences in these constructions were derived from the plasmid, pCP10, which contains two copies of the HBV genome (subtype ayw) cloned into the EcoRI site of pBR322 (Dubois eta/., 1980). The

plasmid, XpLUC (Fig. l), was constructed by digesting pCPl0 with Ncol, digesting with Ba131 nuclease to remove the X-gene initiation codon, filling in the remaining overhang with the Klenow fragment of Escherichia co/i DNA polymerase, ligating Hindlll linkers, digesting with Hindlll, and cloning the 3.2-kbp HBVfragment into the HindIll site of the plasmid, pl SDLUC (Raney et a/., 1990). The unique HBV Ncol site used in this construct is located 67 nucleotides 3’to an X-gene transcription initiation site (Siddiqui et a/., 1987; Treinin and Laub, 1987). Therefore the plasmid, XpLUC, contains one complete HBV genome (coordinates 1375 to 3182/l to 1376’) located directly 5’to the promoterless firefly luciferase (LUC) reporter gene such that the expression of the LUC gene is governed by the hepatitis B X-gene promoter. The designation 1376’has been used to indicate that the nucleotides 1375-l 376 are repeated in this plasmid and that nucleotides 1375-1376 and 1375’-1376’ are distal and proximal to the LUC ORF, respectively. Similarly the plasmid, CpLUC (Fig. 2) was constructed by digesting pCP10 with Fspl, ligating HindIll linkers, digesting with HindIll, and cloning the 3.2-kbp HBV fragment into the /-/indIll site of the plasmid, pl SDLUC. The unique HBV Fspl site used in this construct is located 20 nucleotides 3’to a nucleocapsid gene transcription initiation site (Yaginuma et a/., 1987; Sells et a/., 1988). Therefore the plasmid, CpLUC, contains one complete HBV genome (coordinates 1805 to 3 182/l to 1804) located directly 5’to the promoterless firefly luciferase (LUC) reporter gene such that the expression of the LUC gene is governed by the hepatitis B nucleocapsid gene promoter. The plasmid constructs containing the various deletions, the XpALUC and CpALUC series (Figs. l-6), were generated by appropriate restriction endonuclease or Ba131 nuclease digestions of HBV sequences and subsequent cloning steps similar to those described for XpLUC and CpLUC. All deletion breakpoints generated by Ba/31 nuclease digestion were determined by dideoxynucleotide sequencing (Sanger et al., 1977). The XpALUC deletion series (Fig. 1) was generated from the CpALUC deletion series by deletion of the nucleotide sequence between coordinates 1374/l 375 to 1804 by digesting with Ncol and Kpnl, digesting with mung bean nuclease, subsequently filling in the remaining overhangs with the Klenow fragment of E. co/i DNA polymerase, and self-ligation with T4 DNA ligase. The Kpnl site used in these constructs is located in the pl9DLUC polylinker. The coordinate designation 1374/1375 indicates that the HBV sequence proximal to the luciferase reporter gene in these constructs terminated at either nucleotide 1374 or 1375. The extent of the 5’-deleted nucleotide sequence is indicated in the plasmid designation using

REGULATION

OF HBV GENE EXPRESSION

coordinates derived from the Genbank genetic sequence data bank. The construct, XpAl375-107OSLUC (Fig. 2) was generated by inserting a Sphl linker into the Nsil site (coordinate 1070) of HBV in the plasmid XpAl375-107OLUC. Inversion of the HBV Sphl fragment (coordinates 1071 to 1238) derived from XpAl375-107OSLUC generated the plasmidXpAl3751070SRLUC. The construct, CpAl805-107OSLUC (Fig. 4) was generated by inserting an Sphl linker into the Nsil site (coordinate 1070) of HBV in the plasmid CpA1805-1070LUC. Inversion of the HBV Sphl fragment (coordinates 1071 to 1238) derived from CpAl805-107OSLUC generated the plasmid CpAl8051070SRLUC. The construct, CpAl879-129LUC (Fig. 5) was generated by cloning theXhol toA/ul HBVfragment (coordinates 130 to 1878) between the Sa/l and Smal sites in the pl SDLUC polylinker.

Cells and transfections The human hepatoma cell lines, Huh7, Hep3B, PLCY PRF/5 (Alexander cells), HepG2, and HepG2.1 (Raney et a/., 1990) were grown in RPMI 1640 medium and 10% fetal bovine serum at 37” in 5% CO,-air. The human cervical carcinoma cell line, HeLa S3, was grown in Dulbecco’s modified Eagle’s medium containing 4.5 mg/ml glucose and 10% fetal calf serum at 37” in 5% CO,-air. Transfections were performed as described previously (McLachlan et al., 1987; Raney et a/., 1989, 1990). The transfected DNA mixture comprised 15 pg of a LUC plasmid and 1.5 pg of pSV2CAT (Gorman et a/., 1982) which served as an internal control for transfection efficiency. pSV2CAT directs the expression of the chloramphenicol acetyltransferase (CAT) gene using the SV40 early promoter. Cell extracts were prepared 40 to 48 hr after transfection and assayed for luciferase and chloramphenicol acetyltransferase activity as previously reported (De Wet et al., 1987).

RESULTS Deletion analysis of the HBV X-gene promoter The transcription regulatory elements that control the level of expression from the X-gene promoter were examined in a variety of cell lines using transient transfection assays. A series of promoter deletions was constructed and used to direct the expression of the luciferase reporter gene (Fig. 1). The initial plasmid, XpLUC (Fig. l), contains the complete sequence of the HBV genome. A series of 5’ deletions of the HBV genome was tested for its effect on the transcriptional activity of the X-gene promoter. In all the cell lines examined, transcriptional activity was retained when sequences upstream of nucleotide coordinate 1071 (plasmid XpAl375-107OLUC) were deleted, indicating that all

33

the regulatory sequences controlling X-gene expression were located within the 306-bp sequence between coordinates 107 1 and 1376 (-239 and +67 relative to an X-gene transcription initiation site) (Figs. 1 and 7). In the differentiated hepatoma cell lines, Huh7, Hep3B, PLCIPRW5, and HepG2, deletion of the 88-bp nucleotide sequence between coordinates 1117 (-193) and 1204 (-106) results in a 5- to 20-fold reduction in transcription from the X-gene promoter (plasmids XpAl375-1116LUC and XpAl375-1204LUC). This sequence does not appear to modulate the activity of the X-gene promoter in HepG2.1 and HeLa cells, suggesting that it might positively regulate the level of transcription from the X-gene promoter by interacting with transcription factor(s) present only in differentiated hepatoma cell lines. In HeLa S3 cells, the sequence between coordinates 1071 (-239) and 1116 (-194) appears to modulate the transcriptional activity of the X-gene promoter approximately 2-to 3-fold. The regulation of X-gene expression by this sequence element appears to be limited to HeLa S3 cells. In all the cell lines examined, deletion of the 17 nucleotide sequence between coordinates 1205 and 1221 (plasmids XpA1375-1204LUC and XpAl375122 1LUC) did not further reduce the transcriptional activity from the X-gene promoter. However, deletion of a further 17 nucleotide sequence located between coordinates 1222 and 1238 (plasmids XpA1375-122 1LUC and XpAl375-1238LUC) resulted in a greater than 8fold reduction in transcriptional activity from the X-gene promoter. This observation suggests that the sequence between coordinates 1222 (-88) and 1238 (-72) interacts with transcription factor(s), present in a variety of cell types, which positively regulate the expression of the X-gene. Minimal promoter activity was observed in Huh7, PLC/PRF/5, HepG2, and HepG2.1 cells when only 71 nucleotides (plasmid XpAl3751238LUC) upstream of a transcription initiation site were present, although in Huh7 and PLC/PRF/S cells the transcriptional activity was less than 1% of that observed for the XpLUC construct (Fig. 1). (The minimal promoter activity observed from the plasmid XpAl375-1238LUC in Huh7 and PLC/PRF/5 cells was greater than twice the background activity of the pl SDLUC control construct.) Therefore, the minimal promoter sequence of the X-gene is located within the nucleotide sequence from -71 to +67 (coordinates 1239 to 1376).

Influence of the enhancer I sequence on the transcriptional activity of the X-gene promoter The deletion analysis of the X-gene promoter (Fig. 1) indicates that the nucleotide sequence between coordinates 1071 and 1238 represents an important regulatory region for X-gene expression. This sequence

ZHANG,

34 cp

RANEY, AND MCCACHLAN

psp sp

*

XP s

w*

Eh .

pr, a X

PS PC -

LUC

s

c

P m

Relatiie luciferass activity

P

P\,.r-,.,...,.,\1

XpLUC xpA1375- 12sLuc xpA1375- 1070~~~ xpA1375- I I I~LUC xpA1375- 1204~1~~ xpA1375-1221~~~ xpA1375- 1236LUC xpA1375- 1273LUC xpA1375-1302LUC p 19DLUC

-

-

Huh7 1.00 1.05 1.46 0.81 0.12

0.08

0.00 0.00 0.00 0.00

Hep3B 1.00 1.15 2.02 1.78 0.10 0.12 0.00 0.00 0.00 0.00

Al 1.oo 0.82 1.03 0.96 0.07 0.10 0.00 0.00 0.00 0.00

HepG2 HepG2.1 1.oo 1.oo 1.10 2.19 1.25 3.61 2.65 2.95 0. ia 0.78 0.24 0.94 0.03 0.08 0.00 0.00 0.00 0.00 0.00 0.00

HeLa 1.oo 2.32 3.25 0.46 0.30 0.35 0.00 0.00 0.00 0.00

FIG. 1. Deletion analysis of the HBV X-gene promoter. Arrows indicate the positions and directions of transcription from the HBV X-gene (Xp), core (Cp) or nucleocapsid, pre-Sl (PSp), and surface antigen (Sp) promoters, respectively. Boxes indicate the positions of the HBV enhancer I sequence (Eh), HBV polyadenylation sequence (PA), X-gene ORF (X), presurface antigen ORF (PS), surface antigen ORF (S), precore ORF (PC), core ORF (C), polymerase ORF (P), and luciferase ORF (LUC). The horizontal lines indicate the HBV sequences present in the various XpALUC series plasmids. The plasmid XpLUC contains the HBV sequences from nucleotide coordinates 1375 to 3182/l to 1376’(nucleotide sequences are designated by using coordinates derived from the GenBank genetic sequence data bank). The designation 1376’ has been used to indicate that the nucleotides 1375-l 376 are repeated in this plasmid and that the nucleotides 1375-l 376 and 1375’-1376’are distal and proximal to the LUC reporter gene, respectively. The HBV sequences deleted from the various plasmids are designated by nucleotide coordinates. Al (Alexander cells) indicates the PLC/PRF/5 cell line. The internal control used to correct for transfection efficiencies was pSV2CAT.

closely corresponds to the HBV enhancer I region (Shaul et a/., 1985; Ben-Levy et al., 1989; Tognoni et al., 1985; Trujillo et al., 1991). In an attempt to determine if the enhancer I can be separated from the Xgene minimal promoter, the influence of altering the orientation of the enhancer I sequence relative to the X-gene minimal promoter element was examined (Fig. 2). Insertion of an Sphl linker at coordinate 1070 (plasmid XpAl375-107OSLUC) did not affect the level of transcription from the X-gene promoter. The deletion of the enhancer I region (plasmid XpAl375-1238LUC) resulted in a greater than 1O-fold reduction in transcriptional activity from the X-gene promoter. Insertion of the enhancer I sequence (coordinates 1071 to 1238) in the reverse orientation relative to the X-gene minimal promoter located between coordinates 1239 and 1376 (plasmid XpAl375-1070SRLUC) resulted in the recovery of almost full X-gene transcriptional activity in all the cell lines examined except Huh7 cells. However, even in the case of the Huh7 cells the insertion of the enhancer I in the opposite orientation in front of the Xgene minimal promoter increased transcription from this promoter approximately 25-fold. These results indicate that the enhancer I sequence can regulate the level of expression from the X-gene minimal promoter in an orientation-independent manner. Deletion analysis of the HBV nucleocapsid

promoter

The transcription regulatory elements that control the level of expression from the nucleocapsid promoter

were examined in a similar manner to the X-gene promoter. A series of 5’ promoter deletions, derived from the initial CpLUC plasmid which contains the complete sequence of the HBV genome, was constructed and used to direct the expression of the luciferase reporter gene (Fig. 3). In all the cell lines examined, transcriptional activity was retained when sequences upstream of nucleotide coordinate 107 1 (plasmid CpAl8051070LUC) were deleted, indicating that all the regulatory sequences controlling nucleocapsid gene expression were located within the 734-bp sequence between coordinates 1071 and 1804 (-714 and +20 relative to a nucleocapsid gene transcription initiation site) (Figs. 3 and 7). Within this sequence there are two regions which can clearly be identified as representing important transcriptional regulatory elements of the nucleocapsid gene (Fig. 3). These are the enhancer I region, located between coordinates 1071 and 1238, and the minimal promoter sequence which is contained within the region between coordinates 1700 (-85) and 1804 (+20). However, it is clear that the relative contribution of these two elements to the transcriptional activity from the nucleocapsid promoter is cell-type-dependent. In the differentiated hepatoma cell lines, Huh7, Hep3B, and PLC/PRF/5, and the cervical carcinoma cell line, HeLa S3, deletion of the 134-bp sequence between nucleotide coordinates 1071 and 1238 results in a 3- to lo-fold reduction in transcription from the nucleocapsid gene promoter. This sequence

REGULATION cp M

OF HBV GENE EXPRESSION

psp sp -we

35

xp -e Eh .

0

LUC

X BBI

PC c -

Relative luciferose octiiity

P

P

m

Huh7 XpLUC xpA1375xpA1375xpA1375xpA1375p 19DLUC

e 4-

1070~~~ 10705~~~ 1070SRLUC 1238LUC

-

1.00 1.46 0.98 0.07 0.00 0.00

Hep3B 1.00 2.02 1.65 0.89 0.00 0.00

Al 1.oo 1.03 1.92 0.41 0.00 0.00

HepG2 HepG2.1 1.oo 1.00 3.61 1.25 2.54 4.84 0.56 0.64 0.03 0.08 0.00 0.00

HeLa 1.00 3.25 1.86 0.36 0.00 0.00

FIG. 2. Influence of the enhancer I sequence on the transcriptional activity from the HBV X-gene promoter. Arrows, boxes, and line designations are as described for Fig. 1. The horizontal lines indicate the HBV sequences present in the various XpALUC plasmids. The vertical line indicates the insertion of an Sphl linker at nucleotide coordinate 1070 of the HBV genome in the plasmid XpAl375-107OSLUC. The arrowhead indicates the inversion of the nucleotide sequence between coordinates 1070 and 1238 in the plasmid XpA1375-1070SRLUC. The HBV sequences deleted from the various plasmids are designated by nucleotide coordinates. Al (Alexander cells) indicates the PLCIPRW5 cell line. The internal control used to correct for transfection efficiencies was pSV2CAT.

closely corresponds to the previously identified HBV enhancer I (Shaul et al., 1985; Ben-Levy et al., 1989; Tognoni et a/., 1985; Trujillo eta/., 1991) and positively regulates the level of transcription from the nucleocapsid gene promoter. However, the enhancer I sequence appears to modulate the level of transcription from the

w 0 X

I PC c -

CpLUC CpAl805-2639LUC cpA1605- 129LUC CpAl805- 107OLUC c&6051116LUC cpA1605- 1204~uc C~Al805- 122 ILUC c&9051238LUC cpA1805- 1273LUC c&6051302~uc

nucleocapsid gene promoter to a lesser extent than it influences transcription from the X-gene promoter in these cell lines. The enhancer I sequence influences the transcriptional activity of the nucleocapsid gene promoter to the greatest extent in the differentiated hepatoma cell line, Huh7, and this effect appears to be

Eh .

PS

s P

LUC

X QBI

-I

Relotffe lucifaose activity

-

Huh7 1.00 0.87 1.95

2.76 0.70 0.12 0.16

C~Ali305-1668LUC

0.07 0.08 0.06 0.07 0.16 0.06 0.04

cpA1805-

0.01

C~&805-

0.03 0.00 0.00 0.00 0.00 0.00

C~A1805-1374LUC

c;A1605cp&305-

1574Luc 1599Luc

166lLUC 1699LUC c&1051737~uc C~&805- 1749LUC C&605-1769LUC C~81605- 1776LUC p’l9DLUC

Hep3B 1.00 0.85 0.36 1.90 0.62 0.28 0.33 0.26 0.18 0.12

0.06 0.08 0.07 0.14 0.04 0.06 0.01 0.00 0.00 0.00 0.00

Al 1.00 0.91 1.56 2.76 0.71 0.33 0.54 0.37 0.21 0.22 0.25 0.36 0.19 0.25 0.08 0.06 0.00 0.00 0.00 0.00 0.00

HepGP HepG2.1 1.oo 1.oo 0.76 1.28 2.96 1.95 2.66 2.91 2.44 1.39 2.75 0.90 1.61 1.31 0.56 0.76 1.26 0.63 1.20 0.72 0.84 0.54 1.11 0.76 0.44 0.49 0.16 0.51 0.06 0.34 0.06 0.34 0.00 0.02 0.00 0.00 0.00 o”.“oO 0.00 0.00 0.00

HeLa 1.00 0.72 1.16 1.74 0.80 0.49 0.47 0.34 0.22 0.59 0.37 0.57 0.36 0.33 0.24 0.25 0.00 0.02 0.00 0.00 0.00

FIG. 3. Deletion analysis of the HBV nucleocapsid gene promoter. Arrows, boxes, and line designations are as described for Fig. I. The horizontal lines indicate the HBV sequences present in the various CpALUC series plasmids. The plasmid CpLUC contains the HBV sequences from nucleotide coordinates 1805 to 3 182/l to 1804 (nucleotide sequences are designated by using coordinates derived from the GenBank genetic sequence data bank). The HBV sequences deleted from the various plasmids are designated by nucleotide coordinates. Al (Alexander cells) indicates the PLCIPRW5 cell line. The internal control used to correct for transfection efficiencies was pSV2CAT. ND, not done.

36

ZHANG,

RANEY, AND MCLACHLAN

mediated largely by the sequence between coordinates 1117 and 1204 (plasmids CpAl805-1116LUC CpAl805-1204LUC). These observations are consistent with the enhancer I activating the X- and nucleocapsid gene promoters by the same or similar mechanisms in Huh7, Hep36, PLC/PRF/5, and HeLa S3 cells. Surprisingly, the enhancer I sequence does not appear to influence the level of transcription from the nucleocapsid gene promoter in the dedifferentiated hepatoma cell line, HepG2.1, and the differentiated hepatoma cell line, HepG2, which contrasts with its stimulation of transcription from the X-gene promoter. The explanation for this result is currently unclear although the possibility that sequence elements downstream of enhancer I might compensate for the deletion of this sequence could account for these observations. The 5’ boundary of the nucleocapsid gene minimal promoter sequence was identified within a 38-bp sequence located between nucleotides 1700 and and CpAl8051737 (plasmids CpAl804-1699LUC 1737LUC) (Fig. 3). Therefore, the minimal promoter sequence of the nucleocapsid gene is located within the nucleotide sequence from -85 to +20 (coordinates 1700 to 1804). This is most apparent in the HepG2.1 and HeLa S3 cell lines where the minimal promoter sequence contributes about one-third of the total transcriptional activity from the nucleocapsid promoter. In the other cell lines, deletion of sequences up to coordinate 1737 (-48) is associated with a 6- to lo-fold reduction in transcriptional activity (plasmids CpAl8051699LUC and CpAl805-1737LUC). The sequence between coordinates 1239 and 1699 (plasmids CpAl804-1238LUC to CpAl805-1699LUC) modulates the activity of the nucleocapsid promoter to varying extents in different cell lines (Fig. 3). In HeLa S3 cells, this sequence does not appear to have a role in regulating nucleocapsid gene expression. In Huh7, Hep3B, and HepG2.1 cells this region activates transcription from the nucleocapsid gene promoter approximately 3- to 4-fold but the sequences mediating this effect cannot be precisely identified (Fig. 3). The sequence between coordinates 1669 and 1681 (plasand CpAl805-1681 LUC) mids CpAl804-1668LUC appears to increase transcription from the nucleocapsid gene promoter approximately 3-fold in PLC/PRF/5 cells and the sequence between coordinates 1575 and 1681 (plasmids CpAl805-1574LUC and CpAl8051681 LUC) increases transcription from this promoter about 20-fold in HepG2 cells. These effects identify additional sequence elements involved in the regulation of the expression of this gene in these different cell lines and probably reflect the interaction of some cell-

type-specific transcription tory elements.

factors with these regula-

Influence of the enhancer I sequence on the transcriptional activity of the nucleocapsid gene promoter The deletion analysis of the nucleocapsid gene promoter (Fig. 3) indicates that the nucleotide sequence between coordinates 1071 and 1238 represents a regulatory element modulating the level of expression from the nucleocapsid gene promoter in several cell lines. This sequence closely corresponds to the HBV enhancer I region (Shaul et a/., 1985; Ben-Levy et a/., 1989; Tognoni et al., 1985; Trujillo et al., 1991). In an attempt to determine further if this regulatory element has the properties of an enhancer, the influence of altering the orientation of the enhancer I sequence relative to the nucleocapsid gene promoter was examined (Fig. 4). Insertion of an Sphl linker at coordinate 1070 (plasmid CpAl805-107OSLUC) did not affect the level of transcription from the nucleocapsid gene promoter. The deletion of the enhancer I region (plasmid CpA1805-1238LUC) resulted in a 2- to 1O-fold reduction in transcriptional activity from the nucleocapsid gene promoter. Inversion of the enhancer I sequence located between coordinates 1071 and 1238 upstream of the nucleocapsid promoter (plasmid CpAl375-107OSRLUC) resulted in the maintenance of almost full nucleocapsid gene promoter activity in all the cell lines examined. This demonstrates that the sequence located between coordinates 1071 and 1238 influences the activity of the nucleocapsid gene promoter at a distance of approximately 500 nucleotides in an orientation-independent manner which is consistent with the designation of this region as HBV enhancer I.

Characterization of the influence of the HBV precore sequence on the nucleocapsid gene promoter activity The nucleocapsid gene promoter deletion series (Fig. 3) which was analyzed lacked sequences from the precore region of the HBV genome. The possible regulatory function of the precore sequences in determining the transcriptional activity of the nucleocapsid gene promoter were examined (Fig. 5). The constructs, CpLUC and CpAl805-129LUC, display full nucleocapsid gene promoter activity. The construct, CpAl805129LUC, contains the nucleotide sequence from coordinate 130 to 1804 (+20) directing the expression of the luciferase reporter gene. The promoter activity of

REGULATION

OF HBV GENE EXPRESSION

psp sp

XP **

*e

M a PS Ix-.--.

s .-xl

LUC -

X

c

--

glKo5CpAl805CpA1805CpA1805p 1BDLUC

cp

Eh I

X I PC -

-

P

107OLUC 107OSLUC 1070SRLUC 1238LUC

37

Relative lucifsrase activity

-9 Huh7 1.00 2.78 1.40 0.64 0.07 0.00

c-f-

Hep3B 1.00 1.90 1.40 2.32 0.26 0.00

Al 1.00 2.78 1.32 1.50 0.37 0.00

HepGP HepG2.1 1.oo 1.00 2.91 2.86 1.77 3.3 1 1.35 2.65 0.76 0.58 0.00 0.00

HeLa 1.00 1.74 1.17 0.84 0.34 0.00

FIG. 4. Influence of the enhancer I sequence on the transcriptional activity from the HBV nucleocapsid gene promoter. Arrows, boxes, and line designations are as described for Fig. 1. The horizontal lines indicate the HBV sequences present in the various CpALUC plasmids. The vertical line indicates the insertion of an Sphl linker at nucleotide coordinate 1070 of the HBV genome in the plasmid CpA1805-107OSLUC. The arrowhead indicates the inversion of the nucleotide sequence between coordinates 1070 and 1238 in the plasmid CpAl805-1070SRLUC. The HBV sequences deleted from the various plasmids are designated by nucleotide coordinates. Al (Alexander cells) indicates the PLC/PRF/5 cell line. The internal control used to correct for transfection efficiencies was DSV~CAT.

Influence of the X-gene on the nucleocapsid gene promoter

this construct was compared with the construct, CpAl879-129LUC, which contains the sequence from coordinate 130 to 1878 (+94). This construct includes 63 bps of the precore region immediately upstream of the luciferase reporter gene. It is apparent that the inclusion of this precore sequence in the nucleocapsid gene promoter does not result in a major change in the level of transcription in any of the cell lines examined (Fig. 5). Therefore, it seems that the sequence between coordinates 1805 and 1878 (+21 and +94) does not contribute to the transcriptional activity of the nucleocapsid gene promoter. These observations are consistent with a previous study which indicated that the precore region did not contain sequence elements involved in the regulation of the level of transcription from the nucleocapsid promoter (Honigwachs et al.,

It has been reported that the product of the X-gene can transactivate the SV40 enhancer and early promoter (Spandau and Lee, 1988; Zahm eta/., 1988; Twu and Robinson, 1989; Siddiqui et a/., 1989; Luber et a/., 1991) whereas there have been conflicting results concerning the effect of the X-gene product on the transcriptional activities from HBV genes (Spandau and Lee, 1988; Twu and Robinson, 1989; Siddiqui et al,, 1989; Colgrove et a/., 1989; Balsano et a/., 1991). Since several of the constructs used have either the potential to code for an X-gene product or to be transactivated by it, this possibility was examined. The construct CpLUC (Fig. 6) which contains an 1 1-codon carboxyl-terminally truncated X-gene plus the regula-

1989).

ti

Eh I

a

X I PC -

LUC X

& c

Relatiie luciferme activity

P

CpLUC cpA1805- 129LUC CpA1879- 129LUC p 19DLUC

:

Huh7 1.00 1.95 2.99 0.00

Hap38 1.oo 0.36 1.98 0.00

Al 1.00 1.58 0.49 0.00

HepG2 HepGP. 1 HeLa 1.00 1.00 1.00 1.95 2.96 1.16 2.50 4.46 0.50 0.00 0.00 0.00

FIG. 5. influence of the precore nucleotide sequence on the transcriptional activity from the HBV nucleocapsid gene promoter. Arrows, boxes, and line designations are as described for Fig. 1. The horizontal lines indicate the HBV sequences present in the various CpALUC series plasmids. The vertical line indicates the inclusion of the precore sequence in the plasmid CpA1879-129LUC immediately proximal to the LUC reporter gene. This construct contains the HBV nucleotide sequence from coordinates 130 to 1878. The HBV sequences deleted from the various plasmids are designated by nucleotide coordinates. Al (Alexander cells) indicates the PLC/PRF/5 cell line. The internal control used to correct for transfection efficiencies was pSV2CAT.

ZHANG,

38

RANEY, AND MCLACHLAN

psp sp **

xpcp -c-c EhXlX2

I PC -

c

gf”C

cpx2Luc

p 19DLUC

Relative luciferase activity Huh7 1.00 0.66 2.18 0.00

Hep3B 1.00 0.63 0.53 0.00

Al 1.00 0.60 0.76 0.00

HepGP HepG2.1 1.00 1.00 0.48 2.00 0.56 1.06 0.00 0.00

HeLo 1.00 0.69 0.33 0.00

FIG. 6. Influence of the X-gene product on the transcriptional activity from the HBV nucleocapsid gene promoter. Arrows, boxes, and line designations are as described for Fig. 1. The arrowheads (or vertical lines) designated Xl and X2 indicate the locations of the 4-nucleotide deletion and 1 I-nucleotide insertion in the CpXl LUC and CpX2LUC constructs, respectively. The horizontal lines indicate the HBV sequences present in the various CpLUC plasmids. Al (Alexander ceils) indicates the PLCIPRW5 cell line. The internal control used to correct for transfection efficiencies was pSV2CAT. The level of chloramphenicol acetyltransferase activity encoded by the pSV2CAT plasmid in these transfection analyses was not affected by cotransfection with the CpLUC, CpXl LUC, and CpX2LUC constructs.

tory sequence elements necessary for its expression, was modified so as to either delete four nucleotides (coordinates 1375-l 378 representing part of the Ncol site) including the initiation codon for the X-gene or insert 11 nucleotides into the middle of the X-gene open reading frame (coordinate 1577 representing insertion of a Sacl linker into the Rsrll site). Both of these modifications, generating plasmids CpXl LUC and CpX2LUC, respectively, were designed to generate derivatives of CpLUC which could not produce a functional X-gene product (Ritter et a/., 199 1; Balsano et al., 1991). Comparison of the absolute (unpublished observation) and relative activities of the nucleocapsid gene promoter and the SV40 early promoter in transient cotransfection assays using several cell lines indicated that if the truncated X-gene product were being synthesized by the CpLUC construct, it did not appear to influence the activity of the promoters examined in this system. Therefore, it appears that the identification of the c&-acting sequences involved in the regulation of nucleocapsid gene expression are not influenced by the expression of X-gene products in this analysis. DISCUSSION A deletion analysis of the HBV X- and nucleocapsid gene promoters was performed to examine the transcriptional regulatory elements that control the expression of these two genes and to investigate the role of c&-acting sequences in their coordinate expression. The deletion analysis of the X-gene promoter demonstrated that the nucleotide sequence between coordinates 107 1 (-239) and 1238 (-72) and corresponding to the enhancer I sequence modulated the activity of

this promoter, whereas the minimal X-gene promoter was located between coordinates 1239 (-71) and 1376 (+67) (Figs. 1,2, and 7). The sequence between coordinates 11 17 (-193) and 1204 (- 106) influences the level of transcription from the X-gene promoter only in differentiated hepatoma cell lines, whereas the sequence between coordinates 1222 (-88) and 1238 (-72) is an important regulatory element in all the cell lines examined. This presumably reflects the cell-type distribution of the transcription factors which interact with these sequences. Consistent with this assumption, liver-cell-enriched DNA binding factor(s) which recognize sequences between coordinates 1117 and 1204 (Trujillo eta/., 1991; Guo et al., 1991) and ubiquitous DNA binding factor(s) which recognize sequences between coordinates 1222 and 1238 have been reported (Pate1et al., 1989; Dikstein et a/., 1990; Ben-Levy et al., 1989; Trujillo et a/., 1991; Guo er al., 1991). The sequence elements which regulate transcription from the X-gene promoter have been examined previously using transient transfection assays (Treinin and Laub, 1987; Trujillo et al., 1991; Guo et al., 1991). For comparison purposes, all coordinates reported here are relative to the HBV ayw subtype nucleotide sequence from the GenBank genetic sequence data bank (Fig. 7). In the initial study performed in PLC/PRF/ 5 cells, a modulatory sequence was identified between coordinates 972 and 1116 which increased transcription approximately 1O-fold and an essential region for X-gene promoter activity was detected between coordinates 1117 and 1238 (Treinin and Laub, 1987). These results are different from our observations regarding the regulatory role of sequences between coordinates 1071 and 1116. In our study, this sequence was not essential for enhancer I modulation of X-gene expres-

REGULATION

OF HBV GENE EXPRESSION

1071

1116 . ~GTmAATCTAAGCAGGCTTTcmT~TcGccAAcT&AAGGccT+rcTGTGTAAi

CAATACCTGAACCTTTACCCCGTTGCCCGGCAACGGCCAG 1204 .

1221

1273

1238

1302

131O(Cl) l ->X-RNA

TCGGCTCCTCTGCCGATCCATA~TGCGGAACTCCTAGCCCTTG~TG~T~GCAGCAGG

1374 .xi

GTCCCGTCGGCGCTGAATCCTGCGGACGACCCTTCTCGGGGTCGCTTGGGACTCTCTCGT

1574 1599 . . . . CCGTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGGTCGCA 1668 . TGGAGACCACCGTGAACGCCCACCAAATATTGCCCAAGGG 1681

1699 . .

1749 1769 1785(+1) 1737 1776 . . . . .-X-RNA . . ACTGGGAGGAGTTGGGGGAGGAGATTAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGC 1804 . . PCi ATAAATTGGTCTGCGCACCAGCACC~C~CTTTTTCACCTCTGCCT~TCATCTCTTG 1878 . CL TTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCTGTGCC~GGGTGGCT~GGGGC~

FIG. 7. Sequence of the HBV genome (subtype ayw) from coordinates 1071 to 1905 which includes the enhancer I and II regions plus the X- and nucleocapsid gene promoter sequences. The numbered nucleotides indicate the breakpoints of analyzed deletions. The arrows indicate the approximate location of a predominant HBV X- and nucleocapsid gene transcription initiation site (X-RNA (Siddiqui eta/., 1987; Treinin and Laub, 1987; Hu and Siddiqui, 1991) and C-RNA (Yaginuma et a/., 1987; Sells eta/., 1988; Honigwachs ef al.. 1989; Waisman et a/., 1990; Hu and Siddiqui, 1991) respectively). The translation initiation codons of the X-gene (Xi), precore (PCi), and core (Ci) open reading frames are underlined.

sion in PLC/PRF/5 cells. However, the importance of the sequence located between coordinates 1117 and 1238 for X-gene promoter activity was apparent (Treinin and Laub, 1987). In a second study utilizing Huh7 and HepG2 cells, the sequence between coordinates 1074 and approximately 1 140 increased transcription from the X-gene promoter approximately 20fold and the X-gene minimal promoter was located downstream of coordinate 1 168 (Trujillo et a/., 199 1). It has also been reported that the sequence between coordinates 1 169 and 12 18 is an important regulatory element controlling the level of expression from the

39

X-gene promoter (Guo et al., 1991). These observations are also consistent with our analysis. In this study, cell-type-specific regulation of the HBV nucleocapsid gene promoter was observed (Figs. 3 and 4). However, two regions of the HBV genome displayed the greatest influence on the activity of this promoter. The sequence from coordinates 107 1 to 1238 and spanning the enhancer I region modulated the level of transcription in Huh7, HepSB, PLC/PRF/5, and HeLa S3 cells as was also observed for the X-gene promoter. A minimal promoter element located between coordinates 1700 and 1804 was functional in all the cell lines examined but contributed to varying extents to the total transcriptional activity of the nucleocapsid gene promoter. This region contains a binding site, the II-B element (coordinates 1704 to 1715) for a C/EBP-like protein which constitutes part of the enhancer II sequence (Yuh and Ting, 1990, 1991). The upstream region of the enhancer II, the II-A element (coordinates 1646 to 1668) is located outside the nucleocapsid gene minimal promoter element in a region which modulates the level of transcription of the nucleocapsid gene promoter in HepG2 cells. These observations suggest the II-A and II-B elements of enhancer II may represent binding sites for transcription factors involved in the regulation of transcription from the nucleocapsid gene promoter and indicate that these elements can function independently of each other in the context of the nucleocapsid gene promoter. This is different from the manner in which both elements are required for enhancer II to be functional (Yuh and Ting, 1991). The sequence elements which regulate the expression from the nucleocapsid gene promoter have also been characterized previously using transient transfection (Yee, 1988; Yaginuma and Koike, 1989) and in vitro transcription assays (Waisman et a/., 1990). An initial deletion analysis of the nucleocapsid gene promoter was performed using transient transfection assays in Huh7 cells and utilizing HBV sequences lacking the enhancer I sequence (Yaginuma and Koike, 1989). This analysis indicated that a sequence between coordinates 1524 and 1669 modulated the nucleocapsid gene promoter activity approximately 3-fold and that an essential element of the minimal promoter sequence was located between coordinates 1701 and 1726. These results are consistent with our observations. A second transfection analysis of a series of nucleocapsid gene promoter deletions was performed using Huh6 and HepG2 cells (Yee, 1988). This analysis indicated that the enhancer I sequence did not modulate the nucleocapsid gene promoter and indicated that all of the promoter activity was derived from HBV sequences located within coordinates 1687 and 1773.

ZHANG,

40

RANEY. AND MCLACHLAN

This promoter region corresponds to the minimal promoter element identified in this study which contributes approximately one-third of the transcriptional activity of the nucleocapsid gene promoter in HepG2.1 and HeLa cells (Fig. 3). The absence of any modulation of the transcriptional activity from the nucleocapsid gene promoter by nucleotide sequences upstream of coordinate 1687 in HepG2 cells (Yee, 1988) was unexpected. These observations might be explained by differences in HBV subtypes or differentiation state of the HepG2 cells (Raney ef a/., 1990) used in these studies (Fig. 3). The minimal promoter sequence has also been shown to be active in a HeLa cell derived in vitro transcription system (Waisman et al., 1990). The enhancer I sequence does not influence the level of transcription from the nucleocapsid gene promoter in this in vitro transcription system which might be expected from the limited effect this sequence has in the HeLa S3 cell transfection assays (Figs. 3 and 4).

ACKNOWLEDGMENTS We are grateful to Dean Courtney for excellent technical assistance. We thank Judith Preston for the preparation of the manuscript. This work was supported by Public Health Service Grants Al251 83 and Al30070 from the National Institutes of Health and funds from the Sam and Rose Stein Charitable Trust.

REFERENCES ANTONUCCI, T. K.. and RUTTER,W. J. (1989). Hepatitis B virus (HBV) promoters are regulated by the HBV enhancer in a tissue-specific manner. J. l&o/. 63, 579-583. BALSANO, C., AVANTAGGIATI, M. L., NATOLI, G., et al. (1991). Fulllength and truncated versions of the hepatitis B virus (HBV) X protein (pX) transactivate the cMYC protooncogene at the transcriptional level. Biochem. Biophys. Res. Commun. 176, 985-992. BEN-LEW, R., FAKTOR, O., BERGER,I., and SHAUL, Y. (1989). Cellular factors that interact with the hepatitis B virus enhancer. Mol. Cell. Biol. 9, 1804-l 809. BULLA. G. A., and SIDDIQUI, A. (1988). The hepatitis B virus enhancer modulates transcription of the hepatitis B virus surface antigen gene from an internal location. J. Viral. 62, 1437-l 441. CA~ANEO, R.. WILL, H., HERNANDEZ, N., and SCHALLER, H. (1983). Signals regulating hepatitis B surface antigen transcription. Nature 305, 336-338. CATTANEO, R., WILL, H., and SCHALLER, H. (1984). Hepatitis B virus transcription in the infected liver. EMBO J. 3, 2191-2196. CHANG, H-K., WANG, B-Y., YUH, C-H., WEI, C-L., and TING, L-P. (1989). A liver-specific nuclear factor interacts with the promoter region of the large surface protein gene of human hepatitis B virus. Mol. Cell. Biol. 9. 5189-5197. CHANG, H. K., CHOU, C. K., CHANG, C., et a/. (1987). The enhancer sequence of human hepatitis B virus can enhance the activity of its surface gene promoter. Nucleic Acids Res. 15, 2261-2268. COLGROVE,R., SIMON, G., and GANEM, D. (1989). Transcriptional activation of homologous and heterologous genes by the hepatitis B virus X gene product in cells permissive for viral replication. J. Viral. 63,401 g-4026. DE WET, J. R., WOOD, K. V., DELUCA, M., HELINSKI, D. R., and SUSRA-

MANI. S. (1987). Firefly luciferase gene: Structure and expression in mammalian cells. Mol. Cell. Biol. 7, 725-737. DE-MEDINA, T., FAKTOR,O., and SHAUL, Y. (1988). The S promoter of hepatitis B virus is regulated by positive and negative elements. Mol. Cell. Biol. 8, 2449-2455. DIKSTEIN, R., FAKTOR, O., BEN-LEVY, R., and SHAUL, Y. (1990). Functional organization of the hepatitis B virus enhancer. Mol. Ce//. Biol. 10, 3683-3689. DUBOIS, M. F., POURCEL,C., ROUSSET.S., CHANY, C.. and TIOLLAIS, P. (1980). Excretion of hepatitis B surface antigen particles from mouse cells transformed with cloned viral DNA. froc. Nat/. Acad. Sci. USA 77,4549-4553. ELFASSI,E. (1987). Broad specificity of the hepatitis B enhancer function. virology 160, 259-262. FAKTOR,O., DE MEDINA, T., and SHAUL, Y. (1988). Regulation of hepatitis B virus S gene promoter in transfected cell lines. virology 162, 362-368. GANEM, D., and VARMUS, H. E. (1987). The molecular biology of the hepatitis B viruses. Ann. Rev. Biochem. 56, 651-693. GORMAN, C. M., MOFFAT, L. F., and HOWARD, 8. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, 1044-1051. Guo, W., BELL, K. D., and Ou, J.-H. (1991). Characterization of the hepatitis B virus fnhl enhancer and X promoter complex. 1. Viral. 65,6686-6692. HONIGWACHS,J., FAKTOR, O., DIKSTEIN, R., SHAUL, Y., and LAUB, 0. (1989). Liver-specific expression of hepatitis B virus is determined by the combined action of the core gene promoter and the enhancer. J. Viral. 63, 919-924. HRUSKA, J. F., CLAYTON, D. A., RUBENSTEIN,J. L. R., and ROBINSON, W. S. (1977). Structure of hepatitis B Dane particle DNA before and after the Dane particle DNA polymerase reaction. J. Viral. 21, 666-672. Hu, K.-Q., and SIDDIQUI, A. (1991). Regulation of the hepatitis B virus gene expression by the enhancer element I. Virology 181, 721726. IMAZEKI, F., YAGINUMA, K., OMATA, M.. OKUDA, K., KOBAYASHI,M., and KOIKE, K. (1987). RNA transcripts of hepatitis B virus in hepatocellular carcinoma. Hepafology 7, 753-757. JAMEEL, S., and SIDDIQUI, A. (1986). The human hepatitis B virus enhancer requires trans-acting cellular factor(s) for activity. Mol. Cell. Biol. 6, 710-715. KANEKO, S., and MILLER, R. H. (1988). X-region-specific transcript in mammalian hepatitis B virus-infected liver. J. Viral. 62, 39793984. KARPEN, S., BANERJEE,R., ZELENT, A., PRICE, P., and Acs, G. (1988). Identification of protein-binding sites in the hepatitis B virus enhancer and core promoter domains. Mol. Cell. Biol. 8,5159-5165. LANDERS,T. A., GREENBERG,H. B., and ROBINSON,W. S. (1977). Structure of hepatitis B Dane particle DNA and nature of the endogenous DNA polymerase reaction. J. Viral. 23, 368-376. LOPEZ-CABRERA,M., LE~OVSKY.J., Hu, K.-Q., and SIDDIQUI, A. (1990). Multiple liver-specific factors bind to the hepatitis B virus core/pregenomic promoter: Transactivation and repression by CCAAT/enhancer binding protein. Proc. Nat/. Acad. Sci. USA 87, 50695073. LOPEZ-CABRERA,M., LETOVSKY,J.. Hu, K.-Q., and SIDDIQUI, A. (1991). Transcriptional factor C/EBP binds to and transactivates the enhancer element II of the hepatitis B virus. Virology 183, 825-829. LUBER, B., BURGELT, E., FROMENTAL. C., KANNO, M., and KOCH, W. (1991). Multiple simian virus 40 enhancer elements mediate the trans-activating function of the X protein of hepatitis B virus. Virology 184,808-813. MCLACHLAN, A., MILICH, D. R., RANEY,A. K.. era/. (1987). Expression

REGULATION

OF HBV GENE EXPRESSION

of hepatitis 6 virus surface and core antigens: Influences of pre-S and precore sequences. J. Viral. 61, 683-692. NAKAO, K., MIYAO, Y., OHE, Y., and TAMAOKI, T. (1989). Involvement of an AFPl-binding site in cell-specific transcription of the pres81 region of the human hepatitis B virus surface antigen gene. Nucleic Acids Res. 17, 9833-9842. NASSAL, M., JUNKER-NIEPMANN,M., and SCHALLER,H. (1990). Translational inactivation of RNA function: Discrimination against a subset of genomic transcripts during HBV nucleocapsid assembly. Cell 63, 1357-l 363. Ou, J.-H., BAO, H., SHIH, C., and TAHARA, S. M. (1990). Preferred translation of human hepatitis B virus polymerase from core protein- but not from precore protein-specific transcript. 1. Viral. 64, 4578-4581. PATEL, N. U., JAMEEL, S., ISOM, H., and SIDDIQUI, A. (1989). Interactions between nuclear factors and the hepatitis B virus enhancer. J. Virol. 63, 5293-5301. POURCEL, C., LOUIS, A., GERVAIS, M., CHENCINER, N.. Duaois, M-F., and TIOLLAIS, P. (1982). Transcription of the hepatitis B surface antigen gene in mouse cells transformed with cloned viral DNA. J. Viral. 42, 100-l 05. RANEY,A. K., MILICH, D. R., and MCLACHLAN, A. (1989). Characterization of hepatitis B virus major surface antigen gene transcriptional regulatory elements in differentiated hepatoma cell lines. J. Viral. 63, 3919-3925. RANEY,A. K., MILICH. D. R., EASTON,A. J., and MCLACHLAN, A. (1990). Differentiation specific transcriptional regulation of the hepatitis B virus large surface antigen gene in human hepatoma cell lines. J. Viral. 64, 2360-2368. RANEY. A. K., EASTON, A. J.. MILICH, D. R., and MCLACHLAN, A. (1991 a). Promoter-specific transactivation of hepatitis B virus transcription by a glutamine- and proline-rich domain of hepatocyte nuclear factor 1. J. Viral. 65, 5774-5781. RANEY, A. K., MILICH, D. R., and MCLACHLAN, A. (1991 b). Complex regulation of transcription from the hepatitis B virus major surface antigen promoter in human hepatoma cell lines. 1. Viral. 65,48054811. RITTER. S. E., WHITTEN, T. M., QUETS, A. T., and SCHLOEMER, R. H. (1991). An internal domain of the hepatitis B virus X antigen is necessary for transactivating activity. Virology 182, 841-845. ROBINSON,W. S., CLAMON, D. A., and GREENMAN, R. L. (1974). DNA of a human hepatitis B virus candidate. 1. Viral. 14, 384-391. SAMBROOK, J., FRITSCH, E. F., and MANIATIS, T. (1989). “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. SANGER, F., NICKLEN, S., and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Nat/. Acad. Sci. USA 74, 5463-5467. SELLS, M. A., ZELENT. A. Z., SHVARTSMAN, M., and Acs. G. (1988). Replicative intermediates of hepatitis B virus in HepG2 cells that produce infectious virions. J. Viral. 62, 2836-2844. SHAUL, Y., RUI-~ER, W. J., and LAUB, 0. (1985). A human hepatitis B viral enhancer element. EM60 J. 4, 427-430. SHAUL, Y., BEN LEW. R., and DE MEDINA, T. (1986). High affinity binding site for nuclear factor I next to the hepatitis B virus S gene promoter. EMBO 1. 5, 1967-l 971. SIDDIQUI, A., JAMEEL, S., and MAPOLES, J. (1986). Transcriptional control elements of hepatitis B surface antigen gene. Proc. Nat/. Acad. Sci. USA 83, 566-570.

41

SIDDIOUI, A., JAMEEL, S., and MAPOLES, J. (1987). Expression of the hepatitis B virus X gene in mammalian cells. Proc. Nat/. Acad. SC;. USA 84, 2513-2517. SIDDIOUI,A., GAYNOR, R., SRINIVASAN.A., MAPOLES, J., and FARR, R. W. (1989). Trans-activation of viral enhancers including long terminal repeat of the human immunodeficiency virus by the hepatitis B virus X protein. tiroogy 169, 479-484. SPANDAU, D. F., and LEE, S-D. (1988). Trans-activation of viral enhancers by the hepatitis B virus X protein. J. Viral. 62, 427-434. SU, T-S., LUI, W-Y., LIN, L-H., HAN, S-H., and P’ENG, F-K. (1989). Analysis of hepatitis B virus transcripts in infected human livers. Hepafology 9, 180-l 85. TOGNONI, A., CATTANEO, R., SERFLING,E., and SCHAFFNER,W. (1985). A novel expression selection approach allows precise mapping of the hepatitis B virus enhancer. NucleicAcids Res. 13,7457-7472. TREININ, M., and LAUB, 0. (1987). Identification of a promoter element located upstream from the hepatitis B virus X gene. Mol. Ce//. Biol. 7, 545-548. TRUJILLO, M. A., LETOVSKY,J., MAGUIRE, H. F., LOPEZ-CABREFIA,M., and SIDDIOUI, A. (1991). Functional analysis of a liver-specific enhancer of the hepatitis B virus. Proc. Narl. Acad. Sci. USA 88, 3797-3801. Twu, J-S., and ROBINSON,W. S. (1989). Hepatitis B virus X gene can transactivate heterologous viral sequences. Proc. Nat/. Acad. Sci. USA 86,2046-2050. VANNICE, J. L., and LEVINSON,A. D. (1988). Properties of the human hepatitis B virus enhancer: Position effects and cell-type nonspecificity. J. Viral. 62, 1305-l 313. WAISMAN, A., ALONI, Y., and LAuB, 0. (1990). In vitro regulation of human hepatitis B virus core gene transcription. Virology 177, 737-744. WANG, Y., CHEN, P., Wu, X., et a/. (1990). A new enhancer element, ENII, identified in the X gene of hepatitis B virus. J. Viral. 64, 39773981. WILL, H., REISER,W., WEIMER, T., et a/. (1987). Replication strategy of human hepatitis B virus. J. Viral. 61, 904-91 1. YAGINUMA, K., SHIRAKATA, Y., KOBAYASHI, M., and KOIKE, K. (1987). Hepatitis B virus (HBV) particles are produced in a cell culture system by transient expression of transfected HBV DNA. Proc. Natl. Acad. Sci. USA 84, 2678-2682. YAGINUMA, K., and KOIKE, K. (1989). Identification of a promoter region for 3.6-kilobase mRNA of hepatitis B virus and specific cellular binding protein. J. Viral. 63, 29 14-2920. YEE, J-K. (1988). A liver-specific enhancer in the core promoter region of human hepatitis B virus. Science 246, 658-661. YOKOSUKA,O., OMATA, M., IMA~EKI, F., ITO, Y., and OKUDA, K. (1986). Hepatitis B virus RNA transcripts and DNA in chronic liver disease. N. Engl. J. Med. 315, 1187-l 192. YUH, C.-H., and TING, L.-P. (1990). The genome of hepatitis B virus contains a second enhancer: Cooperation of two elements within this enhancer is required for its function. 1. viral. 64, 4281-4287. YUH, C-H., and TING, L.-P. (1991). C/EBP-like proteins binding to the functional box-a and box-8 of the second enhancer of hepatitis B virus. Mol. Cell. Biol. 11, 5044-5052. ZAHM, P., HOFSCHNEIDER,P. H., and KOSHY, R. (1988). The HBV XORF encodes a transactivator: A potential factor in viral hepatocarcinogenesis. Oncogene 3, 169-l 77. ZHOU, D.-X., and YEN, T. S. B. (1990). Differential regulation of the hepatitis B virus surface gene promoters by a second viral enhancer. J. Biol. Chem. 265,20731-20734.