- Email: [email protected]
Characterization of the human S100A12 (calgranulin C, p6, CAAF1, CGRP) gene, a new member of the 5100 gene cluster on chromosome 1q21
Cell Calcium (1996) 20(6), 459-464 0 Pearson Professional Ltd 1996
Research
Characterization of the human S100A12 (calgranulin C, p6, CAAFl, CGRP) gene, a new member of the SIOO gene cluster on chromosome 1 q21 Roland Wick?, lngo Marenholz2, Dietmar Mischke2, Beat W. Schafer’, Claus W. Heizmannl ‘Kinderspital,
Abteilung
fur Klinische
%stitut fur Experimentelle Berlin, Germany
Onkologie
Chemie,
Universitat
Zurich,
und Transplantationsmedizin,
Zurich,
Switzerland
Virchow-Klinikum
der Humboldt-Universitat
zu Berlin,
Summary Here, we report the characterization of a human cDNA coding for the recently published amino acid sequence of a calcium-binding Sl 00 protein, Sl OOA12 (CGRP, calgranulin C, CAAFl , ~6). The exon/intron structure of the S700A72gene is similar to most other SlOOgenes. It is composed of three exons which are divided by two introns of 900 bp and 400 bp. The protein is encoded by sequences in exons 2 and 3, with exon 2 coding for the N-terminal 45 amino acids and exon 3 coding for the C-terminal 46 amino acids. So far, ten SlOO genes are known to be located on human chromosome lq21 in a clustered organization. Hence, we investigated whether SlOOA7 7 (SlOOC, cdgizzarin) and SIOOA72 are also localized in the Sl 00 gene cluster. We found both genes within the cluster, with SlOOA7 7 being close to SlOOA70 and SIOOA72 between the genes S7OOA8 and SIOOA9. Therefore, the SlOO gene cluster now is composed of 12 differentially expressed family members.
INTRODUCTION Proteins of the SIOO family belong to the large group of EF-hand calcium-binding proteins. Roles in distinct cellular functions such as signal transduction, cell cycle progression or cell differentiation have been proposed for them [ 11. Most S100 proteins are localized in the cytosol, with the exception of Sl OOA2 (in the nucleus) and at
Received 4 July 1996 Revised 28 August 1996 Accepted 28 August 1996 Correspondence to: Dr Beat W. Schafer, Krnderspital, Abteilung fur Klinische Chemie, Universitat Zurich, Steinwiesstrasse 75, CH-8032 Zurich, Switzerland Tel. +41 1 266 75 53: Fax. +41 1 266 71 69 E-mail [email protected]
least three family members which are found extracellularly, probably acting as cytokines (Sl OOp, Sl OOA8, SlOOA9). Since Sl 00 genes are expressed in specific subsets of cells only, they are excellent candidates to function as cell-type specific transducers in calcium signalling pathways. At least ten SlOO genes are organized in a cluster on human chromosome 1q2 1 which led to the introduction of a new nomenclature [2]. A similar cluster might exist on mouse chromosome 3 [3]. So far, three SlOO genes are known to be located on different chromosomes. Sl OOA12 was first described in granulocytes as a cytosolic human protein, p6, which crossreacted with antibodies raised against SlOOAS [4]. The partial 20 amino acid sequence of the N-terminus of p6 was determined and showed similarities with the human protein SlOOA9. Homologous proteins were also found in other species, such as pig and bovine. The pig homologue to 459
460
R Wicki, I Marenholz,
D Mischke,
B W Schtifer,
C W Heizmann
the human SlOOA12 protein was isolated from granulocytes. Its amino acid sequence displayed strong homology to the human proteins SlOOA8 and SlOOA9 (calgranulin A and calgranulin B) and was, therefore, termed calgranulin C 151.Hitomi et al. recently published the amino acid and the cDNA sequence of a bovine homologue to SlOOA12, which was detected in bovine amniotic fluid by using a 45Ca2+overlay technique [6]. The protein was called CAAFl for calcium-binding protein in amniotic fluid. More recently, the complete human amino acid sequence for S1OOA12 was published [7]. It was found in neutrophils as part of the immune response towards a parasite infection and was named CGRP for calgranulin related protein. The identical amino acid sequence was determined for a protein isolated from human neutrophils 181. Here, we report for the first time the nucleotide sequence of a human Sl OOA12 cDNA, the genomic sequence and the exonlintron structure of the gene. Furthermore, we determined the localization of the SI O&I12 gene on the S100 gene cluster on human chromosome lq2 1. The gene SlOUAl I (5’1 OOC, cdgizzarin) was recently localized to chromosome lq21 [9]. Hence, we determined also the precise location of the SI OOAI I gene on the cluster. The new names and symbols for the two genes reported here were chosen considering the date of publication and not the order of the genes in the cluster. These symbols are used throughout this report. MATERIALS Computer
AND
METHODS
analysis
Sequence comparisons were carried out using the GCG software package (version 8.0) of the University of Wisconsin Genetics Computer Group. Southern
blot hybridizations
For hybridizations, blotted YAC DNA carrying the major part of the S100 gene cluster were used (described in 121). Filters were hybridized with [32P]-dATPlabelled (Prime-agene, Promega [lo]) SlOOA12 cDNA (clone 123640, obtained from the UK HGMP Resource Centre, Cambridge, UK) and washed with 1 x SSC at 65°C for 30 min. and 0.5 x SSC at 65°C for 60 min. Pulsed-field electrophoresis and hybridizations with SlOOAl 1 cDNA [ 1 l] were performed as described [ 121.
p6Ex2R, 5’-TCCCTCCAGATGCTCTTCAAG-3’, resulting in amplification of intron 1, and the primers p6ExZF, 5’ATGACAAAACTTGAAGAGCAT-3’ and p6Ex3R, 5’-GTTTATTAACTCTTACTCCCC-3’, resulting in amplification of intron 2 of the gene. 1 ug of genomic DNA isolated from the human epithelial cell line HBL-100 was used in each reaction under the following cycling conditions: 60 s, 95°C; 60 s, 62°C (for intron 1) or 54°C (for intron 2); 120 s, 72°C for 30 cycles. The appropriate amplified fragments were filled in with Klenow enzyme (Promega) and subcloned into the pUC18 vector (Clontech). Sequencing was done on an ALF DNA Sequencer using the AutoRead Sequencing kit (Pharmacia). RESULTS Nucleotide
sequence
of the Sl OOA12 cDNA
In a routine EMBL database search for new SlOO sequences, an EST with similarity to pig calgranulin C and N-terminal human p6 was found (accession numbers R02721 and R02722). The sequences were translated in all six frames using the GCG software package and compared to the published N-terminal 20 amino acid sequence of the human SlOOA12 protein (p6, [4]; for the nomenclature see below). One frame of the translated EST matched to the partial amino acid sequence of the human SlOOAl2 with 100% identity. The following amino acid sequence read in other frames showed an identity of up to 62% compared to the amino acid sequence of the pig SlOOA12 protein (calgranulin C, 151). The clone bearing the EST was available from the HGMP Resource Centre, Cambridge (IMAGE clone 123640). To verify the single sequence analysis deposited in the EST database, the nucleotide sequence of the insert was determined using an ALF automated DNA sequencer and was translated again. We found an open reading frame (ORF) coding for a protein of 92 amino acids, which showed a 70% identity compared to the pig S100A12 sequence (Fig. 1). As the amino acid sequence of the ORF is identical to the published sequence of human S100A12 protein [7,8], this proves that the nucleotide sequence presented in this paper is the cDNA coding for SlOOAl2. In addition, the cDNA contained a 5’ untranslated sequence consisting of 51 nucleotides, which is comparable in length to other SlOO cDNAs, and a larger 3’ untranslated region (113 nucleotides) containing a polyadenylation signal and a polyA tail consisting of 19 adenine residues at the 3’ end of the clone.
PCR
PCR reactions were performed on Perkin-Elmer Cetus and Hybaid Omni-Gene thermal cyclers with the primers p6ExlF, 5’-GCTGTAGCTCCACATTCCT-3’ and Cell Calcium
(1996)
20(6),
459-464
Exonlintron
structure
of the SlOOA12
gene
To determine the exomintron structure of the SIOOAIZ gene, PCR was performed using primers directed against 0 Pearson
Professional
Ltd I996
Characterization
1
of a human
cDNA coding
for SIOO protein
GCTGTAGCTCCACATTccTGTGCATTGAGGGGTTAACATTAGGcTGGG~~ 54 ACAAAACTTGAAGAGCATCTGGAGGGAATTGTCAATATCTTCCACCAATACTCAGTTCGG
55 1 115
T
K
L
E
E
H
LEGIVNIFHQ
114
Y
s
v
R
20
AAGGGGCATTTTGACACCCTCTCTAAGGGTGAGCTGAAGCAGCTGCTTACAAAGGAGCTT 21
175
174
KGHFDTLSKGELKQLLTKEL
40
GCAAACACCATCAAGAATATCAAAGATAAAGCTGTCATTGATGAAATATTCCAAGGCCTG 41
A
N
T
I
K
N
I
K
D
234
KAVIDEIFQGL
60
GATGCTAATCAAGATGAACAGGTCGACTTTCAAGAATTCATATCCCTGGTAGCCATTGCG
235 61
295
DANQDEQVDFQ
294
EFISLVAIA
80
CTGAAGGCTGCCCATTACCACACCCACAAAGA~TAGCTCTCTGAAGGCTTTTTACC 81
354
LKAAHYHTHKE
91
355
CAGCAATGTCCTCAATGAGGGTCTTTTCTTTCCCTCACCAAAACCCAGCCTTGCCCGTGG
414
415
GGAGTAAGAGTT-
443
Fig. 1 Nucleotide and corresponding amino acid coding for a protein of 92 amino acids; start and acids missing the N-terminal methionine residue position 427 (underlined) and the polyA tail was sequence was submitted to the EMBL database
CACACTCACGA
sequence of the cDNA encoding Sl OOA12. The cDNA exhibits an open reading frame stop codons are boxed. The protein sequence was recently found to consist of 91 amino (accession number P80511 [7,8]). A polyadenylation signal is located in the cDNA at found at the end of the sequence containing 19 adenine residues (not shown). The cDNA and is accessible under accession number X97859.
the assumed exonic sequences. Most SIOO genes found so far show a similar exon/intron organization. They consist of three exons divided by two intronic sequences. The first intron is usually untranslated, exon 2 contains 5’ untranslated nucleotides, the ATG translation start codon and about 130 nucleotides coding for the N-terminal half of the protein, whereas exon 3 contains the coding region for the C-terminal half of the protein and a 3’ untranslated region. SIOOA5 is the only exception, showing four exons divided by three introns [ 131. To amplify intron I, primers were directed against the assumed sequence for exon I (untranslated nucleotide sequence at the 5’ end of the cDNA, forward) and exon 2 (nucleotide sequence coding for amino acids 3 to 9, reverse). To amplify intron 2, primers were directed against exon 2 (nucleotide sequence coding for ATG and amino acids 1 to 6, forward) and the assumed exon 3 (3’ end of the cDNA, around polyA signal, reverse). The two highly specific PCR products for the supposed introns 1 and 2 were analysed on an agarose gel, subcloned into pUC vectors and sequenced. In the analysis of the two amplified fragments, the entire nucleotide sequence of the cDNA was found at the ends of the genomic fragments followed by unknown 0 Pearson
461
Professional
Ltd 1996
(intronic) sequences. Therefore, we conclude that the structure of the SIOOA12 gene is the same as in other SlOO genes, consisting of three exons and two introns (Fig. 2). The gene has a length of about 1750 bp, including the two introns of 900 bp (intron 1) and 400 bp (intron 2), respectively. Exon 1 is untranslated, exon 2 codes for the N-terminal 45 amino acids and exon 3 codes for another 46 amino acids. Both intronic sequences are flanked by consensus splice donor (gt) and splice acceptor sequences (ag). Localization of SlOOAll and SlOOA12 on the SlOO gene cluster on human chromosome 1 q21, and extended updated nomenclature
As the amino acid and nucleotide sequences of S 1 OOAl.2 are the closest related to both the amino acid and nucleotide sequences of SlOOA8 and Sl OOA9, which are members of the SIOO gene cluster on human chromosome 1q2 1, we investigated whether the new gene was part of that cluster as well. Human S100A12 cDNA was, therefore, used as a probe in Southern blot hybridizations. The labeled probe was hybridized to filters containing YAC DNA carrying the major part of the SlOO gene Cell Calcium
(1996)
20(6),
459-464
462
R Wicki, I Marenholz,
D Mischke,
B W SchSfer, C W Heizmann
CACCATCAACgtaggtatgc
GCATTGAGGGgtaagtgcat Exon 1
Exon 3
Intron 2
Exon 2
. (400bp) WtccttagAATATCAAAG
(900bp). ttccttgaagGTTAACATTA lntron 1 Exon 2
k
200bp
Fig. 2 Schematic illustration of the human S700A72gene. The exon-intron structure of the Sl00A72gene is depicted. White boxes represent untranslated sequences whereas black boxes represent the coding sequence (parts of exon 2 and exon 3). Sequenced introns are shown as solid line, unsequenced regions are drawn as dotted line. The numbers on top of the boxes stand for the first and last nucleotide of the exons according to the cDNA sequence. The nucleotide sequences show the junctions between exons (capital letters) and introns (small letters), and the consensus splice donor and splice acceptor sites (underlined). The approximate lengths of the introns are 900 bp for intron 1 and 400 bp for intron 2. The sequences are accessible under accession numbers X98288, X98289 and X98290.
cluster (described in [2]). The result of this hybridization shows that S100A9and SlOOAl2 are co-localized on a 30 kb BssHII/SalI fragment, with the new gene showing an additional 15 kb Sal1fragment (Fig. 3A,B). The additional fragment was expected because of the internal Sal1 restriction site in exon 2. From these data, the SlUUA12 gene can be localized nearest to SlUUA9, between SlUUA8 and SlUUA9 (Fig. 3C). The gene SlUUAll has recently been reported to be localized on chromosome 1q21 [9]: thus it might also be part of the Sl00 gene cluster. Hybridizations to the filters containing YAC DNA with a S1OOAl 1 cDNA did not yield any signals. Therefore, we determined the precise location of the SlUUAll gene using genomic Southern blots (described in [ 121). Results show a common Not1 fragment for Sl UUAl 1 and THH, an epidermal differentiation
gene located 150 kb telomeric to SlUUAlU. In addition, Sl UUA 11 and Sl UUA 10 but not THH share the same SfiI fragment (data not shown). These results allowed us to locate SlUUAll near SlUUAlU in the order lcen-SlUUAlU-SlUUAll-THH-ltel (Fig. 3C). Since Sl UUAl 1 (SlOOC) was previously localized on chromosome lq2 1 by in situ hybridization, it is called SIUUAll, whereas the new gene is called SlUUA12. The order of numbering new Sl 00 genes found on the cluster considers the date of publication and not, as at present, its localization. This system should be kept for later localizations when new SlUU genes in the lq2 1 cluster are discovered. Table 1 lists the old and new names of the two genes with all the synonyms used in the literature and the new names and symbols given by the Genome Database (GDB).
Table 1
on the 1 q21 cluster
Extended
updated
nomenclature
for the two SlOO
genes
found
Old name
Old symbol
Synonyms*
New
SlOOC
SlOOC
Calgranulin
CAGC
Calgizzarh p6, MRPG, CAAFl, CGRP
S 100 calcium-binding S 100 calcium-binding
*The synonyms listed in the table are found ‘*The new names and symbols correspond
Cell Calcium
(1996)
20(6),
459-464
in the literature in different species. to the official entries in the Genome
name**
Database
New symbol** protein protein
A 11 A 12
SlOOAll S100A12
(GDB).
0 Pearson
Professional
Ltd 1996
Characterization
ten -//
I
’ nu
-II I
SlOOAlO
I SlOOAlI
I
I
of a human
cDNA coding
I I I
I
for SIOO protein
463
tel
I I
I
I
I
SlOOA9
SiOOAl2
SlOOA8
SlOOA7
,1
Fig. 3 Localization of SlOOA 77 and SlOOA 72 in the S700 gene cluster on chromosome 1 q21.5 ug of yeast DNA containing the YAC was digested using the indicated restriction enzymes. Restriction fragments were separated by pulsed-field gel electrophoresis and blotted to nylon membranes. Blots were subsequently hybridized for S7OOA9 (A, left, genomic probe [2]), and SlOOA72 (B, right, cDNA probe), and exposed to X-ray film for 1 day. Hybridizations were carried out using [32P]-dATP labeled probes. Molecular weight markers are indicated in kb. (C) Physical map of the SlOO gene cluster. Open boxes represent fragments containing the respective genes, whereas the filled box represents the precise location of the gene. SlOOA72 is located between S7OOA8 and S7OOA9; SlOOA77 is located near S7OOA70, about 1500 kb more centromeric compared to SlOOA9. The 1500 kb gap between S7OOA9 and SlOOA77 is shown as //. Several structural genes belonging to the epidermal differentiation complex are located between S7OOA9 and SlOOA77 [12]. The fragments containing the genes SlOOA 77 and SlOOA 70 are drawn in a 1 O-fold compressed scale.
In this report, we describe for the first time the nucleotide sequence of the human cDNA coding for the calcium binding protein S1 OOAl2. S1OOA12 is a 9 1 amino acid protein found in resting human neutrophiles and monocytes [4,8], and homologues of the human protein were found in pig granulocytes [5] and in bovine amniotic fluid [6]. The human cDNA shows a 76% overall identity to the nucleotide sequence of the bovine cDNA, whereas the sequences of the bovine and human proteins show an identity of only 70%. The bovine sequence contains a gap of 13 bp, 5 bp downstream of the translation stop signal TAG compared to the human cDNA (data not shown). The most striking difference between the amino acid sequences of these two species is seen in the C-terminal ends of the proteins: 10 out of the C-terminal 20 amino acids are changed in contrast to only 2 changes out of the N-terminal 20 amino acids of the two species. We, therefore, wondered whether this could be due to an alternative splicing event resulting in two different isoforms of the same protein. If this was the case one should 0 Pearson Professional LM 7996
be able to find a gene that is composed of at least four exons instead of the usually three. Exon 3 and the putative exon 4 would then be alternatively spliced, resulting in an isoform showing a C-terminal amino acid sequence similar to the one found in pig S 1OOA12 and an isoform showing the C-terminal amino acid sequence found in human. To determine the exonlintron structure of the human SIOOA12 gene, we performed PCR using primers directed against exonic sequences, resulting in one specific fragment for each pair of primers. After subcloning and sequencing of the amplified genomic fragments, we could demonstrate that the gene related to the cDNA exhibited the common three exon structure found in most SlOO genes. The introns are approximately 900 bp and 400 bp in length, resulting in a total length of 1750 bp for the SlOOAlZ gene. This length is comparable with other SlOO genes like SI OOAS (104 1 bp) and SlOOA9 (2824 bp), the closest neighbors in respect to the amino acid sequence homology. We localized the SlOOAl2 gene to chromosome lq2 1; thus it is part of the tight cluster of SlOO genes found in this region. The SlOOAl2 gene is located between Cell Calcium (1996)
20(6),
459-464
464
f? Wicki, I Marenholz,
D Mischke,
B W Schafer,
C W Heizmann
Sl WA8 and Sl OOA9. It has been suggested that the 5’100 genes may have arisen from a common ancestor by a process of local gene duplication and divergence. From homology studies of all SlOO proteins being encoded by genes in the cluster we postulate that the subgroup containing the genes Sl OOA8, Sl OOA9 and Sl OOA12 was early separated from a subgroup containing the genes Sl OOA2 to Sl OOA6 and another subgroup consisting of the two genes SlOOAlU and SlOOAll. The three subgroups could h ave had each their own ancestor gene, which was duplicated after separation. Genes like SI OOA7 or Sl OOA 1 have lesser homology to other Sl 00 genes and may, therefore, be ‘older’ candidates. Alternatively, genes more closely related to Sl OOA7 and Sl OOAI might exist and remain to be discovered. To date, the function of S100A12 (and the related S1OOA8and S1OOA9)has not been clarified. The protein is proposed to be involved in specific calcium-dependent signal transduction pathways and a regulatory effect on cytoskeletal components may modulate various neutrophil activities, such as migration, chemotaxis, degranulation or phagocytosis [7]. Hitomi et al. reported that S1OOA12 could be one of the stage-specific proteins in the differentiation of squamous epithelial cells, and that it is preferentially produced by fetal squamous epithelial cells, including epidermal keratinocytes and amniotic epithelial cells, and that it is stored in the amniotic fluid during embryogenesis (bovine). As the protein has been found in neutrophils and monocytes, but not in lymphocytes, the expression of Sl OUAl2 (together with Sl OOA8 and Sl OOA9) seems to be restricted to cells of the myeloid lineage. S100A12 and the two proteins SlOOAS and SlOOA9 might share structural as well as biological characteristics because of their overlapping distribution in granulocytes, macrophages and squamous epithelial cells. This would give rise to the supposition that the three genes are not only structurally and functionally related but also in terms of transcriptional control, probably using a common regulatory region in the cluster. ACKNOWLEDGEMENTS
This work was supported by Biomed-2 (BBW Nr. 95.02 151, Switzerland) grant BMH4-CT96-0319 from the European Union and the Swiss National Science Foundation (3 l-4023794). We would like to thank Prof. M. Tanaka for providing the S1OOA11 cDNA probe. The S 1OOA12 cDNA was kindly supplied as EST (IMAGE clone 123640) by the UK HGMP Resource Centre, Cambridge, UK.
Cell Calcium
(1996)
20(6),
459-464
REFERENCES 1 Schafer B.W., Heizmann C.W. The SlOO family of EF-hand calcium-binding proteins: functions and pathology. Trends Biochem. Sci 1996; 21: 134-140. 2 Schafer B.W., Wicki R., Engelkamp D., Mattei M.G., Heizmann C.W. Isolation of a YAC clone covering a cluster of nine SlOO genes on human chromosome 1q2 1: rationale for a new nomenclature of the SlOO calcium-binding protein family. Genomics 1995; 25: 638-643. 3 Moseley W.S., Seldin M.F. Definition of mouse chromosome 1 and 3 gene linkage groups that are conserved on human chromosome 1: evidence that a conserved linkage group spans the centromere of human chromosome 1. Genomics 1989; 5: 899-905. 4. Guignard F., Mauel J., Markert M. Identification and characterization of a novel human neutrophil protein related to the SlOO family. Biochem J 1995; 309: 395-401. 5. Dell’Angelica EC., Schleicher C.H., Santome J.A. Primary structure and binding properties of calgranulin C, a novel SlOOlike calcium-binding protein from pig granulocytes. J Biol Chem 1994; 269: 28929-28936. 6. Hitomi J., Yamaguchi K., Kikuchi Y., Kimura T., Mamyama K., Nagasaki K. A novel calcium-binding protein in amniotic fluid, CAAFl : its molecular cloning and tissue distribution. J Cell Sd 1996; 109: 805-815. 7. Marti T., Erttmann K.D., Gallin M.Y. Host-parasite interaction in human onchocerciasis: identification and sequence analysis of a novel human calgranulin. Biochem Biophys Res Commun 1996; 221: 454-458. 8. Ilg EC., Troller H., Biirgisser D.M. et al. Amino acid sequence determination of human SlOOA12 (P6, calgranulin C, CGRP, CAAFl) by tandem mass spectrometry. Biochem Biophys Res Commun 1996; In press. 9. Moog-Lutz C., Bouillet P., Regnier C.H. et al. Comparative expression of the psoriasin (S1OOA7) and S1OOC genes in breast carcinoma and co-localization to human chromosome lq21-q22. IntJCancer 1995; 63: 297-303. 10 Sambrook J., Fritsche E.F.,Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989. 11 Tanaka M., Adzuma K., Iwami M., Yoshimoto K., Monden Y., Itakura M. Human calgizzarin: one colorectal cancer-related gene selected by a large scale random cDNA sequencing and northern blot analysis. Cancer Lett 1995; 89: 195-200. 12 Mischke D., Korge B.P., Marenholz I., Volz A., Ziegler A. Genes encoding structural proteins of epidermal cornification and SlOO calcium-binding proteins form a gene complex (‘epidermal differentiation complex’) on human chromosome lq21. J Invest Dermatol1996; 106: 989-992. 13 Engelkamp D., Schafer B.W., Mattei M.G., Erne P., Heizmann C.W. Six SlOO genes are clustered on human chromosome 1q2 1: identification of two genes coding for two previously unreported calcium-binding proteins SlOOD and SlOOE. PYOC Nat1 Acad Sci USA 1993; 90: 6547-6551.
0 Pearson
Professional
Ltd 7996
Research
Characterization of the human S100A12 (calgranulin C, p6, CAAFl, CGRP) gene, a new member of the SIOO gene cluster on chromosome 1 q21 Roland Wick?, lngo Marenholz2, Dietmar Mischke2, Beat W. Schafer’, Claus W. Heizmannl ‘Kinderspital,
Abteilung
fur Klinische
%stitut fur Experimentelle Berlin, Germany
Onkologie
Chemie,
Universitat
Zurich,
und Transplantationsmedizin,
Zurich,
Switzerland
Virchow-Klinikum
der Humboldt-Universitat
zu Berlin,
Summary Here, we report the characterization of a human cDNA coding for the recently published amino acid sequence of a calcium-binding Sl 00 protein, Sl OOA12 (CGRP, calgranulin C, CAAFl , ~6). The exon/intron structure of the S700A72gene is similar to most other SlOOgenes. It is composed of three exons which are divided by two introns of 900 bp and 400 bp. The protein is encoded by sequences in exons 2 and 3, with exon 2 coding for the N-terminal 45 amino acids and exon 3 coding for the C-terminal 46 amino acids. So far, ten SlOO genes are known to be located on human chromosome lq21 in a clustered organization. Hence, we investigated whether SlOOA7 7 (SlOOC, cdgizzarin) and SIOOA72 are also localized in the Sl 00 gene cluster. We found both genes within the cluster, with SlOOA7 7 being close to SlOOA70 and SIOOA72 between the genes S7OOA8 and SIOOA9. Therefore, the SlOO gene cluster now is composed of 12 differentially expressed family members.
INTRODUCTION Proteins of the SIOO family belong to the large group of EF-hand calcium-binding proteins. Roles in distinct cellular functions such as signal transduction, cell cycle progression or cell differentiation have been proposed for them [ 11. Most S100 proteins are localized in the cytosol, with the exception of Sl OOA2 (in the nucleus) and at
Received 4 July 1996 Revised 28 August 1996 Accepted 28 August 1996 Correspondence to: Dr Beat W. Schafer, Krnderspital, Abteilung fur Klinische Chemie, Universitat Zurich, Steinwiesstrasse 75, CH-8032 Zurich, Switzerland Tel. +41 1 266 75 53: Fax. +41 1 266 71 69 E-mail [email protected]
least three family members which are found extracellularly, probably acting as cytokines (Sl OOp, Sl OOA8, SlOOA9). Since Sl 00 genes are expressed in specific subsets of cells only, they are excellent candidates to function as cell-type specific transducers in calcium signalling pathways. At least ten SlOO genes are organized in a cluster on human chromosome 1q2 1 which led to the introduction of a new nomenclature [2]. A similar cluster might exist on mouse chromosome 3 [3]. So far, three SlOO genes are known to be located on different chromosomes. Sl OOA12 was first described in granulocytes as a cytosolic human protein, p6, which crossreacted with antibodies raised against SlOOAS [4]. The partial 20 amino acid sequence of the N-terminus of p6 was determined and showed similarities with the human protein SlOOA9. Homologous proteins were also found in other species, such as pig and bovine. The pig homologue to 459
460
R Wicki, I Marenholz,
D Mischke,
B W Schtifer,
C W Heizmann
the human SlOOA12 protein was isolated from granulocytes. Its amino acid sequence displayed strong homology to the human proteins SlOOA8 and SlOOA9 (calgranulin A and calgranulin B) and was, therefore, termed calgranulin C 151.Hitomi et al. recently published the amino acid and the cDNA sequence of a bovine homologue to SlOOA12, which was detected in bovine amniotic fluid by using a 45Ca2+overlay technique [6]. The protein was called CAAFl for calcium-binding protein in amniotic fluid. More recently, the complete human amino acid sequence for S1OOA12 was published [7]. It was found in neutrophils as part of the immune response towards a parasite infection and was named CGRP for calgranulin related protein. The identical amino acid sequence was determined for a protein isolated from human neutrophils 181. Here, we report for the first time the nucleotide sequence of a human Sl OOA12 cDNA, the genomic sequence and the exonlintron structure of the gene. Furthermore, we determined the localization of the SI O&I12 gene on the S100 gene cluster on human chromosome lq2 1. The gene SlOUAl I (5’1 OOC, cdgizzarin) was recently localized to chromosome lq21 [9]. Hence, we determined also the precise location of the SI OOAI I gene on the cluster. The new names and symbols for the two genes reported here were chosen considering the date of publication and not the order of the genes in the cluster. These symbols are used throughout this report. MATERIALS Computer
AND
METHODS
analysis
Sequence comparisons were carried out using the GCG software package (version 8.0) of the University of Wisconsin Genetics Computer Group. Southern
blot hybridizations
For hybridizations, blotted YAC DNA carrying the major part of the S100 gene cluster were used (described in 121). Filters were hybridized with [32P]-dATPlabelled (Prime-agene, Promega [lo]) SlOOA12 cDNA (clone 123640, obtained from the UK HGMP Resource Centre, Cambridge, UK) and washed with 1 x SSC at 65°C for 30 min. and 0.5 x SSC at 65°C for 60 min. Pulsed-field electrophoresis and hybridizations with SlOOAl 1 cDNA [ 1 l] were performed as described [ 121.
p6Ex2R, 5’-TCCCTCCAGATGCTCTTCAAG-3’, resulting in amplification of intron 1, and the primers p6ExZF, 5’ATGACAAAACTTGAAGAGCAT-3’ and p6Ex3R, 5’-GTTTATTAACTCTTACTCCCC-3’, resulting in amplification of intron 2 of the gene. 1 ug of genomic DNA isolated from the human epithelial cell line HBL-100 was used in each reaction under the following cycling conditions: 60 s, 95°C; 60 s, 62°C (for intron 1) or 54°C (for intron 2); 120 s, 72°C for 30 cycles. The appropriate amplified fragments were filled in with Klenow enzyme (Promega) and subcloned into the pUC18 vector (Clontech). Sequencing was done on an ALF DNA Sequencer using the AutoRead Sequencing kit (Pharmacia). RESULTS Nucleotide
sequence
of the Sl OOA12 cDNA
In a routine EMBL database search for new SlOO sequences, an EST with similarity to pig calgranulin C and N-terminal human p6 was found (accession numbers R02721 and R02722). The sequences were translated in all six frames using the GCG software package and compared to the published N-terminal 20 amino acid sequence of the human SlOOA12 protein (p6, [4]; for the nomenclature see below). One frame of the translated EST matched to the partial amino acid sequence of the human SlOOAl2 with 100% identity. The following amino acid sequence read in other frames showed an identity of up to 62% compared to the amino acid sequence of the pig SlOOA12 protein (calgranulin C, 151). The clone bearing the EST was available from the HGMP Resource Centre, Cambridge (IMAGE clone 123640). To verify the single sequence analysis deposited in the EST database, the nucleotide sequence of the insert was determined using an ALF automated DNA sequencer and was translated again. We found an open reading frame (ORF) coding for a protein of 92 amino acids, which showed a 70% identity compared to the pig S100A12 sequence (Fig. 1). As the amino acid sequence of the ORF is identical to the published sequence of human S100A12 protein [7,8], this proves that the nucleotide sequence presented in this paper is the cDNA coding for SlOOAl2. In addition, the cDNA contained a 5’ untranslated sequence consisting of 51 nucleotides, which is comparable in length to other SlOO cDNAs, and a larger 3’ untranslated region (113 nucleotides) containing a polyadenylation signal and a polyA tail consisting of 19 adenine residues at the 3’ end of the clone.
PCR
PCR reactions were performed on Perkin-Elmer Cetus and Hybaid Omni-Gene thermal cyclers with the primers p6ExlF, 5’-GCTGTAGCTCCACATTCCT-3’ and Cell Calcium
(1996)
20(6),
459-464
Exonlintron
structure
of the SlOOA12
gene
To determine the exomintron structure of the SIOOAIZ gene, PCR was performed using primers directed against 0 Pearson
Professional
Ltd I996
Characterization
1
of a human
cDNA coding
for SIOO protein
GCTGTAGCTCCACATTccTGTGCATTGAGGGGTTAACATTAGGcTGGG~~ 54 ACAAAACTTGAAGAGCATCTGGAGGGAATTGTCAATATCTTCCACCAATACTCAGTTCGG
55 1 115
T
K
L
E
E
H
LEGIVNIFHQ
114
Y
s
v
R
20
AAGGGGCATTTTGACACCCTCTCTAAGGGTGAGCTGAAGCAGCTGCTTACAAAGGAGCTT 21
175
174
KGHFDTLSKGELKQLLTKEL
40
GCAAACACCATCAAGAATATCAAAGATAAAGCTGTCATTGATGAAATATTCCAAGGCCTG 41
A
N
T
I
K
N
I
K
D
234
KAVIDEIFQGL
60
GATGCTAATCAAGATGAACAGGTCGACTTTCAAGAATTCATATCCCTGGTAGCCATTGCG
235 61
295
DANQDEQVDFQ
294
EFISLVAIA
80
CTGAAGGCTGCCCATTACCACACCCACAAAGA~TAGCTCTCTGAAGGCTTTTTACC 81
354
LKAAHYHTHKE
91
355
CAGCAATGTCCTCAATGAGGGTCTTTTCTTTCCCTCACCAAAACCCAGCCTTGCCCGTGG
414
415
GGAGTAAGAGTT-
443
Fig. 1 Nucleotide and corresponding amino acid coding for a protein of 92 amino acids; start and acids missing the N-terminal methionine residue position 427 (underlined) and the polyA tail was sequence was submitted to the EMBL database
CACACTCACGA
sequence of the cDNA encoding Sl OOA12. The cDNA exhibits an open reading frame stop codons are boxed. The protein sequence was recently found to consist of 91 amino (accession number P80511 [7,8]). A polyadenylation signal is located in the cDNA at found at the end of the sequence containing 19 adenine residues (not shown). The cDNA and is accessible under accession number X97859.
the assumed exonic sequences. Most SIOO genes found so far show a similar exon/intron organization. They consist of three exons divided by two intronic sequences. The first intron is usually untranslated, exon 2 contains 5’ untranslated nucleotides, the ATG translation start codon and about 130 nucleotides coding for the N-terminal half of the protein, whereas exon 3 contains the coding region for the C-terminal half of the protein and a 3’ untranslated region. SIOOA5 is the only exception, showing four exons divided by three introns [ 131. To amplify intron I, primers were directed against the assumed sequence for exon I (untranslated nucleotide sequence at the 5’ end of the cDNA, forward) and exon 2 (nucleotide sequence coding for amino acids 3 to 9, reverse). To amplify intron 2, primers were directed against exon 2 (nucleotide sequence coding for ATG and amino acids 1 to 6, forward) and the assumed exon 3 (3’ end of the cDNA, around polyA signal, reverse). The two highly specific PCR products for the supposed introns 1 and 2 were analysed on an agarose gel, subcloned into pUC vectors and sequenced. In the analysis of the two amplified fragments, the entire nucleotide sequence of the cDNA was found at the ends of the genomic fragments followed by unknown 0 Pearson
461
Professional
Ltd 1996
(intronic) sequences. Therefore, we conclude that the structure of the SIOOA12 gene is the same as in other SlOO genes, consisting of three exons and two introns (Fig. 2). The gene has a length of about 1750 bp, including the two introns of 900 bp (intron 1) and 400 bp (intron 2), respectively. Exon 1 is untranslated, exon 2 codes for the N-terminal 45 amino acids and exon 3 codes for another 46 amino acids. Both intronic sequences are flanked by consensus splice donor (gt) and splice acceptor sequences (ag). Localization of SlOOAll and SlOOA12 on the SlOO gene cluster on human chromosome 1 q21, and extended updated nomenclature
As the amino acid and nucleotide sequences of S 1 OOAl.2 are the closest related to both the amino acid and nucleotide sequences of SlOOA8 and Sl OOA9, which are members of the SIOO gene cluster on human chromosome 1q2 1, we investigated whether the new gene was part of that cluster as well. Human S100A12 cDNA was, therefore, used as a probe in Southern blot hybridizations. The labeled probe was hybridized to filters containing YAC DNA carrying the major part of the SlOO gene Cell Calcium
(1996)
20(6),
459-464
462
R Wicki, I Marenholz,
D Mischke,
B W SchSfer, C W Heizmann
CACCATCAACgtaggtatgc
GCATTGAGGGgtaagtgcat Exon 1
Exon 3
Intron 2
Exon 2
. (400bp) WtccttagAATATCAAAG
(900bp). ttccttgaagGTTAACATTA lntron 1 Exon 2
k
200bp
Fig. 2 Schematic illustration of the human S700A72gene. The exon-intron structure of the Sl00A72gene is depicted. White boxes represent untranslated sequences whereas black boxes represent the coding sequence (parts of exon 2 and exon 3). Sequenced introns are shown as solid line, unsequenced regions are drawn as dotted line. The numbers on top of the boxes stand for the first and last nucleotide of the exons according to the cDNA sequence. The nucleotide sequences show the junctions between exons (capital letters) and introns (small letters), and the consensus splice donor and splice acceptor sites (underlined). The approximate lengths of the introns are 900 bp for intron 1 and 400 bp for intron 2. The sequences are accessible under accession numbers X98288, X98289 and X98290.
cluster (described in [2]). The result of this hybridization shows that S100A9and SlOOAl2 are co-localized on a 30 kb BssHII/SalI fragment, with the new gene showing an additional 15 kb Sal1fragment (Fig. 3A,B). The additional fragment was expected because of the internal Sal1 restriction site in exon 2. From these data, the SlUUA12 gene can be localized nearest to SlUUA9, between SlUUA8 and SlUUA9 (Fig. 3C). The gene SlUUAll has recently been reported to be localized on chromosome 1q21 [9]: thus it might also be part of the Sl00 gene cluster. Hybridizations to the filters containing YAC DNA with a S1OOAl 1 cDNA did not yield any signals. Therefore, we determined the precise location of the SlUUAll gene using genomic Southern blots (described in [ 121). Results show a common Not1 fragment for Sl UUAl 1 and THH, an epidermal differentiation
gene located 150 kb telomeric to SlUUAlU. In addition, Sl UUA 11 and Sl UUA 10 but not THH share the same SfiI fragment (data not shown). These results allowed us to locate SlUUAll near SlUUAlU in the order lcen-SlUUAlU-SlUUAll-THH-ltel (Fig. 3C). Since Sl UUAl 1 (SlOOC) was previously localized on chromosome lq2 1 by in situ hybridization, it is called SIUUAll, whereas the new gene is called SlUUA12. The order of numbering new Sl 00 genes found on the cluster considers the date of publication and not, as at present, its localization. This system should be kept for later localizations when new SlUU genes in the lq2 1 cluster are discovered. Table 1 lists the old and new names of the two genes with all the synonyms used in the literature and the new names and symbols given by the Genome Database (GDB).
Table 1
on the 1 q21 cluster
Extended
updated
nomenclature
for the two SlOO
genes
found
Old name
Old symbol
Synonyms*
New
SlOOC
SlOOC
Calgranulin
CAGC
Calgizzarh p6, MRPG, CAAFl, CGRP
S 100 calcium-binding S 100 calcium-binding
*The synonyms listed in the table are found ‘*The new names and symbols correspond
Cell Calcium
(1996)
20(6),
459-464
in the literature in different species. to the official entries in the Genome
name**
Database
New symbol** protein protein
A 11 A 12
SlOOAll S100A12
(GDB).
0 Pearson
Professional
Ltd 1996
Characterization
ten -//
I
’ nu
-II I
SlOOAlO
I SlOOAlI
I
I
of a human
cDNA coding
I I I
I
for SIOO protein
463
tel
I I
I
I
I
SlOOA9
SiOOAl2
SlOOA8
SlOOA7
,1
Fig. 3 Localization of SlOOA 77 and SlOOA 72 in the S700 gene cluster on chromosome 1 q21.5 ug of yeast DNA containing the YAC was digested using the indicated restriction enzymes. Restriction fragments were separated by pulsed-field gel electrophoresis and blotted to nylon membranes. Blots were subsequently hybridized for S7OOA9 (A, left, genomic probe [2]), and SlOOA72 (B, right, cDNA probe), and exposed to X-ray film for 1 day. Hybridizations were carried out using [32P]-dATP labeled probes. Molecular weight markers are indicated in kb. (C) Physical map of the SlOO gene cluster. Open boxes represent fragments containing the respective genes, whereas the filled box represents the precise location of the gene. SlOOA72 is located between S7OOA8 and S7OOA9; SlOOA77 is located near S7OOA70, about 1500 kb more centromeric compared to SlOOA9. The 1500 kb gap between S7OOA9 and SlOOA77 is shown as //. Several structural genes belonging to the epidermal differentiation complex are located between S7OOA9 and SlOOA77 [12]. The fragments containing the genes SlOOA 77 and SlOOA 70 are drawn in a 1 O-fold compressed scale.
In this report, we describe for the first time the nucleotide sequence of the human cDNA coding for the calcium binding protein S1 OOAl2. S1OOA12 is a 9 1 amino acid protein found in resting human neutrophiles and monocytes [4,8], and homologues of the human protein were found in pig granulocytes [5] and in bovine amniotic fluid [6]. The human cDNA shows a 76% overall identity to the nucleotide sequence of the bovine cDNA, whereas the sequences of the bovine and human proteins show an identity of only 70%. The bovine sequence contains a gap of 13 bp, 5 bp downstream of the translation stop signal TAG compared to the human cDNA (data not shown). The most striking difference between the amino acid sequences of these two species is seen in the C-terminal ends of the proteins: 10 out of the C-terminal 20 amino acids are changed in contrast to only 2 changes out of the N-terminal 20 amino acids of the two species. We, therefore, wondered whether this could be due to an alternative splicing event resulting in two different isoforms of the same protein. If this was the case one should 0 Pearson Professional LM 7996
be able to find a gene that is composed of at least four exons instead of the usually three. Exon 3 and the putative exon 4 would then be alternatively spliced, resulting in an isoform showing a C-terminal amino acid sequence similar to the one found in pig S 1OOA12 and an isoform showing the C-terminal amino acid sequence found in human. To determine the exonlintron structure of the human SIOOA12 gene, we performed PCR using primers directed against exonic sequences, resulting in one specific fragment for each pair of primers. After subcloning and sequencing of the amplified genomic fragments, we could demonstrate that the gene related to the cDNA exhibited the common three exon structure found in most SlOO genes. The introns are approximately 900 bp and 400 bp in length, resulting in a total length of 1750 bp for the SlOOAlZ gene. This length is comparable with other SlOO genes like SI OOAS (104 1 bp) and SlOOA9 (2824 bp), the closest neighbors in respect to the amino acid sequence homology. We localized the SlOOAl2 gene to chromosome lq2 1; thus it is part of the tight cluster of SlOO genes found in this region. The SlOOAl2 gene is located between Cell Calcium (1996)
20(6),
459-464
464
f? Wicki, I Marenholz,
D Mischke,
B W Schafer,
C W Heizmann
Sl WA8 and Sl OOA9. It has been suggested that the 5’100 genes may have arisen from a common ancestor by a process of local gene duplication and divergence. From homology studies of all SlOO proteins being encoded by genes in the cluster we postulate that the subgroup containing the genes Sl OOA8, Sl OOA9 and Sl OOA12 was early separated from a subgroup containing the genes Sl OOA2 to Sl OOA6 and another subgroup consisting of the two genes SlOOAlU and SlOOAll. The three subgroups could h ave had each their own ancestor gene, which was duplicated after separation. Genes like SI OOA7 or Sl OOA 1 have lesser homology to other Sl 00 genes and may, therefore, be ‘older’ candidates. Alternatively, genes more closely related to Sl OOA7 and Sl OOAI might exist and remain to be discovered. To date, the function of S100A12 (and the related S1OOA8and S1OOA9)has not been clarified. The protein is proposed to be involved in specific calcium-dependent signal transduction pathways and a regulatory effect on cytoskeletal components may modulate various neutrophil activities, such as migration, chemotaxis, degranulation or phagocytosis [7]. Hitomi et al. reported that S1OOA12 could be one of the stage-specific proteins in the differentiation of squamous epithelial cells, and that it is preferentially produced by fetal squamous epithelial cells, including epidermal keratinocytes and amniotic epithelial cells, and that it is stored in the amniotic fluid during embryogenesis (bovine). As the protein has been found in neutrophils and monocytes, but not in lymphocytes, the expression of Sl OUAl2 (together with Sl OOA8 and Sl OOA9) seems to be restricted to cells of the myeloid lineage. S100A12 and the two proteins SlOOAS and SlOOA9 might share structural as well as biological characteristics because of their overlapping distribution in granulocytes, macrophages and squamous epithelial cells. This would give rise to the supposition that the three genes are not only structurally and functionally related but also in terms of transcriptional control, probably using a common regulatory region in the cluster. ACKNOWLEDGEMENTS
This work was supported by Biomed-2 (BBW Nr. 95.02 151, Switzerland) grant BMH4-CT96-0319 from the European Union and the Swiss National Science Foundation (3 l-4023794). We would like to thank Prof. M. Tanaka for providing the S1OOA11 cDNA probe. The S 1OOA12 cDNA was kindly supplied as EST (IMAGE clone 123640) by the UK HGMP Resource Centre, Cambridge, UK.
Cell Calcium
(1996)
20(6),
459-464
REFERENCES 1 Schafer B.W., Heizmann C.W. The SlOO family of EF-hand calcium-binding proteins: functions and pathology. Trends Biochem. Sci 1996; 21: 134-140. 2 Schafer B.W., Wicki R., Engelkamp D., Mattei M.G., Heizmann C.W. Isolation of a YAC clone covering a cluster of nine SlOO genes on human chromosome 1q2 1: rationale for a new nomenclature of the SlOO calcium-binding protein family. Genomics 1995; 25: 638-643. 3 Moseley W.S., Seldin M.F. Definition of mouse chromosome 1 and 3 gene linkage groups that are conserved on human chromosome 1: evidence that a conserved linkage group spans the centromere of human chromosome 1. Genomics 1989; 5: 899-905. 4. Guignard F., Mauel J., Markert M. Identification and characterization of a novel human neutrophil protein related to the SlOO family. Biochem J 1995; 309: 395-401. 5. Dell’Angelica EC., Schleicher C.H., Santome J.A. Primary structure and binding properties of calgranulin C, a novel SlOOlike calcium-binding protein from pig granulocytes. J Biol Chem 1994; 269: 28929-28936. 6. Hitomi J., Yamaguchi K., Kikuchi Y., Kimura T., Mamyama K., Nagasaki K. A novel calcium-binding protein in amniotic fluid, CAAFl : its molecular cloning and tissue distribution. J Cell Sd 1996; 109: 805-815. 7. Marti T., Erttmann K.D., Gallin M.Y. Host-parasite interaction in human onchocerciasis: identification and sequence analysis of a novel human calgranulin. Biochem Biophys Res Commun 1996; 221: 454-458. 8. Ilg EC., Troller H., Biirgisser D.M. et al. Amino acid sequence determination of human SlOOA12 (P6, calgranulin C, CGRP, CAAFl) by tandem mass spectrometry. Biochem Biophys Res Commun 1996; In press. 9. Moog-Lutz C., Bouillet P., Regnier C.H. et al. Comparative expression of the psoriasin (S1OOA7) and S1OOC genes in breast carcinoma and co-localization to human chromosome lq21-q22. IntJCancer 1995; 63: 297-303. 10 Sambrook J., Fritsche E.F.,Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989. 11 Tanaka M., Adzuma K., Iwami M., Yoshimoto K., Monden Y., Itakura M. Human calgizzarin: one colorectal cancer-related gene selected by a large scale random cDNA sequencing and northern blot analysis. Cancer Lett 1995; 89: 195-200. 12 Mischke D., Korge B.P., Marenholz I., Volz A., Ziegler A. Genes encoding structural proteins of epidermal cornification and SlOO calcium-binding proteins form a gene complex (‘epidermal differentiation complex’) on human chromosome lq21. J Invest Dermatol1996; 106: 989-992. 13 Engelkamp D., Schafer B.W., Mattei M.G., Erne P., Heizmann C.W. Six SlOO genes are clustered on human chromosome 1q2 1: identification of two genes coding for two previously unreported calcium-binding proteins SlOOD and SlOOE. PYOC Nat1 Acad Sci USA 1993; 90: 6547-6551.
0 Pearson
Professional
Ltd 7996