- Email: [email protected]
Characterization of the imprinting and expression patterns of ZAG2 in maize endosperm and embryo
T H E CR O P J O U RN A L 3 ( 2 01 5 ) 7 4 – 7 9
Available online at www.sciencedirect.com
ScienceDirect
Characterization of the imprinting and expression patterns of ZAG2 in maize endosperm and embryo Chaoxian Liu1 , Jiuguang Wang1 , Xiupeng Mei, Xiaojing Deng, Tingting Yu, Xiaoli Liu, Guoqiang Wang, Zhizhai Liu, Yilin Cai⁎ Maize Research Institute, Southwest University, Chongqing 400715, China
AR TIC LE I N FO
ABS TR ACT
Article history:
ZAG2 has been identified as a maternally expressed imprinted gene in maize endosperm.
Received 28 January 2014
Our study revealed that paternally inherited ZAG2 alleles were imprinted in maize
Received in revised form
endosperm and embryo at 14 days after pollination (DAP), and consistently imprinted in
10 October 2014
endosperm at 10, 12, 16, 18, 20, 22, 24, 26, and 28 DAP in reciprocal crosses between B73 and
Accepted 3 December 2014
Mo17. ZAG2 alleles were also imprinted in reciprocal crosses between Zheng 58 and Chang
Available online 16 December 2014
7-2 and between Huang C and 178. ZAG2 alleles exhibited differential imprinting in hybrids of 178 × Huang C and B73 × Mo17, while in other hybrids ZAG2 alleles exhibited binary imprinting. The tissue-specific expression pattern of ZAG2 showed that ZAG2 was
Keywords:
expressed at a high level in immature ears, suggesting that ZAG2 plays important roles in
Gene imprinting
not only kernel but ear development.
ZAG2
© 2015 Crop Science Society of China and Institute of Crop Science, CAAS. Production and hosting
Expression pattern
by Elsevier B.V. All rights reserved. This is an open access article under the CC BY-NC-ND license
Endosperm
(http://creativecommons.org/licenses/by-nc-nd/3.0/).
Embryo
1. Introduction Genomic imprinting, the differential expression of alleles depending on parental origin, is an epigenetic phenomenon occurring in mammals as well as in angiosperms [1]. In mammals, imprinting usually occurs in embryonic and extra-embryonic tissues [2]. In flowering plants, the majority of imprinted genes are expressed in triploid endosperm [3–5]. R1, which regulates anthocyanin biosynthesis in maize endosperm, was the first-discovered gene showing genomic imprinting. When R1 was inherited maternally, the full kernel was pigmented, whereas when R1 was inherited paternally, the kernel exhibited mottled pigmentation [6]. Later, genomic imprinting was also discovered in mouse. A nuclear
transplantation experiment showed that completion of mouse embryogenesis required both the maternal and paternal genomes, and that two copies of either the paternal or the maternal genome were not sufficient for normal development of mouse embryos [7,8]. Although imprinting was first discovered in plants, studies have been widely conducted in mammals. It is well established that imprinted genes regulate placenta development and fetal growth in mammals and that a change of methylation status of imprinted genes may cause human disease [9]. Imprinted loci are classified as paternally or maternally imprinted, depending upon which parental allele is expressed. In maize, paternally imprinted genes include Meg1 [10], nrp1 [11],
⁎ Corresponding author. E-mail address: [email protected] (Y. Cai). Peer review under responsibility of Crop Science Society of China and Institute of Crop Science, CAAS. 1 Chaoxian Liu and Jiuguang Wang contributed equally to this work.
http://dx.doi.org/10.1016/j.cj.2014.10.001 2214-5141/© 2015 Crop Science Society of China and Institute of Crop Science, CAAS. Production and hosting by Elsevier B.V. All rights reserved. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
T H E CR O P J O U RN A L 3 ( 2 0 15 ) 7 4 – 7 9
dzr1 [12], Mez1 [13,14], fie1, and fie2 [15], etc. By contrast, maternally imprinted genes are fewer [16]. With the development of modern sequencing technology, 111 maternally imprinted and 68 paternally imprinted genes were newly identified in 10 DAP endosperm from reciprocal crosses between inbred lines B73 and Mo17, according to whether the expression of a given allele was fivefold greater than that of the other allele [17]. A similar study was performed by Waters et al. [18], but employing different criteria: a gene designated as imprinted required 90% of reads to be from one allele. As a result, 100 putative imprinted genes were identified in endosperm 14 days after pollination (DAP) from reciprocal crosses between B73 and Mo17, including 54 maternally and 46 paternally expressed imprinted genes. Though only 50 genes were common to the 100 and 179 genes designated as imprinted by these two research groups, these studies still greatly expanded the number of imprinted genes in maize. ZAG2 is one of the 50 imprinted genes identified in common. ZAG2, as well as the imprinted gene OsMADS87 in rice [19] and PHE1 in Arabidopsis [20], is also a MADS-box transcription factor. Here we report the imprinting characterization of ZAG2 in three reciprocal crosses and evaluate the tissue-specific expression pattern of ZAG2, with the aim of elucidating the function of ZAG2 in maize development.
75
index. cgi?LINK_LOC = BlastHome) and used to amplify the target sequence of ZAG2 cDNA for CAPS marker development. The main parameters were as follows: primer size of about 22 bp, primer GC content of 40–60%, and no more than 0.7 °C difference melting temperature between forward primer and reverse primer. The PCR products were cloned and sequenced for identifying single-nucleotide polymorphisms. SNPs that created restriction sites were selected for development of CAPS markers with SNP2CAPS [21]. To test the CAPS markers, PCR products were digested with an appropriate FastDigest enzyme (Fermentas) for 5 min with incubation at the corresponding temperature, and then resolved on 1% agarose stained with GoodView (SBS).
2.4. Tissue-specific gene expression analysis of the ZAG2 gene Tissue-specific expression of ZAG2 was assessed by real-time quantitative RT-PCR, performed on a CFX96 Touch Cycler (Bio-Rad). The detection of amplification rates was performed using THUNDERBIRD qPCR Mix (TOYOBO). ZAG2 mRNA expression was normalized against actin. Every sample had three technical replicates. The cycle parameters were as follows: an initial denaturation step of 60 s at 95 °C, and then denaturation at 95 °C for 15 s and annealing and extension at 64 °C for 60 s, for 45 cycles of PCR.
2. Materials and methods 2.1. Plant material and growth conditions
3. Results
Maize inbred lines including B73, Mo17, Zheng 58, Chang 7-2, Huang C, and 178 were planted in spring at Beibei (29°76′N, 106°37′E), Chongqing, China. Among these inbred lines, B73 and Mo17 were the most widely used elite inbred lines worldwide. Zheng 58 and Chang 7-2 and Huang C and 178 were the respective parents of Zhengdan 958 and Nongda 108, well-known corn hybrids in China. Endosperm tissues were collected at 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28 DAP. Embryos were harvested at 14 and 18 DAP. Tissues at the same developmental stage derived from different ears were pooled prior to RNA or DNA extraction. Additionally, the root, stem, leaf, immature tassel (3–4 cm), and ear (3–4 cm) were collected from B73.
3.1. Characterization of ZAG2 According to the putative cDNA sequence (GRMZM2G160687), the gene-specific primer GSP-1 (Table 1) flanking the open reading frame (ORF) was designed to amplify the target gene from cDNA of 14 DAP maize kernels. The PCR products were sequenced and BLASTed against the Reference RNA Sequences database and High Throughput Genomic Sequences database of Zea mays (http://www.ncbi.nlm.nih.gov/BLAST). The amplified sequence showed 99% identity with Zea mays AGAMOUS homolog2 (ZAG2). ZAG2 putatively encoded a protein composed of 269 amino acids and contained a typical MADSbox domain and K-box domain (Fig. 1), indicating that ZAG2 was a member of the MADS-box gene family.
2.2. Total RNA extraction and cDNA synthesis 3.2. ZAG2 is a maternally expressed imprinted gene Samples were ground in liquid nitrogen. Ground tissue (200 mg) was treated with 1 mL Trizol (Invitrogen). Total RNA was isolated and then digested with DNaseI to remove genomic DNA before use. Approximately 1 mg of total RNA was used as a template for cDNA synthesis, using an oligo(dT) primer according to the specifications of RevertAid First Strand cDNA Synthesis Kit (Fermentas). The quality of the synthesized cDNA was evaluated by actin amplification.
2.3. Development of cleaved amplified polymorphic sequence (CAPS) markers Gene specific primers (GSP) were designed with PrimerBLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/
A CAPS marker, GSP-2 (Table 1) located at the 3′ terminus of the ZAG2 cDNA, was developed and used for amplifying the 14 DAP endosperm cDNAs of the reciprocal hybrids between B73 and Mo17. DNA sequencing showed that SNPs were present between B73 and Mo17 alleles and could be recognized by the enzyme Sph I. The digestion profile of the PCR products digested by Sph I indicated that the expression of ZAG2 from the maternal allele was greater than that from the paternal allele in B73 × Mo17 (Fig. 2). Thus, ZAG2 was a maternally expressed imprinted gene. Extremely weak expression of ZAG2 from the paternal allele was detected in B73 × Mo17, indicating that ZAG2 also displayed differential imprinting. However, the case was very different in Mo17 × B73, in which ZAG2 was thoroughly imprinted, indicating that ZAG2
76
T H E CR O P J O U RN A L 3 ( 2 01 5 ) 7 4 – 7 9
Table 1 – Primers used for ZAG2 amplification, imprinting identification, and qPCR. Primer
Forward sequence (5′–3′)
Reverse sequence (5′–3′)
Product size (bp)
GSP-1 GSP-2 a Q-GSP Actin
TTATCTCTTCTGAGTGCTCCGC TGAGAAAGGCATCTCTAAGATCAGG TGAGAGGTACAAGAAGGCACAC TCACCCTGTGCTGCTGACCG
AGAACATCTAGAGGCAACAGCC CACACACAAAAGGCAACAACAATA AAGAATGGGTTCAGCTCCAAGT GAACCGTGTGGCTCACACCA
1002 541 417 190
a
Restriction enzyme Sph I
Information from Zhang et al. (2011).
Fig. 1 – The conservative motifs of the ZAG2 protein.
Fig. 2 – The digestion profile of the PCR products amplified from 14 DAP endosperm of B73, Mo17 and their reciprocal hybrids, indicating that ZAG2 was imprinted in maize endosperm. M: Mo17; B: B73.
displayed binary imprinting in this cross. Imprinting status was also evaluated in 14 DAP maize embryo (Fig. 3). The results showed that ZAG2 was imprinted in embryo as well as in endosperm.
7-2 could be recognized by Sph I. The digestion profile showed that all of the ZAG2 alleles were paternally imprinted in the reciprocal hybrids (Fig. 4). With the imprinting pattern in the reciprocal hybrid between B73 and Mo17, these findings indicate that ZAG2 showed gene-specific imprinting.
3.3. ZAG2 shows gene-specific imprinting To determine whether ZAG2 was also imprinted in other hybrids, GSP-2 was used for amplifying 14 DAP endosperm cDNA from Huang C, 178, Huang C × 178, 178 × Huang C, Zheng 58, Chang 7-2, Zheng 58 × Chang 7-2, and Chang 7-2 × Zheng 58. The sequenced PCR products showed that SNPs distinguishing Huang C and 178, Zheng 58, and Chang
3.4. Imprinting characterization of ZAG2 at different developmental stages in maize endosperm To characterize imprinting in maize endosperm, endosperm was collected every two days from 10 to 28 DAP. In the same way as mentioned above, the PCR products were digested with Sph I and then separated by 1% gel electrophoresis. The
Fig. 3 – The digestion profile of the PCR products amplified from 14 DAP embryo of B73, Mo17, and their reciprocal hybrids, indicating that ZAG2 was imprinted in maize embryo.
T H E CR O P J O U RN A L 3 ( 2 0 15 ) 7 4 – 7 9
77
a
b
Fig. 4 – The digestion profile of PCR products, indicating that ZAG2 showed gene-specific imprinting. H: Huang C; C: Chang 7-2; Z: Zheng 58.
digestion profile showed that ZAG2 was consistently imprinted in B73 × Mo17 and Mo17 × B73 from 10 to 28 DAP in maize endosperm (Fig. 5). The expression of ZAG2 showed differential imprinting at 22, 24, and 28 DAP in B73 × Mo17 (Fig. 5-a), and at 16, 22, 24, and 28 DAP in Mo17 × B73 (Fig. 5-b). At other stages, ZAG2 exhibited binary imprinting.
3.5. Tissue-specific expression pattern of ZAG2 A tissue-specific expression pattern directly reflects the location where a gene functions. Accordingly, cDNAs from root, stem, leaf, immature tassel (3–4 cm), immature ear (3–4 cm), 18 DAP endosperm, and 18 DAP embryo of inbred line B73 were synthesized. The primer Q-GSP (Table 1) was designed for amplifying ZAG2 in the different B73 tissues. The qRT-PCR results indicated that ZAG2 was expressed primarily in immature ear and 18 DAP embryo. Extremely weak signals were detected in stem, immature tassel and 18 DAP endosperm and no signal was detected in root or leaf (Fig. 6). These results
suggest that ZAG2 plays important roles in maize immature ear and kernel development.
4. Discussion Genomic imprinting has been shown to play important roles in seed development. Berger and Chaudhury pointed out that an additional dosage of the paternal genome increased endosperm size and that an additional maternal dosage reduced endosperm size [22]. RNA-seq of 10 and 14 DAP endosperm of reciprocal hybrids between B73 and Mo17 greatly expanded the number of imprinted genes including ZAG2 in maize [17,18]. Although genomic imprinting in maize has attracted wide interest, the function of most imprinted plant genes is not well characterized [23]. As a first step toward addressing this issue, we studied the imprinting type and expression pattern of ZAG2 in three reciprocal hybrids.
a
b
Fig. 5 – Imprinting characterization of ZAG2 in different developmental stages of endosperm in B73 × Mo17 and Mo17 × B73. *indicates that ZAG2 expression showed differential imprinting.
78
T H E CR O P J O U RN A L 3 ( 2 01 5 ) 7 4 – 7 9
REFERENCES
Fig. 6 – Tissue-specific expression pattern of ZAG2 in B73.
Imprinted gene expression is classified as gene-specific imprinting (in which all the alleles at a given locus are imprinted) or allele-specific imprinting (in which certain alleles at a specific locus are imprinted), differential imprinting (in which both alleles are expressed, but one allele is expressed dominantly), or binary imprinting (in which only one allele is expressed) [24]. Our results showed that ZAG2 exhibited differential imprinting in hybrids of B73 × Mo17 and 178 × Huang C, but binary imprinting in other hybrids. The difference could be caused by different genetic backgrounds. It can be concluded that ZAG2 is a maternally expressed locus-specific imprinted gene, given that all the ZAG2 alleles were imprinted when paternally inherited. In maize, the majority of imprinted genes are subject to a parent-of-origin pattern of expression at a given locus, and gene-specific imprinting usually occurs during early stages of endosperm development [10]. ZAG2 was consistently imprinted in endosperm from 10 to 28 DAP, a pattern similar to that of fie1 in maize [15] and FIS2 in Arabidopsis [25]. Interestingly, ZAG2 was also imprinted in embryo at 14 DAP. It appears that ZAG2 played an important role in embryo development, but the expression pattern also indicated that ZAG2 played an important role in immature ear development. A previous study showed that imprinted genes crucially affect seed development in flowering plants [26]. To date, the function of only one imprinted maize gene has been completely established [27]. The imprinting and expression pattern of ZAG2 will shed light on the function of ZAG2 in kernel development.
Acknowledgment This study was supported by the Fundamental Research Funds for the Central Universities (XDJK2013C023), the Chongqing Postdoctoral Science Foundation (Xm201344), the China Postdoctoral Science Foundation (2014M552303), the Research Fund for the Doctoral Program of Southwest University (SWU112037) and the Research Fund for the Doctoral Program of Higher Education (2011182120011).
[1] M. Gehring, Y. Choi, R.L. Fischer, Imprinting and seed development, Plant Cell 16 (2004) S203–S213. [2] W. Reik, J. Walter, Genomic imprinting: parental influence on the genome, Nat. Rev. Genet. 2 (2001) 21–32. [3] M. Luo, J.M. Taylor, A. Spriggs, H. Zhang, X. Wu, S. Russell, M. Singh, A. Koltunow, A genome-wide survey of imprinted genes in rice seeds reveals imprinting primarily occurs in the endosperm, PLoS Genet. 7 (6) (2011) e1002125, http:// dx.doi.org/10.1371/journal.pgen.1002125. [4] T.-F. Hsieh, J. Shin, R. Uzawa, P. Silva, S. Cohen, M.J. Bauer, M. Hashimoto, R.C. Kirkbride, J.J. Harada, D. Zilberman, Regulation of imprinted gene expression in Arabidopsis endosperm, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 1755–1762. [5] J.H. Huh, M.J. Bauer, T.-F. Hsieh, R. Fischer, Endosperm gene imprinting and seed development, Curr. Opin. Genet. Dev. 17 (2007) 480–485. [6] J. Kermicle, Dependence of the R-mottled aleurone phenotype in maize on mode of sexual transmission, Genetics 66 (1970) 69–85. [7] J. McGrath, D. Solter, Completion of mouse embryogenesis requires both the maternal and paternal genomes, Cell 37 (1984) 179–183. [8] M. Surani, S. Barton, M. Norris, Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis, Nature 308 (1984) 548–550. [9] G. Egger, G. Liang, A. Aparicio, P.A. Jones, Epigenetics in human disease and prospects for epigenetic therapy, Nature 429 (2004) 457–463. [10] J.F. Gutiérrez-Marcos, L.M. Costa, C. Biderre-Petit, B. Khbaya, D.M. O'Sullivan, M. Wormald, P. Perez, H.G. Dickinson, Maternally expressed gene1 is a novel maize endosperm transfer cell-specific gene with a maternal parent-of-origin pattern of expression, Plant Cell 16 (2004) 1288–1301. [11] M. Guo, M.A. Rupe, O.N. Danilevskaya, X. Yang, Z. Hu, Genome-wide mRNA profiling reveals heterochronic allelic variation and a new imprinted gene in hybrid maize endosperm, Plant J. 36 (2003) 30–44. [12] S. Chaudhuri, J. Messing, Allele-specific parental imprinting of dzr1, a posttranscriptional regulator of zein accumulation, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 4867–4871. [13] W.J. Haun, S. Laoueillé-Duprat, M.J. O'Connell, C. Spillane, U. Grossniklaus, A.R. Phillips, S.M. Kaeppler, N.M. Springer, Genomic imprinting, methylation and molecular evolution of maize enhancer of zeste (Mez) homologs, Plant J. 49 (2007) 325–337. [14] S. Jahnke, S. Scholten, Epigenetic resetting of a gene imprinted in plant embryos, Curr. Biol. 19 (2009) 1677–1681. [15] O.N. Danilevskaya, P. Hermon, S. Hantke, M.G. Muszynski, K. Kollipara, E.V. Ananiev, Duplicated fie genes in maize expression pattern and imprinting suggest distinct functions, Plant Cell 15 (2003) 425–438. [16] J.F. Gutierrez-Marcos, P.D. Pennington, L.M. Costa, H.G. Dickinson, Imprinting in the endosperm: a possible role in preventing wide hybridization, Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 358 (2003) 1105–1111. [17] M. Zhang, H. Zhao, S. Xie, J. Chen, Y. Xu, K. Wang, H. Zhao, H. Guan, X. Hu, Y. Jiao, Extensive, clustered parental imprinting of protein-coding and noncoding RNAs in developing maize endosperm, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 20042–20047. [18] A.J. Waters, I. Makarevitch, S.R. Eichten, R.A. Swanson-Wagner, C.-T. Yeh, W. Xu, P.S. Schnable, M.W. Vaughn, M. Gehring, N.M. Springer, Parent-of-origin effects on gene expression and DNA methylation in the maize endosperm, Plant Cell 23 (2011) 4221–4233. [19] R. Ishikawa, T. Ohnishi, Y. Kinoshita, M. Eiguchi, N. Kurata, T. Kinoshita, Rice interspecies hybrids show precocious or
T H E CR O P J O U RN A L 3 ( 2 0 15 ) 7 4 – 7 9
[20]
[21]
[22] [23]
delayed developmental transitions in the endosperm without change to the rate of syncytial nuclear division, Plant J. 65 (2011) 798–806. C. Köhler, D.R. Page, V. Gagliardini, U. Grossniklaus, The Arabidopsis thaliana MEDEA Polycomb group protein controls expression of PHERES1 by parental imprinting, Nat. Genet. 37 (2004) 28–30. T. Thiel, R. Kota, I. Grosse, N. Stein, A. Graner, SNP2CAPS: a SNP and INDEL analysis tool for CAPS marker development, Nucleic Acids Res. 32 (2004) e5. F. Berger, A. Chaudhury, Parental memories shape seeds, Trends Plant Sci. 14 (2009) 550–556. A.J. Waters, P. Bilinski, S.R. Eichten, M.W. Vaughn, J. Ross-Ibarra, M. Gehring, N.M. Springer, Comprehensive analysis of imprinted genes in maize reveals allelic variation for imprinting and limited conservation with other species, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 19639–19644.
79
[24] P. Bhavani, K. Harinikumar, H. Shashidhar, S.M. Zargar, Genetic imprinting in maize, Maize Genomics Genet. 3 (2012) 13–21. [25] M. Luo, P. Bilodeau, E.S. Dennis, W.J. Peacock, A. Chaudhury, Expression and parent-of-origin effects for FIS2, MEA, and FIE in the endosperm and embryo of developing Arabidopsis seeds, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 10637–10642. [26] M.T. Raissig, C. Baroux, U. Grossniklaus, Regulation and flexibility of genomic imprinting during seed development, Plant Cell 23 (2011) 16–26. [27] L.M. Costa, J. Yuan, J. Rouster, W. Paul, H. Dickinson, J.F. Gutierrez-Marcos, Maternal control of nutrient allocation in plant seeds by genomic imprinting, Curr. Biol. 22 (2012) 160–165.
Available online at www.sciencedirect.com
ScienceDirect
Characterization of the imprinting and expression patterns of ZAG2 in maize endosperm and embryo Chaoxian Liu1 , Jiuguang Wang1 , Xiupeng Mei, Xiaojing Deng, Tingting Yu, Xiaoli Liu, Guoqiang Wang, Zhizhai Liu, Yilin Cai⁎ Maize Research Institute, Southwest University, Chongqing 400715, China
AR TIC LE I N FO
ABS TR ACT
Article history:
ZAG2 has been identified as a maternally expressed imprinted gene in maize endosperm.
Received 28 January 2014
Our study revealed that paternally inherited ZAG2 alleles were imprinted in maize
Received in revised form
endosperm and embryo at 14 days after pollination (DAP), and consistently imprinted in
10 October 2014
endosperm at 10, 12, 16, 18, 20, 22, 24, 26, and 28 DAP in reciprocal crosses between B73 and
Accepted 3 December 2014
Mo17. ZAG2 alleles were also imprinted in reciprocal crosses between Zheng 58 and Chang
Available online 16 December 2014
7-2 and between Huang C and 178. ZAG2 alleles exhibited differential imprinting in hybrids of 178 × Huang C and B73 × Mo17, while in other hybrids ZAG2 alleles exhibited binary imprinting. The tissue-specific expression pattern of ZAG2 showed that ZAG2 was
Keywords:
expressed at a high level in immature ears, suggesting that ZAG2 plays important roles in
Gene imprinting
not only kernel but ear development.
ZAG2
© 2015 Crop Science Society of China and Institute of Crop Science, CAAS. Production and hosting
Expression pattern
by Elsevier B.V. All rights reserved. This is an open access article under the CC BY-NC-ND license
Endosperm
(http://creativecommons.org/licenses/by-nc-nd/3.0/).
Embryo
1. Introduction Genomic imprinting, the differential expression of alleles depending on parental origin, is an epigenetic phenomenon occurring in mammals as well as in angiosperms [1]. In mammals, imprinting usually occurs in embryonic and extra-embryonic tissues [2]. In flowering plants, the majority of imprinted genes are expressed in triploid endosperm [3–5]. R1, which regulates anthocyanin biosynthesis in maize endosperm, was the first-discovered gene showing genomic imprinting. When R1 was inherited maternally, the full kernel was pigmented, whereas when R1 was inherited paternally, the kernel exhibited mottled pigmentation [6]. Later, genomic imprinting was also discovered in mouse. A nuclear
transplantation experiment showed that completion of mouse embryogenesis required both the maternal and paternal genomes, and that two copies of either the paternal or the maternal genome were not sufficient for normal development of mouse embryos [7,8]. Although imprinting was first discovered in plants, studies have been widely conducted in mammals. It is well established that imprinted genes regulate placenta development and fetal growth in mammals and that a change of methylation status of imprinted genes may cause human disease [9]. Imprinted loci are classified as paternally or maternally imprinted, depending upon which parental allele is expressed. In maize, paternally imprinted genes include Meg1 [10], nrp1 [11],
⁎ Corresponding author. E-mail address: [email protected] (Y. Cai). Peer review under responsibility of Crop Science Society of China and Institute of Crop Science, CAAS. 1 Chaoxian Liu and Jiuguang Wang contributed equally to this work.
http://dx.doi.org/10.1016/j.cj.2014.10.001 2214-5141/© 2015 Crop Science Society of China and Institute of Crop Science, CAAS. Production and hosting by Elsevier B.V. All rights reserved. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
T H E CR O P J O U RN A L 3 ( 2 0 15 ) 7 4 – 7 9
dzr1 [12], Mez1 [13,14], fie1, and fie2 [15], etc. By contrast, maternally imprinted genes are fewer [16]. With the development of modern sequencing technology, 111 maternally imprinted and 68 paternally imprinted genes were newly identified in 10 DAP endosperm from reciprocal crosses between inbred lines B73 and Mo17, according to whether the expression of a given allele was fivefold greater than that of the other allele [17]. A similar study was performed by Waters et al. [18], but employing different criteria: a gene designated as imprinted required 90% of reads to be from one allele. As a result, 100 putative imprinted genes were identified in endosperm 14 days after pollination (DAP) from reciprocal crosses between B73 and Mo17, including 54 maternally and 46 paternally expressed imprinted genes. Though only 50 genes were common to the 100 and 179 genes designated as imprinted by these two research groups, these studies still greatly expanded the number of imprinted genes in maize. ZAG2 is one of the 50 imprinted genes identified in common. ZAG2, as well as the imprinted gene OsMADS87 in rice [19] and PHE1 in Arabidopsis [20], is also a MADS-box transcription factor. Here we report the imprinting characterization of ZAG2 in three reciprocal crosses and evaluate the tissue-specific expression pattern of ZAG2, with the aim of elucidating the function of ZAG2 in maize development.
75
index. cgi?LINK_LOC = BlastHome) and used to amplify the target sequence of ZAG2 cDNA for CAPS marker development. The main parameters were as follows: primer size of about 22 bp, primer GC content of 40–60%, and no more than 0.7 °C difference melting temperature between forward primer and reverse primer. The PCR products were cloned and sequenced for identifying single-nucleotide polymorphisms. SNPs that created restriction sites were selected for development of CAPS markers with SNP2CAPS [21]. To test the CAPS markers, PCR products were digested with an appropriate FastDigest enzyme (Fermentas) for 5 min with incubation at the corresponding temperature, and then resolved on 1% agarose stained with GoodView (SBS).
2.4. Tissue-specific gene expression analysis of the ZAG2 gene Tissue-specific expression of ZAG2 was assessed by real-time quantitative RT-PCR, performed on a CFX96 Touch Cycler (Bio-Rad). The detection of amplification rates was performed using THUNDERBIRD qPCR Mix (TOYOBO). ZAG2 mRNA expression was normalized against actin. Every sample had three technical replicates. The cycle parameters were as follows: an initial denaturation step of 60 s at 95 °C, and then denaturation at 95 °C for 15 s and annealing and extension at 64 °C for 60 s, for 45 cycles of PCR.
2. Materials and methods 2.1. Plant material and growth conditions
3. Results
Maize inbred lines including B73, Mo17, Zheng 58, Chang 7-2, Huang C, and 178 were planted in spring at Beibei (29°76′N, 106°37′E), Chongqing, China. Among these inbred lines, B73 and Mo17 were the most widely used elite inbred lines worldwide. Zheng 58 and Chang 7-2 and Huang C and 178 were the respective parents of Zhengdan 958 and Nongda 108, well-known corn hybrids in China. Endosperm tissues were collected at 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28 DAP. Embryos were harvested at 14 and 18 DAP. Tissues at the same developmental stage derived from different ears were pooled prior to RNA or DNA extraction. Additionally, the root, stem, leaf, immature tassel (3–4 cm), and ear (3–4 cm) were collected from B73.
3.1. Characterization of ZAG2 According to the putative cDNA sequence (GRMZM2G160687), the gene-specific primer GSP-1 (Table 1) flanking the open reading frame (ORF) was designed to amplify the target gene from cDNA of 14 DAP maize kernels. The PCR products were sequenced and BLASTed against the Reference RNA Sequences database and High Throughput Genomic Sequences database of Zea mays (http://www.ncbi.nlm.nih.gov/BLAST). The amplified sequence showed 99% identity with Zea mays AGAMOUS homolog2 (ZAG2). ZAG2 putatively encoded a protein composed of 269 amino acids and contained a typical MADSbox domain and K-box domain (Fig. 1), indicating that ZAG2 was a member of the MADS-box gene family.
2.2. Total RNA extraction and cDNA synthesis 3.2. ZAG2 is a maternally expressed imprinted gene Samples were ground in liquid nitrogen. Ground tissue (200 mg) was treated with 1 mL Trizol (Invitrogen). Total RNA was isolated and then digested with DNaseI to remove genomic DNA before use. Approximately 1 mg of total RNA was used as a template for cDNA synthesis, using an oligo(dT) primer according to the specifications of RevertAid First Strand cDNA Synthesis Kit (Fermentas). The quality of the synthesized cDNA was evaluated by actin amplification.
2.3. Development of cleaved amplified polymorphic sequence (CAPS) markers Gene specific primers (GSP) were designed with PrimerBLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/
A CAPS marker, GSP-2 (Table 1) located at the 3′ terminus of the ZAG2 cDNA, was developed and used for amplifying the 14 DAP endosperm cDNAs of the reciprocal hybrids between B73 and Mo17. DNA sequencing showed that SNPs were present between B73 and Mo17 alleles and could be recognized by the enzyme Sph I. The digestion profile of the PCR products digested by Sph I indicated that the expression of ZAG2 from the maternal allele was greater than that from the paternal allele in B73 × Mo17 (Fig. 2). Thus, ZAG2 was a maternally expressed imprinted gene. Extremely weak expression of ZAG2 from the paternal allele was detected in B73 × Mo17, indicating that ZAG2 also displayed differential imprinting. However, the case was very different in Mo17 × B73, in which ZAG2 was thoroughly imprinted, indicating that ZAG2
76
T H E CR O P J O U RN A L 3 ( 2 01 5 ) 7 4 – 7 9
Table 1 – Primers used for ZAG2 amplification, imprinting identification, and qPCR. Primer
Forward sequence (5′–3′)
Reverse sequence (5′–3′)
Product size (bp)
GSP-1 GSP-2 a Q-GSP Actin
TTATCTCTTCTGAGTGCTCCGC TGAGAAAGGCATCTCTAAGATCAGG TGAGAGGTACAAGAAGGCACAC TCACCCTGTGCTGCTGACCG
AGAACATCTAGAGGCAACAGCC CACACACAAAAGGCAACAACAATA AAGAATGGGTTCAGCTCCAAGT GAACCGTGTGGCTCACACCA
1002 541 417 190
a
Restriction enzyme Sph I
Information from Zhang et al. (2011).
Fig. 1 – The conservative motifs of the ZAG2 protein.
Fig. 2 – The digestion profile of the PCR products amplified from 14 DAP endosperm of B73, Mo17 and their reciprocal hybrids, indicating that ZAG2 was imprinted in maize endosperm. M: Mo17; B: B73.
displayed binary imprinting in this cross. Imprinting status was also evaluated in 14 DAP maize embryo (Fig. 3). The results showed that ZAG2 was imprinted in embryo as well as in endosperm.
7-2 could be recognized by Sph I. The digestion profile showed that all of the ZAG2 alleles were paternally imprinted in the reciprocal hybrids (Fig. 4). With the imprinting pattern in the reciprocal hybrid between B73 and Mo17, these findings indicate that ZAG2 showed gene-specific imprinting.
3.3. ZAG2 shows gene-specific imprinting To determine whether ZAG2 was also imprinted in other hybrids, GSP-2 was used for amplifying 14 DAP endosperm cDNA from Huang C, 178, Huang C × 178, 178 × Huang C, Zheng 58, Chang 7-2, Zheng 58 × Chang 7-2, and Chang 7-2 × Zheng 58. The sequenced PCR products showed that SNPs distinguishing Huang C and 178, Zheng 58, and Chang
3.4. Imprinting characterization of ZAG2 at different developmental stages in maize endosperm To characterize imprinting in maize endosperm, endosperm was collected every two days from 10 to 28 DAP. In the same way as mentioned above, the PCR products were digested with Sph I and then separated by 1% gel electrophoresis. The
Fig. 3 – The digestion profile of the PCR products amplified from 14 DAP embryo of B73, Mo17, and their reciprocal hybrids, indicating that ZAG2 was imprinted in maize embryo.
T H E CR O P J O U RN A L 3 ( 2 0 15 ) 7 4 – 7 9
77
a
b
Fig. 4 – The digestion profile of PCR products, indicating that ZAG2 showed gene-specific imprinting. H: Huang C; C: Chang 7-2; Z: Zheng 58.
digestion profile showed that ZAG2 was consistently imprinted in B73 × Mo17 and Mo17 × B73 from 10 to 28 DAP in maize endosperm (Fig. 5). The expression of ZAG2 showed differential imprinting at 22, 24, and 28 DAP in B73 × Mo17 (Fig. 5-a), and at 16, 22, 24, and 28 DAP in Mo17 × B73 (Fig. 5-b). At other stages, ZAG2 exhibited binary imprinting.
3.5. Tissue-specific expression pattern of ZAG2 A tissue-specific expression pattern directly reflects the location where a gene functions. Accordingly, cDNAs from root, stem, leaf, immature tassel (3–4 cm), immature ear (3–4 cm), 18 DAP endosperm, and 18 DAP embryo of inbred line B73 were synthesized. The primer Q-GSP (Table 1) was designed for amplifying ZAG2 in the different B73 tissues. The qRT-PCR results indicated that ZAG2 was expressed primarily in immature ear and 18 DAP embryo. Extremely weak signals were detected in stem, immature tassel and 18 DAP endosperm and no signal was detected in root or leaf (Fig. 6). These results
suggest that ZAG2 plays important roles in maize immature ear and kernel development.
4. Discussion Genomic imprinting has been shown to play important roles in seed development. Berger and Chaudhury pointed out that an additional dosage of the paternal genome increased endosperm size and that an additional maternal dosage reduced endosperm size [22]. RNA-seq of 10 and 14 DAP endosperm of reciprocal hybrids between B73 and Mo17 greatly expanded the number of imprinted genes including ZAG2 in maize [17,18]. Although genomic imprinting in maize has attracted wide interest, the function of most imprinted plant genes is not well characterized [23]. As a first step toward addressing this issue, we studied the imprinting type and expression pattern of ZAG2 in three reciprocal hybrids.
a
b
Fig. 5 – Imprinting characterization of ZAG2 in different developmental stages of endosperm in B73 × Mo17 and Mo17 × B73. *indicates that ZAG2 expression showed differential imprinting.
78
T H E CR O P J O U RN A L 3 ( 2 01 5 ) 7 4 – 7 9
REFERENCES
Fig. 6 – Tissue-specific expression pattern of ZAG2 in B73.
Imprinted gene expression is classified as gene-specific imprinting (in which all the alleles at a given locus are imprinted) or allele-specific imprinting (in which certain alleles at a specific locus are imprinted), differential imprinting (in which both alleles are expressed, but one allele is expressed dominantly), or binary imprinting (in which only one allele is expressed) [24]. Our results showed that ZAG2 exhibited differential imprinting in hybrids of B73 × Mo17 and 178 × Huang C, but binary imprinting in other hybrids. The difference could be caused by different genetic backgrounds. It can be concluded that ZAG2 is a maternally expressed locus-specific imprinted gene, given that all the ZAG2 alleles were imprinted when paternally inherited. In maize, the majority of imprinted genes are subject to a parent-of-origin pattern of expression at a given locus, and gene-specific imprinting usually occurs during early stages of endosperm development [10]. ZAG2 was consistently imprinted in endosperm from 10 to 28 DAP, a pattern similar to that of fie1 in maize [15] and FIS2 in Arabidopsis [25]. Interestingly, ZAG2 was also imprinted in embryo at 14 DAP. It appears that ZAG2 played an important role in embryo development, but the expression pattern also indicated that ZAG2 played an important role in immature ear development. A previous study showed that imprinted genes crucially affect seed development in flowering plants [26]. To date, the function of only one imprinted maize gene has been completely established [27]. The imprinting and expression pattern of ZAG2 will shed light on the function of ZAG2 in kernel development.
Acknowledgment This study was supported by the Fundamental Research Funds for the Central Universities (XDJK2013C023), the Chongqing Postdoctoral Science Foundation (Xm201344), the China Postdoctoral Science Foundation (2014M552303), the Research Fund for the Doctoral Program of Southwest University (SWU112037) and the Research Fund for the Doctoral Program of Higher Education (2011182120011).
[1] M. Gehring, Y. Choi, R.L. Fischer, Imprinting and seed development, Plant Cell 16 (2004) S203–S213. [2] W. Reik, J. Walter, Genomic imprinting: parental influence on the genome, Nat. Rev. Genet. 2 (2001) 21–32. [3] M. Luo, J.M. Taylor, A. Spriggs, H. Zhang, X. Wu, S. Russell, M. Singh, A. Koltunow, A genome-wide survey of imprinted genes in rice seeds reveals imprinting primarily occurs in the endosperm, PLoS Genet. 7 (6) (2011) e1002125, http:// dx.doi.org/10.1371/journal.pgen.1002125. [4] T.-F. Hsieh, J. Shin, R. Uzawa, P. Silva, S. Cohen, M.J. Bauer, M. Hashimoto, R.C. Kirkbride, J.J. Harada, D. Zilberman, Regulation of imprinted gene expression in Arabidopsis endosperm, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 1755–1762. [5] J.H. Huh, M.J. Bauer, T.-F. Hsieh, R. Fischer, Endosperm gene imprinting and seed development, Curr. Opin. Genet. Dev. 17 (2007) 480–485. [6] J. Kermicle, Dependence of the R-mottled aleurone phenotype in maize on mode of sexual transmission, Genetics 66 (1970) 69–85. [7] J. McGrath, D. Solter, Completion of mouse embryogenesis requires both the maternal and paternal genomes, Cell 37 (1984) 179–183. [8] M. Surani, S. Barton, M. Norris, Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis, Nature 308 (1984) 548–550. [9] G. Egger, G. Liang, A. Aparicio, P.A. Jones, Epigenetics in human disease and prospects for epigenetic therapy, Nature 429 (2004) 457–463. [10] J.F. Gutiérrez-Marcos, L.M. Costa, C. Biderre-Petit, B. Khbaya, D.M. O'Sullivan, M. Wormald, P. Perez, H.G. Dickinson, Maternally expressed gene1 is a novel maize endosperm transfer cell-specific gene with a maternal parent-of-origin pattern of expression, Plant Cell 16 (2004) 1288–1301. [11] M. Guo, M.A. Rupe, O.N. Danilevskaya, X. Yang, Z. Hu, Genome-wide mRNA profiling reveals heterochronic allelic variation and a new imprinted gene in hybrid maize endosperm, Plant J. 36 (2003) 30–44. [12] S. Chaudhuri, J. Messing, Allele-specific parental imprinting of dzr1, a posttranscriptional regulator of zein accumulation, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 4867–4871. [13] W.J. Haun, S. Laoueillé-Duprat, M.J. O'Connell, C. Spillane, U. Grossniklaus, A.R. Phillips, S.M. Kaeppler, N.M. Springer, Genomic imprinting, methylation and molecular evolution of maize enhancer of zeste (Mez) homologs, Plant J. 49 (2007) 325–337. [14] S. Jahnke, S. Scholten, Epigenetic resetting of a gene imprinted in plant embryos, Curr. Biol. 19 (2009) 1677–1681. [15] O.N. Danilevskaya, P. Hermon, S. Hantke, M.G. Muszynski, K. Kollipara, E.V. Ananiev, Duplicated fie genes in maize expression pattern and imprinting suggest distinct functions, Plant Cell 15 (2003) 425–438. [16] J.F. Gutierrez-Marcos, P.D. Pennington, L.M. Costa, H.G. Dickinson, Imprinting in the endosperm: a possible role in preventing wide hybridization, Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 358 (2003) 1105–1111. [17] M. Zhang, H. Zhao, S. Xie, J. Chen, Y. Xu, K. Wang, H. Zhao, H. Guan, X. Hu, Y. Jiao, Extensive, clustered parental imprinting of protein-coding and noncoding RNAs in developing maize endosperm, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 20042–20047. [18] A.J. Waters, I. Makarevitch, S.R. Eichten, R.A. Swanson-Wagner, C.-T. Yeh, W. Xu, P.S. Schnable, M.W. Vaughn, M. Gehring, N.M. Springer, Parent-of-origin effects on gene expression and DNA methylation in the maize endosperm, Plant Cell 23 (2011) 4221–4233. [19] R. Ishikawa, T. Ohnishi, Y. Kinoshita, M. Eiguchi, N. Kurata, T. Kinoshita, Rice interspecies hybrids show precocious or
T H E CR O P J O U RN A L 3 ( 2 0 15 ) 7 4 – 7 9
[20]
[21]
[22] [23]
delayed developmental transitions in the endosperm without change to the rate of syncytial nuclear division, Plant J. 65 (2011) 798–806. C. Köhler, D.R. Page, V. Gagliardini, U. Grossniklaus, The Arabidopsis thaliana MEDEA Polycomb group protein controls expression of PHERES1 by parental imprinting, Nat. Genet. 37 (2004) 28–30. T. Thiel, R. Kota, I. Grosse, N. Stein, A. Graner, SNP2CAPS: a SNP and INDEL analysis tool for CAPS marker development, Nucleic Acids Res. 32 (2004) e5. F. Berger, A. Chaudhury, Parental memories shape seeds, Trends Plant Sci. 14 (2009) 550–556. A.J. Waters, P. Bilinski, S.R. Eichten, M.W. Vaughn, J. Ross-Ibarra, M. Gehring, N.M. Springer, Comprehensive analysis of imprinted genes in maize reveals allelic variation for imprinting and limited conservation with other species, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 19639–19644.
79
[24] P. Bhavani, K. Harinikumar, H. Shashidhar, S.M. Zargar, Genetic imprinting in maize, Maize Genomics Genet. 3 (2012) 13–21. [25] M. Luo, P. Bilodeau, E.S. Dennis, W.J. Peacock, A. Chaudhury, Expression and parent-of-origin effects for FIS2, MEA, and FIE in the endosperm and embryo of developing Arabidopsis seeds, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 10637–10642. [26] M.T. Raissig, C. Baroux, U. Grossniklaus, Regulation and flexibility of genomic imprinting during seed development, Plant Cell 23 (2011) 16–26. [27] L.M. Costa, J. Yuan, J. Rouster, W. Paul, H. Dickinson, J.F. Gutierrez-Marcos, Maternal control of nutrient allocation in plant seeds by genomic imprinting, Curr. Biol. 22 (2012) 160–165.