Characterization of the integration site of the CMV mtr in a tumor cell line

VIROLOGY

156,

74-63

(1987)

Characterization FRANC0 Fred

of the Integration

M. BUONAGURO, Hutchinson

Cancer

JAMES K. MCDOUGALL,

Research

Received

Site of the CMV mtr in a Tumor Cell Line

Center,

July 3, 1986;

1124 Columbia accepted

Street,

September

DENISE A. GALLOWAY’

AND

Seattle, 22,

Washington

98104

1986

Previous studies have shown that a 558-bp fragment of human cytomegalovirus (CMV) DNA contained within pCM4127 and designated CMV mtr can morphologically transform rodent cells in vitro. By cotransformation with pCM4127 and a plasmid conferring G418 resistance, pSVPneo, morphologically transformed NIH3T3 cell lines were isolated. Dot blot hybridization indicated that approximately 30% of the transformants retained CMV sequences. Two cell lines which retained viral DNA were chosen for further study. They were capable of anchorage independent growth and formed tumors in nude mice. Integrated viral sequences in the transformants and tumor cell lines were analyted by Southern blotting. A bacteriophage lambda library was constructed using a tumor cell line which retained a single copy of the viral sequences, and a phage was isolated which contained the integrated plasmid and the flanking cellular sequences. A complex rearrangement between pCM4127 and pSV2neo had occurred. DNA sequence analysis showed integration of the plasmid sequences into repetitive mouse DNA and identified an adjacent mouse sequence. Q 1997 Academic

Press. Inc.

INTRODUCTION

strated that a cloned fragment of viral DNA from CMV strain AD1 69 is able to morphologically transform NIH3T3 or rat embryo cells to an anchorage independent phenotype and many of the transformants were tumorigenic in nude mice (Nelson et a/., 1982). The morphological transforming region (mtr) was delineated to a 558-bp fragment, designated pCM4127, which mapped to the region of the genome encoding the IE mRNAs (Nelson et al,, 1984). A structural analysis of the region encoding pCM4127 has shown that it falls within a 5.0-kb unspliced message which is made at immediate-early times and continues to be synthesized late in infection. DNA sequence analysis of a 2.9-kb segment within the message, including the region encoding pCM4127 has not revealed a significantly long open reading frame, nor have efforts to identify a protein product by in vitro translation of hybrid selected mRNA been successful. In order to study the mechanism by which pCM4127 transforms cells we established cell lines by cotransfection of NIH3T3 cells with pCM4127 and plasmid pSV2neo containing a dominant selectable marker, resistance to the antibiotic G418. These studies were designed to measure the frequency at which morphological transformation occurs, facilitate the identification of cell lines which have retained pCM4127 sequences, and help determine whether the integration of CMV sequences into the host cell genome contributes to the transformed phenotype. Because the CMV mtr does not encode a viral transforming protein, one hypothesis is that transformation occurs by activation of cellular genes. As an approach to identify the target genes, a genomic library was constructed from a

Human cytomegalovirus (CMV) is a member of the herpesvirus group and is capable of causing permissive infections resulting in asymptomatic disease, birth defects, pneumonia, or mononucleosis, and is a serious pathogen of immunocompromised hosts (for a review see Ho, 1982). It is capable of remaining latent in the host and causing recurrent infections (for a review see Jordan, 1983). In addition, viral nucleic acids or antigens have been found in tumors, such as Kaposi’s sarcoma, adenocarcinoma of the colon, and prostate carcinoma (for a review see Spector and Spector, 1984) although an etiologic role for CMV has not been established. The genome of CMV is a linear double-stranded DNA molecule of approximately 235 kb with a structural organization similar to that of herpes simplex virus (HSV) (for a review see Stinski, 1983). Mapping of the viral genes is in a preliminary stage because of the lack of viral genetics and poor growth in culture. The most extensively characterized RNAs have been those that are transcribed as immediate early (IE) genes in the laboratory strains AD1 69 (Jahn et al., 1984) Towne (Stinski eta/., 1983) and Davis (DeMarchi, 1981). Unlike HSV, CMV IE transcription is clustered to a single region of the genome (map coordinate 0.709-0.751) where a number of IE RNAs are encoded. The ability of CMV to transform rodent cells was first reported by Albrecht and Rapp (1973) using UV inactivated virus. The transformants were able to form tumors in weanling Syrian hamsters. We have demon’ To whom 0042.6822187

requests

for reprints

$3.00

Copyright Q 1997 by Academic Press. Inc. All rights of reproduction in any form reserved.

should

be addressed. 74

CMV

transformed pCM4127.

cell line which retained

MATERIALS Plasmid construction hybridization probes

AND

MORPHOLOGICAL

a single copy of

METHODS

and preparation

of

The plasmid pCM4127 which contains a 558-bp /iindIIIIBamHI fragment of CMV strain AD1 69 DNA was described previously (Nelson et al., 1984). pSV2neo was supplied by Peter Southern (Scripps Research Institute). The bacteriophage TN4-Z/2 was used as stat-ting material to construct a number of plasmids. Individual fragments were purified from low melting agarose gels and ligated to appropriately cleaved pUC vectors as described in the text and figure legends. Restriction endonucleases and other nucleic acid modifying enzymes were purchased from Bethesda Research Laboratories or New England Biolabs and used according to the manufacturers instructions or according to Maniatis er al. (1982). Plasmids were propagated in Escherichia coliJM83 and DNA was isolated by the clear lysate technique and purified by gradient centrifugation through CsCI. fragments of DNA were purified after restriction cleavage and electrophoresis through low melting point agarose. Hybridization probes were prepared by nick translation of either intact plasmids or purified fragments with 32P-labeled nucleotides to specific activities of 5 X 10’ CPM/pg DNA. Transformation characterization

Protocol and biological of the transformants

Ten micrograms of pCM4127 plasmid DNA were coprecipitated with 10 pg of pSV2neo by the calcium phosphate technique (Graham and van der Eb, 1973) onto 80% confluent monolayers of NIH3T3 cells in 60mm dishes, which had been seeded with 5 x 1O5 cells 24 hr before transfection. Cultures were exposed to DNA for 4 hr, treated with 10% DMSO for 2 min, washed with phosphate-buffered saline solution (PBS), and allowed to incubate for 24 hr at 37” in DME + 10% FCS. After incubation, cells were passaged 1:9 and placed in selective medium (DME + 5% FCS + 400 pg/ml G-41 8). Ten to 15 days later, when drug resistant colonies were visible, plates were fed with DME + 2% FCS + 200 pg/ml of G-41 8. Medium was changed twice weekly. Foci of morphologically altered cells were identified and isolated by cylinder cloning 5-6 weeks later and expanded in DME + 5% FCS. Anchorage-independent growth was quantitated by colony formation in semisolid agar employing a modification of the method developed by MacPherson and Montagnier (1964). Transformed cells were trypsinized,

TRANSFORMATION

75

diluted and 1 X 104, 1 X 1 03, or 1 X 10’ cells were seeded per 60-mm dish in 0.3% Difco Noble agar. One hundred cells were plated per loo-mm dish in DME for plating efficiency. Cultures were fed with 2 ml of DME medium every week and colonies 2 mm in diameter were counted 4 weeks later. Tumorigenicity was assayed by subcutaneous injection of 0.5-l .O x 1 O6 cells into 4-week-old athymic BALB/c nu/nu mice. Inoculated animals were checked weekly for palpable tumors. All tumors were assayed by pathological examination. Construction and screening of a lambda library of TN4-2/2 transformed cell DNA High molecular weight DNA from the tumor cell line TN4-2/2 was digested to completion with Bg/ll and fractionated on a 0.7% low melting agarose gel. DNA from the region of 1 O-20 kb was purified and consisted of an enrichment of pCM4127 positive sequences of about 1 O-fold. The bacteriophage XL47.1 (Leonen and Brammar, 1980) was digested with BarnHI and the left and right arms were purified. The genomic DNA and the X DNA were ligated together in a ratio of 2:l and the DNA was packaged into phage coats following the method of Hohn and Murray (1977). Phage (4 X 105) were screened by hybridization to nitrocellulose filters (Benton and Davis, 1977), using as probe the released CMV fragment pCM4127. Filter hybridization was performed in 50x formamide, 5X SSC, 5X Denhardt’s, 25 mM NaP04, and 250 pg/ml of salmon sperm DNA at 42” for 20 hr followed by washing four times in 0.2X SSC + 0.1% SDS at 68”. Areas yielding a positive signal were diluted and reanalyzed and plaque purified. DNA from nine plaques was prepared and analyzed by restriction enzyme cleavage and Southern blotting. DNA sequence

analysis

M 13 recombinant phage were constructed by purifying fragments of DNAfrom plasmids and ligating them into appropriately cleaved M 13 vectors. Selection and growth of recombinant phage and preparation of phage DNA were done by standard techniques (Schrier and Cortese, 1979). Recombinants were characterized by T-track analysis (Anderson, 1981) prior to running full sequencing reactions. Dideoxynucleoside triphosphate chain termination sequencing methods (Sanger et al., 1977) were pet-formed using M 13 recombinant phage DNA templates as previously described (Swain et a/., 1985). DNA sequence data were compiled and analyzed on a DEC Rainbow computer using the Genepro software written by J. Brown (Oncogene, Inc.) and J. Wallace (Fred Hutchinson Cancer Research Center). Homology searches on DNA and amino acid se-

76

BUONAGURO,

MCDOUGALL, TABLE

AND

GALLOWAY

1

EFFICIENCY OF DRUG RESISTANT AND MORPHOLOGICAL No. of cells exposed b

DNA” 1. C.T.

1.5x

2. CT. + pSV2neo 3. C.T. + pCM4127

1.5x10” 1.5x lo6 1.5x106

4.

pSV2neo

t pCM4127

No. of foci in G418

106

0

<6.5X

0

1.74x10-4 <6.5x 1O-7 1.86 x 1 o-’

255 280

60-mm dish received 20 rrg- total of DNA; Dfasmid of three 60.mm dishes received 5 X 1 O5 cells.

a Each b Each

quences (1983).

utilized the method

Freq of TX to G418’

DNA

was

of Wilbur and Lipman

RESULTS Characterization

of pCM4127

transformed

cells

NIH3T3 cells were exposed to mixtures of DNA containing either 10 pg pCM4127 + 10 pg pSV2neo or 10 pg calf thymus DNA + 10 pg pSV2neo. The frequency of G418 resistant colony formation was the same in each case, 1.8 X 1OP4. When drug resistant colonies were clearly visible, the serum content of the medium was reduced to 2% and the medium was changed twice weekly. Foci of morphologically altered cells were identified and counted 3-4 weeks later. In the dishes exposed to pCM4127 transformed foci arose at a frequency of 3.0 x 1OP5 foci/cell or 1.5 foci/pg of DNA. The transformation frequency is consistent with the level reported previously (Nelson et al., 1984). In contrast, in the dishes exposed to calf thymus DNA morphologically transformed foci arose at a frequency of 2.6 X 1O-6 foci/cell or 0.12 foci/pg DNA. The experiments have been done three times and the results of one transformation experiment is shown in Table 1.

TABLE TUMORIGENICIW

AND ANCHOWGE

2 INDEPENDENT

Clone

Colony forming efficiency in 0.3% Noble agar’

N4-1 N4-2 NIH3T3

100% 71%
GROWTH

Tumorigenicity in nude miceb 414 314 o/4

’ Primary transformants were tested for anchorage independent growth by plating 1 04, 1 03, and 10’ cells in soft agar (the efficiency has been calculated normalizing the number of colonies in agarvisible on the stereomicroscope by the plating efficiency on solid support). * Tumorigenicity was tested by subcutaneous injection of 0.5-l .O X 10’ cells into 4-week-old nude mice.

1O-7

TRANSFORMATION

No. of foci in G418 + 2% serum

Freq of morphol. TX

%G418’ + morphol.

TX

4 45

2.6 x lo-” 3.0 x 1o-5

1.49 16.1

10 rg/dish.

Individual foci were isolated with cloning cylinders 5-6 weeks after the shift to low serum and were expanded in DME plus 5% FCS. The morphology of the transformants was somewhat variable; however, in general the cells appeared elongated, highly refractile, with areas of irregular piling up, and criss-crossing of cells. The transformants were able to grow at higher density than the normal 3T3 cells. For reasons discussed below, two cell lines at approximately the 9th passage, designated N4-1 and N4-2, were chosen for further study. The cell lines were tested for anchorage independent growth in 0.3% Noble agar. The cloning efficiency was 100 and 7 l%, respectively, versus less than 0.01% for untransformed NIH3T3 cells. The transformants were also tested for their ability to induce tumors in 3-to 4-week-old athymic BALB/c nude mice. Animals injected with 2 X 10” NIH3T3 cells failed to develop tumors for up to 3 months. Mice injected with 0.5-l .O X 1 O6 cells from the N4-1 and N4-2 clones developed tumors which were evident within 4 weeks. The tumors were fibrosarcomas that in some cases metastasized to the kidney and other organs. These data are shown in Table 2. In previous experiments when pCM4127 was used alone to transform NIH3T3 cells or rat primary cells most of the transformants did not appear to retain viral DNA. In this experiment cell lines could be examined for the retention of both pSV2neo and pCM4127. In particular, because the CMV mtr was introduced on a separate plasmid from that conferring neomycin resistance the loss of the CMV plasmid could be followed independent of G418 selection. Initially, individual foci were screened by spot blot hybridization. When pBR322 or a purified fragment containing sequences just from the neomycin resistance gene were used as probe, 100% of the colonies were positive. When the 558 bp /-/indIII/f3amHI fragment containing the CMV moiety of pCM4127 was used as probe, approximately 30% of the colonies were positive (data not shown). This figure may be an underestimate of the number of

CMV

MORPHOLOGICAL

colonies which have retained pCM4127 sequences because those cell lines which retained only a single copy or a portion of the plasmid may have been missed by this assay. The percentage of cell lines which have retained viral sequences in a cotransformation experiment is certainly higher than when pCM4127 was used alone in previous experiments, suggesting that the obligatory integration of pSV2neo sequences to confer resistance to G418 leads to the integration of pCM4127 sequences as well. Two cell lines which retained CMV sequences were chosen for further study, N4-1 and N4-2. High molecular weight cell DNA was extracted from cells at passage 7, cleaved with the restriction endonucleases HindIll, Bglll, or Psf, electrophoresed through 1% agar, blotted, and hybridized with the CMV fragment denoted as 4127R as shown in Fig. 1. Both HindIll and Pstl cleave pCM4127 once to give a linear molecule of 4.6 kb; Bglll does not cleave the recombinant plasmid. In the case of N4-1 cleavage with either HindIll or fsrl gave an identical band of approximately 3.5 kb and a

I

N4-1 II

N4-2

TRANSFORMATION

few other high molecular weight bands, whereas cleavage with EIg/ll gave bands of 3.8 kb and at least one greater than 15 kb. This pattern of integrated sequences could result either from the integration of head to tail concatamers of a deleted form of pCM4127 or from the integration of a rearranged recombinant between pCM4127 and pSV2neo. Normal NIH3T3 cells do not have sequences homologous to pCM4127 (see Fig. 3). In the case of N4-2, cleavage with either HindIll or Pstl, resulted in a prominent band comigrating with unit length pCM4127, as well as bands of higher molecular weight. The presence of a band of greater than 15 kb when the DNA is digested with Bglll or left uncut argues against the presence of unintegrated plasmid DNA. When the DNA from N4-2 was cleaved with HindIll or Bg/ll and probed with a 2.3-kb HindllIIBamHI fragment containing the neomycin resistance gene and the downstream SV40 region, a 5.6-kb fragment corresponding to linear pSV2neo was seen (Fig. 1) suggesting the integration of at least partial head to tail

1

N4-2

I

~4127

/

23.1 9.4 6.6 4.4

2.3. 2.0

4127R

pBR322

NeoR

4127R

FIG. 1. Analysis of the retention of plasmid sequences in CMV transformed cell lines. High molecular weight cell DNA (5 pg) from the transformed cell lines N4-1 and N4-2 was cleaved with the restriction enzymes shown. The lanes marked ~4127 contain 100 pg of pCM4127 plasmid DNA plus 5 Mg NIH3T3 DNA. The lane marked X contains HindIll cleaved X DNA which was made radioactive with 3zP by end labeling. The DNAs were electrophoresed through 0.7% agarose. transferred to nitrocellulose. and prepared for hybridization using standard protocols. The nitrocellulose filter was first probed with the released 558.bp fragment of pCM4127 designated 4127R prepared by cleavage with Hindlll and BarnHI, electrophoresis through low melting agarose, and purification by phenol extraction. The fragmentation was then labeled by nick translation with two [3ZP]dNTP labels. Hybridization was at 42” in 50% formamide, 5X SSC for 18 hr followed by washes to 0.1 X SSC, 42”, 30’. The filter was covered in Saran Wrap and exposed for autoradiography for 5 days using Cronex “lightening plus” screens. The filter section containing the N4-2 DNA was then boiled to release the 4127R probe from the filter, monitored by autoradiographic exposure, and rehybridized with the nick-translated probes pBR322 and a 2.3.kb fragment containing the neomycin resistant gene prepared by cleavage of pSV2neo with HindIll and BarnHI. designated neoR.

78

BUONAGURO.

MCDOUGALL,

concatamers of the pSV2neo plasmid. The 7.0-kb HindIll fragment could result from the junction of pSV2neo and cellular sequences or from rearrangements between the two plasmids. Although each of the hybridization probes, 4127R and neoR might be contaminated with small amounts of vector sequences which could explain some comigrating species, it is likely that the N4-2 cell line retains multiple copies of pCM4127 (1 O-20 copies as estimated by hybridization intensity) as head to tail concatamers integrated into one or more sites in the host cell genome, fewer copies of pSV2neo (as shown by the fainter hybridization signal in Fig. 1 and as compared with a reconstruction, data not shown), and possibly rearranged molecules from both plasmids. When N4-2 transformed cells were injected into nude mice, tumors arose. Two of the tumors were excised and used to establish tumor cell lines designated TN42/l and TN4-2/2. DNA from these cell lines was purified and analyzed by Southern blot hybridization to determine whether CMV sequences were retained and whether the pattern of integration was changed by in viva passage of the cells. The results are shown in Fig. 2A. In this experiment, approximately fivefold more 2/ 2 DNA was loaded on the gel compared with 2/l. When both tumor cell lines are cleaved with BarnHI, a fragment indistinguishable from unit length pCM4127 is seen when probed with the 4127R probe suggesting that at least one intact copy of pCM4127 is present. Cleavage with EcoRl results in different bands in TN42/l and TN4-2/2 of slightly higher mobility than unit length 4127 suggesting that there are less than two intact tandem copies of pCM4127 in either cell line. A x

EcoRI -II---

BamHI

211 212

2/l

212

BgllI 2/l

2/2

Uncut 2/l

AND

GALLOWAY

Both BarnHI and EcoRl cleave pCM4127 once. Cleavage of either cell line with Hindlll results in a single band of approximately 8 kb which confirms the suggestion that less than a full tandem repeat of pCM4127 is retained in the tumor cell lines. Cleavage with Bglll results in a band of approximately 15 kb and only a signal in high molecular weight DNA is seen when the DNA is uncut. From the intensity of the hybridization signal using 4127R as a probe compared to a reconstruction (not shown) it is estimated that only a single copy of the CMV sequences is retained in the tumor cell lines. When the DNAs are probed with the neomycin sequences (Fig. 28) a band of 5.6 kb corresponding to unit length pSV2neo is seen in all of the lanes. The band at 4.6 kb comigrating with unit length pCM4127 may be due to contamination of the probe with vector sequences, or more likely the additional bands are probably due to rearrangements between pSV2neo and pCM4127. This is also true for the 15-kb Bglll band and the 8.0-kb HindIll band. A direct comparison of the integrated CMV sequences between the initial transformed cell lines and the tumor cell derivatives was done. Figure 3 shows the pattern of hybridization to 4127R in Bglll cleaved DNA of the transformants N41 and N4-2 and their tumor derivatives TN4-l/2 and TN4-2/2. Because the tumor cell derivatives retain fewer viral sequences than the parental transformants (see Figs. 1 and 2A) six times more tumor cell DNA was loaded on the gel. A band of approximately 15 kb is seen in the cell line N4-1 (as in Fig. 1) whereas no high molecular weight band is seen in the tumor derivative TN4-l/2. In the transformant N4-2 a doublet of

Hind III

212 2/l

2/2

0

EcoRI

BomHI

BgllI

Uncut

Hind IlI

x;/12/;;/12/;;/1

4127R FIG. 2. Analysis of the retention of plasmid sequences cell DNA from the tumor cell lines TN4-2/l and TN4-2/2 hybridization probe was 4127R, and in (B) the probe was

Neo R

in tumor cell lines derived from the CMV transformant N4-2. High molecular weight (here shown as 2/l and 2/2) were cleaved with the enzymes indicated. In (A) the neoR. flhe probes were described in the legend to Fig. 1.)

CMV

MORPHOLOGICAL

4127R FIG. 3. Analysis of the retention of CMV sequences in the transformed cell lines and their tumor cell line derivatives. High molecular weight DNA from N4-1 and N4-2 (2 fig) and from TN4-l/2 and TN42/2 (12 pg) were digested with 89-111, Southern blotted, and probed with 4127R as described in the legend to Fig. 1.

greater than 15 kb is prominent. Faint bands at approximately 15 and 12 kb can also be seen. In the tumor cell line TN4-2/2 a single strong band of 15 kb is present which does not correspond with either of the prominent bands of the parental cell line N4-2. The faint band at

’\

5.6 kb present in all of the cell lines is presumably pSV2neo detected because of small contamination of the 4127R probe with pBR322 sequences. Because of the similarity between the pattern of N4-1 and TN4-21 2, the possibility that the cell lines or their DNAs were mixed up was carefully examined. The date of establishment of the various tumor cell lines and isolation of a new preparation of DNA verified the results shown in Fig. 3. In addition when N4-1 is cleaved with HindIll or /?stl (see Fig. 1) smaller than unit length bands are seen in contrast with TN4-2/2. These results suggest that rearrangements occur during in viva propagation of the transformants. Because of the faint band at 15 kb in N4-2 which appears to comigrate with the prominent band in the tumor cell line, the possibility that the initial cell line was heterogeneous and only a small portion of the population grew in viva cannot be excluded. of the integration site of CMV Characterization sequences in the tumor cell line TN442

To obtain more complete information about the role of retention of CMV sequences in morphological transformation, the integration site.of pCM4127 in the tumor cell line TN4-2/2 was analyzed. High molecular weight cell DNA was cleaved with Bglll and fractionated on an agarose gel. The fraction containing the 15-kb Bglll band harboring the CMV sequences was purified and

pES325 E I

;-; H

79

‘\ I,\\, S,

I

TRANSFORMATION

pSH725 S

FIG. 4. Restriction enzyme cleavage map of XTN4-2/2. The parental bacteriophage XL47.1 is shown on the top line. The f3g/ll fragment of cellular DNA is inserted into the BamHl arms of the vector and a partial restriction enzyme cleavage map is shown on the middle line using the enzymes EcoRl (E). HindIll (H), BamHl (B), and Bg/ll (Bg). The schematic representation of the sequences contained within the insert as determined by restriction enzyme, Southern blot, and DNA sequence analysis includes the cellular sequences of NIH3T3 (m). the CMV sequences from pCM4127 (0) the neomycin gene from pSV2neo (&I), the SV40 sequences of pSV2neo (kg)). and pBR322 (0). Below the phage XTN4-2/2 are EcoRI. EcoRIISsfl. and SsrllHindlll plasmids which were subcloned from fragments of phage DNA. All of the fragments were ligated into appropriately cleaved pUC vectors. The plasmids are designated according to the restriction enzyme fragment used and the size of the fragment estimated from agarose gels.

80

BUONAGURO.

MCDOUGALL,

ligated to BarnHI arms of the bacteriophage lambda vector, L47.1. Phage containing the integrated pCM4127 sequences were identified by hybridization with the released viral fragment. These were analyzed extensively by restriction enzyme and Southern blot analysis using as probes 4127R, neoR, pBR322, and NIH3T3 DNA (data not shown), and the results were confirmed and extended by DNA sequence analysis. The composite results for the prototype phage XTN42/2 are shown in Fig. 4, and can be summarized as follows: (1) Nearly the entire transforming plasmid pCM4127 is present once and is contained within a 4.6 kb BarnHI fragment. (2) The 558-bp /-/indlll/BamHI CMV sequences present in pCM4127 are intact and are present once within the 4.6-kb BarnHI fragment. (3) The pCM4127 plasmid is flanked on either side by portions of the pSV2neo plasmid: rightwards of pCM4127 is a 4.7-kbf3amHl fragment from which about 1 kb of pSV2neo has been deleted, including the upstream regulatory sequences of SV40 and the 5’ end of the neomycin resistance gene spanning at least the BgllllHindIII fragment of pSV2neo, leaving the 3’ end of the neomycin gene, pBR322 sequences, and the SV40 sequences downstream of the neomycin gene. (4) Leftward of pCM4127, the pBR322 vector sequences within the Sa/l/Aval fragment have integrated into the downstream SV40 sequences rightward of the SV40 BarnHI site of pSV2neo, the SV40 sequences extended through the BamHIIEcoRI fragment containing nucleotides 1765-2516 of the SV40 genome and were confirmed by DNA sequence analysis. (5) Host cell (NIH3T3) DNA sequences flanking either side of the plasmid sequences are present within the insert. The most probable explanation is that during transfection, recombination between pCM4127 and pSV2neo occurred followed by a rearrangement which deleted a portion of the pSV2neo sequences. Then, insertion into the host cell DNA occurred. It is worth reiterating that in addition to the neomycin sequences retained as an incomplete copy in this location, Fig. 2B demonstrated the presence of additional copies of presumably intact pSV2neo plasmid within the cellular DNA of TN4-2/2. One question to address was whether the flanking cellular sequences were transcribed in the tumor cell. Cytoplasmic RNA was prepared from normal NIH 3T3 cells and TN4-2/2 cells, spotted in serial dilutions onto nitrocellulose and hybridized with the probes pXE2.3 and pXE5.1. Hybridization to RNAfrom both the normal and transformed cells was observed with phE2.3 whereas none was seen with pXE5.1 (data not shown). Because the cellular sequences leftward of the pCM4127 are transcriptionally active, attention was focused on characterizing the leftward integration site

AND

GALLOWAY

and the nature of those flanking cellular sequences. The nature of the cellular sequences present in pXE2.3 which was used as a hybridization probe to measure the levels of RNA was further analyzed by Southern blot hybridization. Figure 5 shows NIH3T3 DNA which has been cleaved with a number of restriction endonucleases, the fractionated products were transferred to nitrocellulose and hybridized with the pXE2.3 probe. The hybridization pattern indicated the presence of repetitive sequences although low copy number discrete bands could also be seen. The sequence of the junction spanning the plasmid and cellular sequences and extending to the junction with the bacteriophage arm is shown in Fig. 6. The individual EcoRl fragments designated pEE400 and pEE430 were cloned into M 13 vectors and sequenced. The EcoRl fragment pXE2.3 was subcloned by cleavage with Sstl and HindIll to produce pES325 and pSH725 which were then cloned into M 13 vectors for sequencing. The pBR322 portion of pSV2neo extended from the EcoRl site in the fragment designated pEE400 for 32 bases. At that point, another segment of pBR322 designated as nucleotides 1164 to 1333 of the pBR322 genome was present in an inverted orientation. The sequences adjacent to this portion of pBR322 are presumably mouse in origin as they show no homology to pSV2neo, pCM4127, or X DNA as determined by

23.1 9.4 6.6 4.4

2.3

pXE2.3 FIG. weight series 0.7% pXE2.3 in the

5. Hybridization of pXE2.3 to NIH3T3 DNA. High molecular DNA from untransformed NIH3T3 DNA was cleaved with a of restriction enzymes as indicated, electrophoresed through agarose and prepared for Southern blot analysis. The probe was nick translated and hybridized to the filter as described legend to Fig. 1.

CMV 10

20

MORPHOLOGICAL

30

81

TRANSFORMATION

40

50

60

70

80

90

GGATCTCCACAGTGTCATCCACACTGTGAGACAGATCAGAAAGAGTGGC~AGACTATGGACAGATTGGCACGTCAAGGACAGACACAGA 6an/Sg I 101

CAGAAAGGAAAGAATCAAACCTCCCGAAGiXACCCAGATATCCTTCTTAAGAGACCCAG;ACCAAGCATiCCTCCAGTAGGAGCCAGAGAGGACCCAGGA

201

301

401

501

601

701

TACAATCCT~GCATTCCTGGGATGAAGCC~TCTGAAGCA~TATGTGTTC~TGGATTCAG~TTTTGAGAA~TTTATTGAGC ----------------~-~---------_--_-----------~~~~~~

801

ATTTTTGCA~CGATATTCA~AAGGAAAAT~GGTCTGACA~TTGGGTCTT~ATGTGGTTTAGGTATAAGTCCAATTGTGACTCCATACAAA -Clo,-----------------------------------------------

301

GAATTGGGTAGTGTTCCTTClGTGTCTATiTTGTGGAATACCC ------------------------------------------EcoR,------

1001

ATCTGTTCC~GGGATTTGT~TGGTTGGGAGICTATTAAT~ACT~TTCT~TTTCTTTAG~TGTTATGGG~CAG~TG~~~~CA~GCA~AGATAGAGAC --------------------------

1101

CCAACCTTACCAGTTTTCCiGTCTGGTGGCACAGTCCACiT

1201

GAATCCGTTAGCGAGGTGCCGCCGGCTTCCATTCAGGTCG

1301

CGCCTACAAiCCATGCCAACCCGTTCCATGTGCTCGCCGAGAATTC

\I

EcoR

I

FIG. 6. DNA sequence of the joint between plasmid and cellular sequences and the flanking cellular sequence. The plasmids pSH725, pES325, pEE430. and pEE400 were cloned into appropriately cleaved Ml3 phage vectors and were used as templates for sequencing in Sanger reactions. The data obtained from a single strand extending from the BamHIIBg!ll phage-insert junction to the EcoRl site which includes the plasmid-cellular junction is shown. The position of relevant restriction enzyme sites which were used either for cloning the fragment or for orientation of the direction of the fragment is shown. The solid line (nucleotides 1 179-l 376) indicates the pBR322 sequences which include plasmid sequences 4363-4332 in one orientation. A region homologous to the human and mouse repetitive elements is shown as a dotted line (nucleotides 3151051).

computer assisted analysis. Beginning at nucleotide 1051 (Fig. 6) and extending to nucleotide 316 homology was detected to mouse repetitive DNA. A computer assisted homology search identified a segment which is homologous to the mouse dispersed repetitive DNA of the R family (Gebhard et al., 1982) and to the human Kpnl repetitive element (DiGiovanni et a/., 1983). Interestingly, both of these elements have been shown to be capable of transposition. The identity of the remaining cellular sequences (nucleotides l-31 5 and 10521177 of Fig. 6) remains unclear. A preliminary search for homology with DNA sequences in the EMBO library

or protein sequences in the Dayhoff library has not been conclusive. This question will be pursued more fully once the entire flanking gene has been isolated. From this data it can be concluded that a complicated rearrangement between pCM4127 and pSV2neo occurred which left most of pCM4127 intact, and rearranged and deleted pSV2neo sequences. This element was then inserted into the host cell genome without the generation of duplicated target sequences. Whether rearrangement of the cellular sequences occurred cannot be determined until the homologous sequences from untransformed NIH3T3 cells are isolated.

82

BUONAGURO.

MCDOUGALL.

DISCUSSION Our previous studies have demonstrated that a 558bp fragment of human cytomegalovirus DNA can morphologically transform rodent cells (Nelson eta/., 1982). The studies presented here confirm that observation and show that morphological transfomation of NIH3T3 cells occurs at a frequency of at least 1.5 foci/l O6cells/ pg DNA. Because only a single dose of the CMV mtr was used (10 pg) the efficiency of transformation may be an underestimate. Although this indicates that transformation by fragments of CMV DNA is inefficient, the results are reproducible and represent a frequency at least 1 O-fold above background. The resulting transformants can form colonies in semisolid media and are tumorigenic in nude mice indicating that pCM4127 can induce a fully transformed phenotype. The question of retention of viral sequences in the transformed cells has not been fully answered by these experiments. Using a protocol of cotransfection with a pSV2neo plasmid and initially selecting for drug resistant colonies, at least 30% of the morphologically transformed foci retained pCM4127. Several conclusions can be drawn: (1) These sequences of CMV DNA are not obligatorily excluded from cells. (2) Many cell lines could be established which apparently retained no CMV sequences. Although not fully explored in this study, there were no obvious differences in morphological appearance or biological behavior between cells which either did, or did not retain viral sequences (data not shown). (3) The frequency of retention of viral sequences was higher in protocols which involved cotransformation with a dominant selectable marker, than in those in which morphological transformation was selected directly. This may imply that the forced retention of pSV2neo sequences stimulates fortuitous integration of any DNA into the host cell genome, including pCM4127. In the primary transformants, multiple copies of viral sequences were retained, however, in cells which had been passaged extensively in nondrug-selective medium, and had been propagated in viva as tumors, cell lines could be identified in which only a single copy of pCM4127 was retained. Although the retention of even that integrated copy may be irrelevant, it may also indicate that its presence can contribute to the tumorigenic phenotype of the cell line. The analysis of the integration site in this tumor has revealed several things. Nearly the entire transforming plasmid (pCM4127) was retained intact, particularly the CMV sequences, indicating that the loss of the mtr is not essential. Whether recombination of pCM4127 with pSV2neo has in some way stabilized the retention of the viral sequences is unclear. Because a portion of the sequences conferring neomycin resistance have

AND

GALLOWAY

been deleted, one cannot argue that the plasmid sequences in this insertion were retained to confer neomycin resistance. There does not appear to be any unusual feature associated with the integration of the plasmid sequences into the host cell genome. No homology between the plasmid and cellular sequences is apparent, nor is there any duplication of sequences at the site of integration. Neither this data, nor a comparison of the restriction pattern of integrated pCM4127 from several transformants (Fig. 1 and unpublished data) supports a model of a specific integration site. The CMV mtr has been shown not to encode a viral protein (Nelson et a/., 1984) suggesting that an alternative mechanism to those generally found in DNA tumor viruses must be occurring. One possibility is that the CMV mtr alters the expression of a cellular gene, either by influencing its transcription, or simply by acting as an insertional mutagen. An important step will be to isolate the intact gene that is adjacent to the CMV mtr to determine whether this gene contributes to the transformed phenotype of the tumor cell line. ACKNOWLEDGMENTS We acknowledge gifts of plasmids from Jay Nelson and Peter Southern (Scripps Research Institute), computer analysis and DNA sequencing advice from Margaret Swain, the construction of M 13 recombinant phage and their sequencing from Jack Stevens (UCLA) and Luigi Buonaguro (Naples) whilevisiting this laboratory, technical assistance from Angela Taeschner and Lynetta Odell, manuscript preparation by Toni Higgs, and artwork by Paul Su. This work was supported by grants from the National Cancer Institute, CA26001 and CA35568 to D.A.G., and CA29350 and CA37265 to J.K.M. In the initial phase of this work F.B. (who is on leave from the Division of Viral Oncology, lstituto Nazionale dei Tumori, Naples) was supported by a fellowship from the World Health Organization.

REFERENCES ALBRECHT, T., and RAPP, F. (1973). Malignant transformation of hamster embryo fibroblasts following exposure to ultraviolet irradiated human cytomegalovirus. Virology 55, 53-61. ANDERSON, S. (1981). Shotgun DNA sequencing strategy using cloned DNase l-generated fragments. Nucleic Acids Res. 9, 3015-3027. BENTON, W. D., and DAVIS, R. W. (1977). Screening Xgt recombinant clones by hybridization to single plaques in situ. Science 196, 180192. DEMARCHI, J. M. (1981). Human cytomegalovirus DNA: Restriction enzyme cleavage maps and map locations for immediate early, early. and late RNAs. Virology 114, 23-28. DIGIOVANNI. L., HAYNES. S. R., MISRA. R., and JELINEK, W. R. (1983). Kpnl family of long dispersed repeated DNA sequences of man: Evidence for entry into genomic DNA of DNA copies of poly (A) terminated Kpnl RNAs. Proc. Nat/. Acad. Sci. USA 80, 6533-6537. GALLOWAY, D. A., NELSON, J.. and MCDOUGALL, J. K. (1984). Small fragments of herpesvirus DNA with transforming activity contain insertion sequence-like structures. Proc. Nat/. Acad. Sci. USA 81, 4736-4740. GEBHARD, W., MEITINGER. T., HOCHTL, J., and ZACHAUS, H. G. (1982).

CMV

A new mouse

MORPHOLOGICAL

family of interdispersed repetitive DNA sequence in the genome. J. Mol. Biol. 157, 453-47 1. GRAHAM, F. L., and VAN DER EB, A. J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52,456.467. Ho, M. (1982). In “Cytomegalovirus Biology and Infection” (IV. B. Greenough and T. C. Merigan, Eds.), pp. l-275. Plenum, New York. HOHN, B., and MURRAY, K. (1977). Packaging recombinant DNA molecules into bacteriophage particles in vitro. Proc. Nat/. Acac!. Sci. USA 74, 3259-3263. JAHN, G., KNUST, E., SCHMOLLA, H., SARRE, T., NELSON, J. A., McDouGALL, J. K., and FLECKENSTEIN, B. (1984). Predominant immediate early transcripts of human cytomegalovirus AD 169. J. Viral. 49, 363-370. JORDAN, M. C. (1983). Latent infection and the elusive cylomegalovirus. Rev. Infect. Dis. 5, 205-215. LOENEN, W. A., and BRAMMAR. W. J. (1980). A bacteriophage lambda vector for cloning large DNA fragments made with several resttiction enzymes. Gene 10,249-259. MACPHERSON, I., and MONTAGNIER, L. (1964). Agar suspension culture for the selective assay of cells transformed by polyoma virus. Virology 23, 291-294. MANIATIS, T., FRITSCH, E. F., and SAMBROOK, J. (1982). “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. NELSON, J. A., FLECKENSTEIN, B., GALLOWAY, D. A., and MCDOUGALL,

TRANSFORMATION

83

J. K. (1982). Transformation of NIH3T3 cells with cloned fragments of human cytomegatovirus strain AD169.J. Viral. 43, 83-91. NELSON, J. A., FLECKENSTEIN, B., JAHN, G., GALLOWAY, D. A., and MCDOUGALL, 1. K. (1984). Structure of the transforming region of human cytomegalovirus AD1 69. J. Krol. 49, 109-l 15. SANGER, F., NICKLEN. S., and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Nat/. Acad. Sci. USA 74, 5463.-5467. SCHRIER, P. H.. and CORTESE, R. (1979). A fast and simple method for sequencing DNA cloned in the single stranded bacteriophage Ml 3. J. Mol. Biol. 129, 169-172. SPECTOR, D. H., and SPECTOR, S. A. (1984). The oncogenic potential of human cytomegalovirus. In “Medical Virology” (J. L. Melnick, Ed.), Vol. 29, pp. 45-89. Karger, Easel. STINSKI, M. F. (1983). Molecular biology of cylomegaloviruses. In “The Herpesviruses” (B. Roizman, Ed.), Vol. 2, pp. 67-l 13. Plenum, New York. STINSKI, M. F., THOMSEN, R. M., STENBERG, R. M., and GOLDSTEIN, L. C. (1983). Organization and expression of the immediate early genes of human cytomegalovirus. J. Viral. 46, l-l 4. SWAIN, M. A., PEET, R. W., and GALLOWAY, D. A. (1985). Characterization of the gene encoding herpes simplex virus type 2 glycoprotein C and comparison with the type 1 counterpart. J. Viral. 53, 561-569. WILBUR, W. J., and LIPMAN. D. J. (1983). Rapid similarity searches of nucleic acid and protein data banks. Proc. Nat/. Acad. Sci. USA 80,726-730.