Characterization of the poly(A) binding proteins expressed during oogenesis and early development of Xenopus laevis

Biology of the Cell 94 (2002) 217–231 www.elsevier.com/locate/biocell

Original article

Characterization of the poly(A) binding proteins expressed during oogenesis and early development of Xenopus laevis Bertrand Cosson a, Anne Couturier a, René Le Guellec a, Jacques Moreau b, Svetlana Chabelskaya c, Galina Zhouravleva c, Michel Philippe a,* a

Université de Rennes 1, CNRS UMR 6061, IFR 97, 2, avenue Pr. Léon Bernard, 35043 Rennes cedex, France b Institut Jacques Monod, 2, Place Jussieu, 75251 Paris cedex 5, France c Department of Genetics, St. Petersburg State University, Universitetskaya emb. 7/9, 199034 St. Petersburg, Russia Received 4 October 2001; accepted 22 March 2002

Abstract During vertebrate oogenesis and early embryogenesis, gene expression is governed mainly by translational control. The recruitment of Poly(A) Binding Protein (PABP) during poly(A) tail lengthening appears to be the key to translational activation during this period of development in Xenopus laevis. We showed that PABP1 and ePABP proteins are both present during oogenesis and early development. We selected ePABP as an eRF3 binding protein in a two-hybrid screening of a X. laevis cDNA library and demonstrated that this protein is associated with translational complexes. It can complement essential functions of the yeast homologue Pab1p. We discuss specific expression patterns of the finely tuned PABP1 and ePABP proteins. © 2002 Published by Éditions scientifiques et médicales Elsevier SAS. Keywords: EPABP; PABP1; Pab1p; Poly(A) binding protein; ERF3

1. Introduction During vertebrate oogenesis and early embryogenesis, gene expression is governed mainly by translational control (see Curtis et al., 1995). Developing oocytes of most species are arrested at the first prophase of meiosis. Their growth is accompanied by an accumulation of maternal mRNAs, proteins and ribosomes that are necessary for the very rapid development following fertilization (Davidson, 1986). In general, reentry of quiescent oocytes into the meiotic cell cycle is associated with transcriptional arrest for a period that is species dependent. In X. laevis, this event is triggered by progesterone and marks the beginning of maturation which is characterized by progress from prophase I to metaphase II of meiosis. This prepares cells for fertilization.

* Corresponding author. Tel.: +33-2-23-23-44-70; fax: +33-2-23-23-44-78. E-mail address: [email protected] (M. Philippe). © 2002 Published by Éditions scientifiques et médicales Elsevier SAS. PII: S 0 2 4 8 - 4 9 0 0 ( 0 2 ) 0 1 1 9 5 - 4

Zygotic transcription is not effective until the 4000-cell stage named the Mid-Blastula Transition (MBT) (Newport and Kirschner, 1982). Translation of maternal mRNAs is the only means of synthesizing new proteins prior to the MBT. Dynamic changes in poly(A) tail length of some of these maternal mRNAs play important roles in their ribosome recruitment and temporally regulated pattern of translation (McGrew et al., 1989, reviewed in Osborne and Richter, 1997) and are required for correct development of X. laevis oocytes and embryos (Barkoff et al., 1998; Kuge and Inoue, 1992; Sheets et al., 1995; Stebbins-Boaz et al., 1996). However, to date the mechanisms by which changes in poly(A) tail length of mRNAs govern their translation are not fully understood. The protein that binds poly(A) tails in vivo, the poly(A) binding protein (PABP), is able to stimulate translation in X. laevis oocytes (Gray et al., 2000). Its recruitment during poly(A) tail lengthening appears, therefore, to be the key to translational activation during early development. This protein is a member of the Poly(A) Binding Protein I (PABP I) family composed of highly conserved eucaryotic proteins with high affinity for poly(A) RNA (Adam et al., 1986). The N-terminal part of PABP consists of four RNA binding

218

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

domains (RBD I–IV) and is linked by a long unfolded region to the PABC region (Kozlov et al., 2001). In yeast the essential Pab1p, the major cytoplasmic mRNA binding protein, fulfills roles in the translation and the stability (reviewed in Jacobson and Peltz, 1996). It also functions in premessenger RNA 3'-end formation (Amrani et al., 1997; Mangus et al., 1998; Minvielle-Sebastia et al., 1997). The cap-poly(A) synergy that stimulates translation (Iizuka et al., 1994) requires Pab1p (Tarun and Sachs, 1995) that interacts with eIF4G to circularize capped and polyadenylated mRNA (Wells et al., 1998). The PABPC region of mammalian PABP is able to bind in vitro to the translation termination factor eRF3 (Hoshino et al., 1999; Kozlov et al., 2001). This interaction has also been shown to occur in yeast where Pab1p acts in translation termination via eRF3 interaction (Cosson et al., 2002). In X. laevis, the first member of the PABP I family was cloned by Zelus et al. (Zelus et al., 1989) and is named PABP1. Its mRNA is present from the beginning of oogenesis and is homogeneously distributed in developing oocytes and then localized to the animal hemisphere in stage VI oocyte (Schroeder and Yost, 1996). However, the PABP1 protein was not detected before blastula stage of embryogenesis (Stambuk and Moon, 1992). The absence of this protein during early development was not expected since cytoplasmic polyadenylation of several mRNAs coincides with their translation activation and is critical for maturation. Cross-linking experiments have shown that in both stage I oocytes and X. laevis reticulocyte lysate, an 80 kDa protein binds to poly(A) RNA (Swiderski and Richter, 1988), that could correspond to PABP1. The presence and functional importance at this stage of development of PABP I was demonstrated by showing that some PABP could be coprecipitated with overexpressed human eIF4G in oocytes and that functional PABP binding domain of eIF4G was critical for maturation (Wakiyama et al., 2000). Cross-linking experiments have shown that a 74 kDa protein that binds poly(A) was present in oocytes but not in X. laevis reticulocyte lysate, suggesting that a variant of PABP1 or another PABP, which is development specific, exists in X. laevis (Swiderski and Richter, 1988). Nietfield et al. looked for new PABP by screening a X. laevis gastrula cDNA library. They found variants that have different untranslated regions but an open reading frame highly homologous to the PABP1 (Nietfeld et al., 1990). In this paper, we describe the characterization of a new PABP, named ePABP, selected as eRF3 binding protein in a two-hybrid screening of a X. laevis cDNA library. This new PABP was also cloned very recently by the Steitz group using a different approach (Voeltz et al., 2001). We developed specific tools in order to study expression pattern of PABP1 and ePABP proteins that are both present during oogenesis and early development of X. laevis.

2. Materials and methods 2.1. Yeast strains and media The Saccharomyces cerevisiae strain used in two-hybrid screen was HF7C (MAT a ura3-52 his 3-200 ade2-101 lys2-801 trp1-901 leu2-3,112 gal4-542 gal80-538 LYS2::GAL1-HIS3 URA3::(GAL4 17-mers)3-CYC1-lacZ) (Feilotter et al., 1994). Two reporter genes, HIS3 and lacZ, were used for assaying interactions. Positive protein interactions first were detected by the ability of yeast cotransformants to grow on synthetic medium lacking histidine, leucine and tryptophan and then—by a β-galactosidase filter assay. Strain YBL 4068 (MATα his3-11,15 leu2-3,112 trp1-1 ura3-1 pab1::HIS3 [pBL471 PAB1]) was received from B. Lapeyre (Pintard et al., 2000). Yeast cultures were grown in YPD (1% yeast extract/2% peptone/2% glucose) or in SC—synthetic minimal medium (0.67% yeast nitrogen base/2% glucose with appropriate auxotrophic supplements). Transformants were grown in the media selective for plasmid maintenance, e.g., SC-TRP, SC-Leu, SC-Ura. Cotransformants were grown in the media selective for maintenance of all plasmids introduced. Yeast transformations was performed as described (Gietz et al., 1995). Plate color assay with X-gal as substrate was performed as described (Xie et al., 1993). For plasmid shuffling, selective medium containing 1 mg/ml 5-fluorotic acid (Sigma) was used. Growth curves were performed as follows. Overnight cultures were diluted 1:20 in YEPD and grown to mid-log phase (∼1 × 107 cells/ml). These cultures were used to inoculate YEPD to a starting density of 1 × 105 cells/ml and then grown at 25 °C. Samples were taken in triplicate from two independent cultures for optical density at 600 nm readings. 2.2. Library screening and sequencing An X. laevis cDNA library (oocyte VI and maturated eggs) in pGADGE plasmid was used for the two-hybrid screen (Fields and Song, 1989). The yeast reporter strain, HF7C, first was transformed by a pGBT9/XSUP35 plasmid containing a fusion of GAL4-DNA binding domain with Xenopus eRF3 and then with the library plasmids. More than 1.3 × 106 yeast transformants were screened using X. laevis cDNA library. After 5 d of growth on synthetic medium lacking histidine, leucine and tryptophan, His positive clones were isolated. His+ colonies were then tested in the β-galactosidase filter assay and His+ LacZ+ colonies were selected. These colonies were grown on synthetic tryptophane-containing liquid medium lacking leucine. DNA was isolated and used to transform HB101 strain to select the library plasmid carrying LEU2. These plasmids were recovered and retested. The plasmids that caused blue color in the presence of the Gal4-SUP35 fusion but not

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

alone were sequenced. Partial sequence analysis of clones was performed on double-stranded DNA with an oligonucleotide which hybridized to GAD plasmids. 2.3. ePABP cloning Total RNA from X. laevis stage 26 embryos were extracted according to Harland et al. (Harland and Misher, 1988). In order to obtain the 5' ePABP cDNA end, SMART RACE (Clontech) was performed with primer 214 that was designed from ePABP sequences selected from the twohybrid screen. Complete cDNA was then obtained by RT-PCR. First strand cDNA was synthesized from 5 µg of total RNA using standard protocol (Sambrook and Russell, 2001), using the 216C primer complementary to the 3' sequence of ePABP obtained via the two-hybrid screen. Semi-nested PCR amplification was done with primers 215–135 and then with primers 216–135 using the Dynazyme polymerase (Finnzymes) according to the manufacturer’s instructions. The BamHI–EcoRI amplimere was inserted in BamHI–EcoRI sites of pGEX-3X (Amersham Pharmacia Biotech) to create the plasmid GST-ePABP. 2.4. Plasmid construction Plasmid GST-PABP1 was obtained by subcloning a 1.9 kb XmaI–AatII PCR-generated fragment (from Psp64T/PABP1, a gift of F. Braun) containing the entire Xenopus PABP1 sequence using primers A and B (Table 1) into XmaI–AatII sites of pGEX-2T (Amersham Pharmacia Biotech). Plasmid pGBT9/XSUP35 was constructed by subcloning a 2.4 kb BamHI–SalI fragment containing XSUP35 sequence from bluescript/xSUP35 (Zhouravleva et al., 1995) (aa 1–614) into BamHI–SalI sites of pGBT9 (Clontech). Plasmid pGADGH/ePABP was obtained by subcloning of PCR-generated fragment (from GST-ePABP) containing the ePABP sequence in BamHI–EcoRI sites of pGADGH (Clontech) using primers C and 135.

219

Plasmid pYX242/ePABP was constructed by subcloning a 1.9 kb PCR fragment containing the ePABP sequence (from pGADGH/ePABP) using primers C and D into BamHI–HindIII sites of pYX242 (R&D Systems). For pYX242/yPAB1 plasmid construction, a PCR fragment was synthesized (from pFL44/PAB1 plasmid) (Amrani et al., 1997) using primers I and J. The product was digested with BamHI–XhoI and subcloned in pYX242. Plasmid MH3GB-PABP1 was constructed by subcloning BglII–AscI PABP1 PCR fragment (from GST-PABP1 plasmid) using primers E and F into BglII–AscI sites of MH3GB (a gift of F. Omilli). Plasmid MH3GB-ePABP was constructed by subcloning BglII–AscI ePABP PCR fragment (from GST-ePABP plasmid) using primers G and H into BglII–AscI sites of MH3GB. Plasmid pET21b/eRF3 and Plasmid pQE30/eRF1 have been previously described (Zhouravleva et al., 1995). 2.5. Antibodies Rabbit polyclonal antibodies were prepared against aa 445–458 of ePABP and aa 449–462 of PABP1, respectively (see Fig. 1B). Polyclonal anti-X. laevis PABPs antibody raised against amino acids 315–499 is a gift of F. Braun. Anti-yeast Pab1p is a gift of F. Wyers. Anti-eIF4G was kindly provided by S. Morley. Monoclonal anti-rabbit eIF4E was obtained from Transduction Laboratories and anti-β tubulin antibody from Sigma. Anti-eRF3 and antieRF1 antibodies were published previously (Tassan et al., 1993; Zhouravleva et al., 1995). 2.6. Protein procedures Radioactive recombinant proteins were produced in rabbit reticulocyte lysate using the TNT T7 quick system (Promega) as described by the manufacturer using MH3GBPABP1 and MH3GB-ePABP plasmids linearized by XbaI and EcoRI, respectively.

Table 1 Name

Sequence (5'–3')

Restriction site

A B C D E F G H I J 214 215 135 216

GGTACCCGGGGAATCCCAGTGCTCCCAGCTACCCAATGG ATTTGCGACGTCCTTAAGCAGTTGGCACTCCAGTTGCATTAAC CGGGATCCAAACATGAATGCAACC CCCAAGCTTGGGGTCCCTGTCTAG GAAGATCTTCCACCATGAATCCCAGTGCTCCCAGCTACCC GGCGCGCCGAGCAGTTGGCACTCCAGTTGC GAAGATCTTCCACCATGAATGCAACCGGAGCCGGATATCCG GGCGCGCCGGATCAAAGATGGTTGGGCAC CGGGATCCAACCAATAAAAATAAAATG CGCCTCGAGAGCTTGCTCAGTTTGTTG GCGGTCGTTCCCGGGG TCGTTCTGTAGGTTCGGC GGAATTCTGTCCTGTGCAAACTATAC CGGGATCCCCAACACACTGGCAAAC

XmaI AatII BamHI HindIII BglII AscI BglII AscI BamHI XhoI

EcoRI BamHI

220

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

Fig. 1. Identification of the proteins interacting with eRF3 using two-hybrid system. (A) Yeast strain HF7C containing two reporter genes (HIS3 and lacZ) was first transformed with a pGBT9 plasmid containing fusion of GAL4 DNA-binding domain with Xenopus eRF3 and then by a cDNA library of Xenopus laevis (stage VI oocyte and unfertilized egg (UFE)) expressed as fusions to the GAL4 activation domain. (B) Relative position of the sequences of three different clones obtained in the two-hybrid screen that correspond to ePABP and PABP1 sequences. For PABP1 (633 aa), the four RRM forming the RNA binding domain are indicated as gray boxes. The sequences of peptides homologous to ePABP and PABP1 used for rabbit’s immunizations are given. Only three amino acids (boldfaced) are identical between the two sequences. (C) Immunoblotting with specific antibodies revealed different electrophoretic mobility properties for recombinant ePABP and PABP1 despite their similar molecular weight. Full length ePABP was cloned by RT-PCR and the coding sequence was inserted into expression vector in order to produce recombinant proteins (see Materials and methods). Radiolabeled His-tagged proteins synthetized in RRL were analyzed by SDS-PAGE. Both proteins were detected by autoradiography (lanes 1 and 2), and immunoblot analyses were performed with antibodies specific to PABP1 (lanes 3 and 4) or ePABP (lanes 5 and 6).

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

Strain BL21(DE3) transformed with pET21b/eRF3 or PQE30/eRF1 was grown at 37 °C in LB + 50 µg/ul ampicillin to OD= 0.5. One milli-molar IPTG was added for induction of the tagged proteins overnight at 21 °C. NiNTA resin was equilibrated with buffer containing 20 mM Tris–HCl, pH 7.5, 500 mM NaCl, 10% glycerol. The 1000 g supernatant of the cell lysate with expressed Xenopus eRF3 or eRF1 were passed through the column. The column was washed extensively with 20 mM imidazole and His-tagged proteins were eluted from the resin with 0.25 M imidazole. Fractions containing eRF3 or eRF1 were combined, dialyzed against buffer A containing 50 mM Tris–HCl, pH 7.8, 1 mM EDTA, 1 mM DTT, and stored at –80 °C. For production of GST (glutathione-S-transferase)PABP protein, strain BL21(DE3) was transformed by pGEX construct (GST-ePABP and GSP-PABP1), growth and induction was carried out as described above for preparation of His-tagged proteins. Proteins were purified on glutathione sepharose 4B (Amersham Pharmacia Biotech) as described by the manufacturer and dialyzed against buffer A and stored at –80 °C. For quantification experiments, the GST tag of GST-PABP1 was cut using factor Xa protease according to the manufacturer’s instructions (New England Biolabs). In order to test PABP-eRF3 interactions, mixtures were prepared using 1 µg of ePABP, 1 µg of PABP1, 1 µg of GST, 2 µg of eRF3, 2 µg of eRF1 and were incubated 20 min at 4 °C in buffer A containing 1% NP40. Glutathione sepharose 4B was added, and the mixture was incubated for 15 min at 4 °C. Mixtures were then washed with 60-fold resin volume of buffer A containing 1% NP40. Bound proteins were eluted with buffer B (100 mM Tris pH 8, 1 mM DTT, 20 mM glutathione), subjected to SDS-PAGE, and analyzed by western blotting using anti-Xenopus eRF3 Cp, eRF1 or PABP (a gift from F. Braun) polyclonal rabbit antibodies. The developed antigen antibody complexes were detected with alkaline phosphatase conjugated second antibody with a chemifluorescent detection system (ECF, Amersham Pharmacia Biotech). To check expression of PABPs in the course of complementation experiments, yeast cell pellets from 0.25 l of growth medium were lyzed in buffer L containing 50 mM Tris–HCl, pH 7.8, 50 mM KCl, 5 mM βmercaptoethanol, 0.5% IGEPAL (Sigma), 1 mM phenylmethylsulfonyl fluoride (PMSF). Subsequent to centrifugation at 12 000 g, protein concentration in the supernatant was estimated by the Bradford method. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and revealed by western blotting using anti-ePABP or anti-Pab1p (a gift of F. Wyers) rabbit polyclonal antibodies. X. laevis cell extracts were prepared by homogenization of 20 oocytes or UFE in 200 µl of buffer E containing 100 mM Tris–HCl, pH 7.5, 15 mM KCl, 4 mM EDTA, 1% triton X100, 60 µM leupeptin, 40 µM pepstatin, 50 µM chymostatin. Subsequent to centrifugation at 12000g, freon

221

(1,1,2-trichlorotrifluoroethan) extraction was done. For samples that have been submitted to phosphatase treatment, EDTA was omitted in buffer E and 400 u of phosphatase lambda (New England Biolabs) was added to a volume of extract corresponding to three UFE—with 50 mM NaF and 50 mM EDTA when phosphatase inhibitors were used—and incubated for 30 min at 30 °C. Laemmli buffer was added before loading a volume equivalent to one oocyte or one UFE per lane. Protein extracts from adult X. laevis tissues were prepared according to Dignam et al. (Dignam, 1990) and 40 µg of proteins were loaded per lane. Western blot was then done as described for recombinant proteins. In vitro maturation of stage VI oocytes was induced by incubation of manually dissected oocytes in OR2 medium containing 4 nM of progesterone at 22 °C. Oocyte extract and protein analysis were done as described above. For the poly(A) and 7mGTP chromatography, extracts from oocytes or UFE were prepared as previously described (Murray et al., 1989). For the poly(A) column, 2 mM DTT, 4 µg/µl of yeast tRNA (Boerhinger) and 5 µg/µl of heparin (Sigma) were added. The mixture was incubated for 60 min at 4 °C with poly(A) or poly(C) beads (Sigma) that were then washed extensively before adding Laemmli buffer. For the cap column, 0.2 mM GTP was added to cell extracts and chromatography using 7mGTP-sepharose 4B (Amersham Pharmacia Biotech) was then carried out accordingly to Stebbins-Boaz et al. (1999).

3. Results and discussion 3.1. ePABP and eRF1 were selected as eRF3-interacting proteins We used the yeast two-hybrid system to identify protein(s) that associate with eRF3. A X. laevis cDNA library was screened with the Xenopus eRF3 as a bait. HF7C strain was transformed with a library of X. laevis cDNA fragments (from stage VI oocyte and matured eggs) expressed as fusions to the GAL4 acidic activation domain in pGADGE plasmid. Approximately 1.3 × 106 yeast transformants were screened, 460 His+ clones were isolated, among them 21 expressed both HIS3 and lacZ reporter genes. Sixteen clones that remained positive after plasmid purification and retesting were partly sequenced from 5' ends. Twelve represent independent fusions of Xenopus eRF1 to pGADGE (Fig. 1A). In agreement with published results (Merkulova et al., 1999), the domain of eRF1 involved in the interaction with eRF3 is situated in C-terminal part of eRF1 (amino acids 261–437). Four clones contain fusions of sequences of a PABP recently identified by Voeltz et al. using a different approach (Voeltz et al., 2001). This protein called embryonic PABP (ePABP) is clearly different from the previously described X. laevis PABP1 (Zelus et al., 1989). PABP contains four consensus RNA binding domains and a proline-rich carboxyl-terminal domain (Adam

222

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

et al., 1986; Burd et al., 1991). Comparative sequence analysis (Fig. 1B) reveals that the shortest ePABP clone is composed of the C-terminal part of the RRM4 and the C domain of the molecule. This is in accordance with the results of Hoshino et al. that define the C domain of the human PABP as the eRF3-interacting region (Hoshino et al., 1999). The complete cDNA sequence was obtained by RT-PCR using RNA derived from stage 26 embryos. The open reading frame of ePABP was subcloned in expression vectors (see Materials and methods). Antibodies against specific peptides of ePABP and PABP1 (described in Fig. 1B) were then produced in rabbit and tested by immunoblotting on recombinant proteins. As shown in Fig. 1C, specific antibodies were generated against each of the two PABPs. Despite close molecular weights (70.5 kDa for PABP1 and 70.7 kDa for ePABP), the apparent electrophoretic mobility differs between the two recombinant PABPs, whether produced in rabbit reticulocyte lysate (Fig. 1C, His-tagged proteins) or in bacteria (Fig. 3A, GST tagged proteins). 3.2. ePABP is able to complement PAB1 deletion in S. cerevisiae As the level of identity between Xenopus and yeast PABP is significant but not substantial (44% between ePABP or PABP1 and yeast Pab1p), we tested the ability of the Xenopus ePABP to compensate PAB1 gene disruption. For this purpose, the ePABP DNA sequence was placed under the control of the constitutive TPI promoter in the multicopy plasmid pYX242 and tested for functional complementation. In the haploid yeast strain YBL 4068, the lethal PAB1 disruption was complemented by the PAB1 gene on a URA3 centromeric plasmid pBL471 (Pintard et al., 2000). Transformants for pYX242/ePABP, pYX242/yPAB1 (a positive control) or the empty vector pYX242 (a negative control) were subjected to plasmid shuffling analysis in order to loose the pBL471 plasmid carrying the yeast PAB1 gene (Boeke et al., 1987). Yeast will grow only if Xenopus ePABP can functionally substitute for the essential yeast gene. Leu+Ura+ transformants were plated on medium containing 5-FOA to select against URA3 PAB1 plasmid. As expected, no growth on 5-FOA was observed when the empty vector pYX242 was used (Fig. 2A). Cells bearing the pYX242/ePABP plasmid, expressing only ePABP as evidenced by western blot analysis (Fig. 2B), grew on 5-FOA, as well as cells with pYX242/yPAB1. Thus, yeast expressing the X. laevis ePABP protein retains viability in the absence of its own PABP. Next, we determined whether ePABP could efficiently support growth of yeast cells (Fig. 2C). The results showed that cells expressing ePABP compared to the ones expressing yeast Pab1p grew slightly slower during the exponential phase. Thus, ePABP could complement the essential function of endogenous Pab1p in yeast cells. Complementation was also observed with wheat and Ara-

bidopsis PABP (Belostotsky and Meagher, 1996; Le et al., 1997a), providing evidence that some function(s) of eucaryotic PABPs has been conserved throughout evolution. Most of the sequence conservation between eucaryotic PABPs is localized in the N-terminal part, confirming that part of this region that contains four RNA binding domains is essential at least in yeast (Sachs et al., 1987). 3.3. Both ePABP and PABP1 are able to bind to eRF3 in vitro The two-hybrid screen identified ePABP as a partner of eRF3 but no clone homologous to PABP1 was found. In order to determine whether both Xenopus PABPs are able to interact with eRF3, we directly tested the interaction between the recombinant proteins in vitro. His-tagged eRF3 and eRF1 (used as a control) and GST-PABPs were individually produced in Escherichia coli and purified by affinity chromatography (Fig. 3A). GST-pulldown analysis was carried out to test the ability of these factors to interact. As shown in Fig. 3B, eRF3 interacts both with GST-PABP1 and GST-ePABP, but not with GST alone. To check the specificity of the interaction, we tested if GST-PABP could bind to eRF1. His-tagged eRF1 was not retained on GSTPABP1 or GST-ePABP columns. From these results, we conclude that both ePABP and PABP1 can specifically bind to eRF3. This result confirms that eRF3-PABP interaction is a general feature of eucaryotes from yeast to human (Cosson et al., 2002). The role of PABP in translation termination that is observed in yeast remains to be demonstrated in other eucaryotes. 3.4. ePABP is associated with eIF4G during Xenopus early development Functional properties of the PABP family include binding to poly(A) RNA and association with eIF4G, the large subunit of eIF4F. We initially checked that binding to poly(A) occurs both for recombinant proteins and for proteins from stage VI oocyte, UFE and activated eggs. Recombinant PABP1 and ePABP were able to bind specifically to poly(A), only low level of binding to the poly(C) column was observed (Fig. 3C, lanes 1 and 2). This result is in accordance with the strong homology (80%) between the RNA binding domains of PABP1 and ePABP. When extracts from stage VI oocyte, UFE or activated eggs were chromatographed on a poly(A) column, ePABP was retained from all the extracts. In contrast PABP1 was only detected in UFE and activated egg extracts. The lack of signal from PABP1 in the stage VI oocyte extract is probably due to the low level of expression of this protein before maturation (see below). Gallie et al. (Gallie et al., 2000) have shown that overexpressed but not endogenous PABP1 in stage VI oocytes was incorporated into the eIF4F complex suggesting that the PABP concentration was a limiting factor in

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

223

Fig. 2. ePABP compensate disruption of yeast PAB1 gene. (A) YBL 4068 strain (∆ pab1::HIS3 [pBL471 PAB1]) was transformed with pYX242/ePABP, vector pYX242 (negative control), or pYX242/yPAB1 (positive control). The transformants were assayed for growth by plating on 5-FOA medium to select against URA3 plasmid pBL471 carrying a wild type copy of PAB1. Yeasts transformed by ePABP were able to grow, whereas yeast transformed by the vector alone did not. (B) Western blot analyses of ePABP transformants compared with a wild type strain. Yeast extracts from exponential growing cell culture were prepared and subjected to SDS-PAGE analyses. Immunoblots were performed using anti-yeast Pab1p or anti-ePABP antibodies. (C) Growth curves of yeast strain (YBL 4068) bearing PAB1 or ePABP homologous gene instead of yeast PAB1. Transformants expressing only ePABP were selected in 5-FOA medium (panel A). Three independent transformants of each strain were inoculated at a cell density of 5 × 104 cells/ml in liquid YPD medium. The cultures were incubated with shaking at 25 °C, and aliquots were taken at intervals for optical density at 600 nm (OD600) readings.

224

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

Fig. 3a. PABP1 and ePABP properties. (A) Xenopus PABPs were expressed in fusion with the GST-tag. Immunoblot analyses were performed with antibodies specific to PABP1 (lanes 1 and 2) or ePABP (lanes 3 and 4). (B) GST-pulldown analyses of His-tagged eRF3 or eRF1 with GST-PABPs. The purified recombinant proteins were mixed as indicated in the figure before being chromatographed on GSH-sepharose column. Western blot analysis was performed using anti-eRF3 and anti-eRF1 polyclonal antibodies. GST protein was used as control. (C) Both PABPs, recombinant or from cell extracts, can be purified on poly(A) beads. GST-PABPs and stage VI oocyte, UFE and activated eggs extracts were chromatographed in parallel on a poly(A) and poly(C) columns. After extensive washing, beads were boiled in SDS to elute bound proteins. Western blots were performed using specific anti-ePABP antibodies (top panel). Lanes 3–8, the membrane blotted with anti-ePABP antibodies was reused to detect PABP1 with specific antibodies (bottom panel).

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

225

Fig. 3b. (D) Cap column assay. RNAse-treated UFE extracts from stage VI oocyte or UFE were supplemented with excess GTP (0.2 mM) and mixed with 7m GTP-sepharose beads (cap beads). The cap column was washed extensively. Bound proteins were eluted with 7mGTP (i.e., cap) or with GTP, then beads were boiled in SDS sample buffer. Proteins that eluted, in 7mGTP or with GTP, or in SDS sample buffer were western blotted with specific antibodies against eIF4G, eIF4E, ePABP and PABP1. GSH-sepharose beads were used as control.

226

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

Fig. 3c. (E) Cap column assay. Analyses were carried out as described in (D) except that proteins were directly eluted in SDS sample buffer. (F) Phosphatase treatment of UFE extracts does not modify the electrophoretic mobility of Xenopus PABPs. Extracts were treated with lambda phosphatase. Samples that correspond to one UFE were electrophoresed and immunoblotted with anti-Xenopus PABPs antibodies. Eg3 was used as control of phosphatase treatment.

determining its binding to eIF4F in uninjected oocyte. But at the same stage of development, a PABP was efficiently coimmunoprecipitated with overexpressed human eIF4GI (Wakiyama et al., 2000). In X. laevis, the eIF4G-PABP interaction was observed only in cells derived from adult tissues (Fraser et al., 1999). As there is no clear indication of an interaction between the endogenous PABP1 and eIF4F proteins, these results suggest that interaction does not exist during X. laevis oogenesis and early development. However, a functional PABP binding domain of eIF4G is critical for maturation (Wakiyama et al., 2000). The new ePABP is a good candidate to mediate cap-poly(A) dependent translation as it is efficiently expressed in oocytes and eggs. To test if Xenopus PABP(s) copurify with eIF4F, a cap affinity (7mGTP-Sepharose) column was loaded with RNAsetreated extracts from UFE supplemented with GTP (0.2 mM) to reduce non-specific adsorption (Stebbins-Boaz et al., 1999). After extensive washing, proteins were eluted first with 7mGTP (cap) or with GTP, and then with SDS. As expected, eIF4E and eIF4G were eluted specifically with 7m GTP (Fig. 3D, compare lanes 1 and 3). ePABP was also detected in the eluates from the column treated with 7mGTP (lane 1). We were not able to detect PABP1 by western blot in the eluate, possibly due to the sensitivity threshold, PABP1 is present in a lower amount in UFE extract than in ePABP. 7mGTP elution was incomplete as proteins that remained on the column were detected after boiling beads in SDS-containing buffer (lane 2). Cap-associated proteins are not eluted by GTP treatment (lane 3). These proteins were recovered in SDS (lane 4). No proteins were bound to the

control column (i.e., glutathione-sepharose column, lane 5) confirming that binding/washing conditions were selective and specific. Direct SDS elution was, therefore, used in further experiments. Chromatographs of both stage VI oocyte and UFE RNAse treated extracts allow the recovery of ePABP and eIF4G (Fig. 3E, lanes 3 and 6). For RNAse-untreated extracts, neither ePABP nor eIF4G were recovered on the column eluates (lanes 2 and 5). This indicates that initiation complexes should be released from cellular RNA in order to bind to the cap column and that ePABP interacts directly with the eIF4F complex without an RNA intermediate. No PABP1 was recovered on the cap column possibly because this protein is present in low amount in extracts or maybe it is not present in the complex. From this experiment, we conclude that ePABP is a capassociated protein that should be functional in translation reactions during early development. In yeast, sea urchin (Drawbridge et al., 1990) and plants (Le et al., 1997b), PABP is present as a multiple phosphorylated species. In plants, the phosphorylation state of PABP affects its interaction with poly(A) RNA and initiation factors (Le et al., 1997b). To determine if apparent electrophoretic mobility difference between ePABP and PABP1 in extracts could be due to phosphorylation, treatment of extracts with phosphatase lambda was done before SDSPAGE analysis and immunoblotting (Fig. 3F). Eg3, a Xenopus kinase present as multiple phosphorylated species in UFE was used as control for phosphatase treatment effectiveness. As previously shown (Blot et al., 2002), phosphatase treatment resulted in an electrophoretic mobil-

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

ity shift of Eg3 (Fig. 3F). For both PABP1 and ePABP, apparent electrophoretic mobility was not modified by phosphatase treatment. Even if not all phosphorylated proteins show aberrant migration in gels and that sensitivity to another class of phosphatase could not be strictly excluded, this result suggests that the difference of electromobility between ePABP and PABP1 is due to the intrinsic properties of the molecules. 3.5. Specific expression pattern of ePABP and PABP1 during early development Previous studies have shown that PABP1 protein was not present in oocytes and embryos before blastula stage embryos (Stambuk and Moon, 1992; Zelus et al., 1989). Wakiyama et al. have recently shown that a PABP was present in X. laevis stage VI oocyte since this protein can be efficiently coimmunoprecipitated with overexpressed human eIF4GI (Wakiyama et al., 2000). Given that the new ePABP was selected from an oocyte library, we next addressed the question of if the two PABPs are expressed separately or concomitantly during development. Extracts from oocytes, embryos or tissues from adult X. laevis frogs were prepared and submitted to immunoblot analyses. Antibodies raised against amino acids 315–499 of PABP1 (a gift from F. Braun) recognize both PABPs, in contrast to specific anti-ePABP or PABP1 sera (see Fig. 1B for description). Polyclonal antibodies to eRF1 were used as a loading control since the amount of this protein is constant from stage V of oogenesis until at least 22 h after fertilization (Tassan et al., 1993). As shown in Fig. 4A, ePABP is present during oogenesis and, in agreement with the recent results of Voeltz et al. (Voeltz et al., 2001), during early embryogenesis. At 48 h post-fertilization (PF), the ePABP signal decreases dramatically and becomes undetectable after 72 h. This protein was not detected in adult tissues (Fig. 5). We conclude that expression of ePABP is restricted to oogenesis and early development. Contrary to results published previously, PABP1 was detected during early oogenesis (Fig. 4A). Later, in oogenesis, only traces of PABP1 are detectable before maturation. PABP1 is synthesized during maturation (Fig. 4C). After fertilization, PABP1 remains stable in quantity up to the resumption of transcription (8 h post-fertilization, MidBlastula Transition (MBT)) when a dramatic increase of the amount of PABP1 begins and continues over the rest of the observed period of embryogenesis. PABP1 is detected in some adult tissues (brain, testis, lung, stomach, heart) and in XL2 cells (see Fig. 5). The ratio of PABP1 to total protein extracted varies among these tissues. For spleen, liver and skeletal muscle, the amount of PABP1 is below the sensitivity threshold of the western blot. Consequently, PABP1 appears to be a finely tuned protein during development and in adult tissues. The amount of PABP1 dramatically in creased during the development of the early embryo as was also observed earlier (Stambuk and Moon, 1992; Zelus

227

et al., 1989). Our detection of this protein in oocytes is the first demonstration of its expression at this stage of development. The low sensibility of the anti-PABP1 antibodies used in previous studies probably explains that PABP1 was not detected before the blastula stage of embryogenesis (Voeltz et al., 2001). A quantitative estimation of each PABP was performed by immunoblotting. Purified GST-ePABP and PABP1 were used as standard for western blots using anti-peptide antibodies directed against ePABP or PABP1. The amount used of these recombinant proteins gave signals that were within the linear range of the sera (data not shown). In an early embryo quantification essentially confirms previous results, namely, that 6 × 1010 molecules of PABP1 were present per embryo (Stambuk and Moon, 1992). We found around 2 × 1010 molecules of PABP1 present in a stage VI oocyte and around 8 × 1010 molecules of ePABP present in stage VI oocytes which slightly differed from the quantification of the Steitz group (Voeltz et al., 2001), who found 5 × 1011 molecules. As we added an additional extraction step compared to the Steitz group, we verified that this treatment did not decrease ePABP amount in extracts (see Fig. 4B, lower panel, compare lanes 10 and 11). Consequently, both PABP1 and ePABP should now be considered as major poly(A) binding proteins during oocyte maturation and early embryogenesis. Since poly(A) sites were estimated to be approximately to 2 × 1011 per stage VI oocyte (Sagata et al., 1980), it appears that PABPs are present at non-saturating levels during this period. Both PABP1 and ePABP are able to protect mRNAs—at least in vitro (Voeltz et al., 2001)—against default deadenylation that normally occurs during maturation after GVBD. We propose that this limiting quantity of PABPs is a prerequisite for translation regulation via poly(A) tail length control. This was suggested by the disruption of normal default deadenylation when PABP1 is overexpressed in moderate amounts in oocytes (Wormington et al., 1996). Given that cytoplasmic polyadenylation and deadenylation of specific mRNAs orchestrate a strict temporal pattern of maternal mRNA translation during maturation, we performed a time course experiment to monitor de novo synthesis of PABP1 during this period. Stage VI oocytes were incubated in OR2 medium containing progesterone in order to induce maturation in vitro. Oocytes were taken every 2 h and analyzed by western blotting (Fig. 4C). 50% germinal vesicule breakdown (GVBD) occur after 4 h of incubation in progesterone. PABP1 synthesis occurs very early during maturation as the signal increases from 2 to 6 h of incubation, and then remains constant until completion of maturation. In contrast, the amount of ePABP remains stable over this period. The early increase of PABP1 during maturation suggests that this protein could play an important role over this period of development. At the beginning of the maturation, PABPs are present at non-saturating levels, and no release of PABPs from the

228

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

Fig. 4. Expression profile of PABP1 and ePABP during oogenesis and embryogenesis. (A) Expression profile of PABPs during Xenopus laevis early development. Extracts from oocytes, eggs and embryos were prepared and 40 ug of total proteins were loaded in parallel on SDS-PAGE, and immunoblotted with anti-Xenopus PABPs antibodies as indicated on the left. The position of molecular weight markers is shown on the right. (B) Extracts corresponding to one oocyte, egg or embryo were prepared and loaded in parallel on SDS-PAGE. Recombinant proteins as indicated were also loaded in parallel or mix with extracts in order to quantify endogenous ePABP and PABP1. D – direct analysis, F – freon extraction. (C) Stage VI oocytes were incubated in OR2 medium containing progesterone in order to induce maturation. Extracts from maturating oocytes were treated as in panel A. The length of progesterone treatment was indicated above the blot. Oocytes incubated without progesterone (-Pg) were used as control.

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

229

Fig. 5. Western blot analysis of PABP1 and ePABP in adult tissues and cultured cells. The expression of PABPs in some X. laevis adult tissues and in XL2 cells was analyzed using specific antibodies (see Materials and methods). Samples were treated as in 4A. Anti-tubulin antibody was used to control sample load.

poly(A) tails is expected before default deadenylation that occurs after the germinal vesicle break down (GVBD). Specific mRNAs—such as c-mos mRNA—need to be unmasked at the beginning of maturation. The time at which synthesis of PABP1 occurs is consistent with its role in this process. The increase of PABP1 during embryogenesis to a high level marks the transition between early development and meiotic cycles, and adult life and mitotic cycles. During maturation, unmasking of specific mRNAs by poly(A) tail lengthening is a critical step for the resumption of meiosis (Barkoff et al., 1998). Unmasking is associated with mRNA polyadenylation (McGrew et al., 1989), and translation activation, correlated to poly(A) elongation, is probably mediated by the poly(A) binding protein (see Introduction). Consequently, a PABP is needed to mediate translation activation. The amount of ePABP associated with eIF4E and eIF4G increases in egg comparing with oocyte, while PABP1 remains undetectable (Fig. 3E). This increase of ePABP in translation initiation complexes suggests that the twofold increase in protein synthesis during maturation (Shih et al., 1978; Wasserman et al., 1982) involves ePABP rather than PABP1. Only traces of PABP1 are present in oocytes until maturation occurs, ePABP could ensure both binding to the short poly(A) tails of the silenced mRNAs and also act in the translation of active mRNAs during oogenesis as evidenced by its presence in eIF4F complex in oocyte (Fig. 3C). Possibly, PABP1 presence is not compatible with the masking process, and its synthesis de novo at the beginning of maturation is essential to the unmasking of specific mRNAs.

Acknowledgements We are very grateful to F. Braun, B.Lapeyre, F. Wyers, S. Hamon and F.Omilli for plasmids, yeast strains, proteins and antibodies; L.Paillard and V.Legagneux for the very helpful discussions and H.B. Osborne for critical reading of the manuscript. B.C. was supported by the ‘Ligue Nationale Contre le Cancer’ and ‘Fondation pour la Recherche Médicale’. This work was supported by a grant to M.P. from the Human Frontier Science Program (RG 0032/1997-M), G.Z., and M.P. from CNRS (PICS 1113), G.Z. and S.C. from RFBR (00-04-22001NCNI_a).

References Adam, S.A., Nakagawa, T., Swanson, M.S., Woodruff, T.K., Dreyfuss, G., 1986. mRna polyadenylate-binding protein: gene isolation and sequencing and identification of a ribonucleoprotein consensus sequence. Mol. Cell. Biol. 6, 2932–2943. Amrani, N., Minet, M., Le Gouar, M., Lacroute, F., Wyers, F., 1997. Yeast Pab1 interacts with Rna15 and participates in the control of the poly(A) tail length in vitro. Mol. Cell. Biol. 17, 3694–3701. Barkoff, A., Ballantyne, S., Wickens, M., 1998. Meiotic maturation in Xenopus requires polyadenylation of multiple mRNAs. Embo J. 17, 3168–3175. Belostotsky, D.A., Meagher, R.B., 1996. A pollen-, ovule-, and early embryo-specific poly(A) binding protein from Arabidopsis complements essential functions in yeast. Plant Cell 8, 1261–1275. Blot, J., Chartrain, I., Roghi, C., Philippe, M., Tassan, J.P., 2002. Cell cycle regulation of pEg3, a new Xenopus protein kinase of the KIN1/PAR1/MARK family. Dev. Biol. 241, 327–338.

230

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231

Boeke, J.D., Trueheart, J., Natsoulis, G., Fink, G.R., 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154, 164–175. Burd, C.G., Matunis, E.L., Dreyfuss, G., 1991. The multiple RNA-binding domains of the mRNA poly(A)-binding protein have different RNAbinding activities. Mol. Cell. Biol. 11, 3419–3424. Cosson, B., Couturier, A., Chabelskaya, S., Kiktev, D., Inge-Vechtomov, S., Philippe, M., Zhouravleva, G., 2002. Poly(A)-Binding Protein acts in translation termination via eRF3 interaction and does not influence [PSI+] propagation. Mol. Cell. Biol. 22, 3301–3315. Curtis, D., Lehmann, R., Zamore, P.D., 1995. Translational regulation in development. Cell 21, 171–178. Davidson, E.H., 1986. The Nature and Function of Maternal Transcripts, third ed. Academic Press, New York.. Dignam, J.D., 1990. Preparation of extracts from higher eukaryotes. Methods Enzymol. 182, 194–203. Drawbridge, J., Grainger, J.L., Winkler, M.M., 1990. Identification and characterization of the poly(A)-binding proteins from the sea urchin: a quantitative analysis. Mol. Cell. Biol. 10, 3994–4006. Feilotter, H.E., Hannon, G.J., Ruddell, C.J., Beach, D., 1994. Construction of an improved host strain for two-hybrid screening. Nucleic Acids Res. 22, 1502–1503. Fields, S., Song, O., 1989. A novel genetic system to detect protein-protein interactions. Nature 340, 245–246. Fraser, C.S., Pain, V.M., Morley, S.J., 1999. The association of initiation factor 4F with poly(A)-binding protein is enhanced in serum-stimulated Xenopus kidney cells. J. Biol. Chem. 274, 196–204. Gallie, D.R., Ling, J., Niepel, M., Morley, S.J., Pain, V.M., 2000. The role of 5-leader length, secondary structure and PABP concentration on cap and poly(A) tail function during translation in Xenopus oocytes. Nucleic Acids Res. 28, 2943–2953. Gietz, R.D., Schiestl, R.H., Willems, A.R., Woods, R.A., 1995. Studies on the transformation of intact yeast cells by the LiAc/SS- DNA/PEG procedure. Yeast 11, 355–360. Gray, N.K., Coller, J.M., Dickson, K.S., Wickens, M., 2000. Multiple portions of poly(A)-binding protein stimulate translation in vivo. Embo J. 19, 4723–4733. Harland, R., Misher, L., 1988. Stability of RNA in developing Xenopus embryos and identification of a destabilizing sequence in TFIIIA messenger RNA. Development 102, 837–852. Hoshino, S., Imai, M., Kobayashi, T., Uchida, N., Katada, T., 1999. The eukaryotic polypeptide chain releasing factor (eRF3/GSPT) carrying the translation termination signal to the 3-Poly(A) tail of mRNA. Direct association of erf3/GSPT with polyadenylate-binding protein. J. Biol. Chem. 274, 16677–16680. Iizuka, N., Najita, L., Franzusoff, A., Sarnow, P., 1994. Cap-dependent and Cap-independent translation by internal initiation of mRNAs in cell extracts prepared from Saccharomyces cerevisiae. Mol. Cell. Biol. 14, 7322–7330. Jacobson, A., Peltz, S.W., 1996. Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells. Annu. Rev. Biochem. 65, 693–739. Kozlov, G., Trempe, J.F., Khaleghpour, K., Kahvejian, A., Ekiel, I., Gehring, K., 2001. Structure and function of the C-terminal PABC domain of human poly(A)-binding protein. Proc. Natl. Acad. Sci. USA 98, 4409–4413. Kuge, H., Inoue, A., 1992. Maturation of Xenopus laevis Oocyte by Progesterone Requires Poly(A) Tail Elongation of mRNA. Exp. Cell Res. 202, 52–58. Le, H., Chang, S.C., Tanguay, R.L., Gallie, D.R., 1997. a. The wheat poly(A)-binding protein functionally complements pab1 in yeast. Eur. J. Biochem. 243, 350–357.

Le, H., Tanguay, R.L., Balasta, M.L., Wei, C.C., Browning, K.S., Metz, A.M., Goss, D.J., Gallie, D.R., 1997. b. Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity. J. Biol. Chem. 272, 16247–16255. Mangus, D.A., Amrani, N., Jacobson, A., 1998. Pbp1p, a factor interacting with saccharomyces cerevisiae Poly(A)- binding protein, regulates polyadenylation. Mol. Cell. Biol. 18, 7383–7396. McGrew, L.L., Dworkin-Rastl, E., Dworkin, M.B., Richter, J.D., 1989. Poly(A) elongation during Xenopus oocyte maturation is required for translational recruitment and is mediated by a short sequence element. Genes Dev. 3, 803–815. Merkulova, T.I., Frolova, L.Y., Lazar, M., Camonis, J., Kisselev, L.L., 1999. C-terminal domains of human translation termination factors eRF1 and eRF3 mediate their in vivo interaction. FEBS Lett. 443, 41–47. Minvielle-Sebastia, L., Preker, P.J., Wiederkehr, T., Strahm, Y., Keller, W., 1997. The major yeast poly(A)-binding protein is associated with cleavage factor IA and functions in premessenger RNA 3-end formation. Proc. Natl. Acad. Sci. USA 94, 7897–7902. Murray, A.W., Solomon, M.J., Kirschner, M.W., 1989. The role of cyclin synthesis and degradation in the control of maturation promoting factor activity. Nature (Lond) 339, 280–286. Newport, J., Kirschner, M., 1982. A major developmental transition in early Xenopus embryos: I. characterization and timing of cellular changes at the midblastula stage. Cell 30, 673–686. Nietfeld, W., Mentzel, H., Pieler, T., 1990. The Xenopus laevis poly(A) binding protein is composed of multiple functionally independent RNA binding domains. Embo J. 9, 3699–3705. Osborne, H.B., Richter, J.D., 1997. Translational control by polyadenylation during early development. Prog. Mol. Subcell. Biol. 18, 173–198. Pintard, L., Kressler, D., Lapeyre, B., 2000. Spb1p is a yeast nucleolar protein associated with Nop1p and Nop58p that is able to bind S-adenosyl-L-methionine in vitro. Mol. Cell. Biol. 20, 1370–1381. Sachs, A.B., Davis, R.W., Kornberg, R.D., 1987. A single domain of yeast poly(A)-binding protein is necessary and sufficient for RNA binding and cell viability. Mol. Cell. Biol. 7, 3268–3276. Sagata, N., Shiokawa, K., Yamana, K., 1980. A study on the steady-state population of Poly(A) + RNA during early development of Xenopus laevis. Dev. Biol. 77, 431–448. Sambrook, J., Russell, D.W., 2001. Molecular cloning: a laboratory manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schroeder, K.E., Yost, H.J., 1996. Xenopus poly (A) binding protein maternal RNA is localized during oogenesis and associated with large complexes in blastula. Dev. Genet. 19, 268–276. Sheets, M.D., Wu, M., Wickens, M., 1995. Polyadenylation of c-mos mRNA as a control point in Xenopus meiotic maturation. Nature 374, 511–516. Shih, R.J., O’Connor, C.M., Keem, K., Smith, L.D., 1978. Kinetic analysis of amino acid pools and protein synthesis in amphibian oocytes and embryos. Dev. Biol. 66, 172–182. Stambuk, R.A., Moon, R.T., 1992. Purification and characterization of recombinant Xenopus poly(A)(+)-binding protein expressed in a baculovirus system. Biochem. J. 287, 761–766. Stebbins-Boaz, B., Cao, Q., de Moor, C.H., Mendez, R., Richter, J.D., 1999. Maskin is a CPEB-associated factor that transiently interacts with eIF4E. Mol Cell 4, 1017–1027. Stebbins-Boaz, B., Hake, L.E., Richter, J.D., 1996. CPEB controls the cytoplasmic polyadenylation of cyclin, Cdk2 and c-mos mRNAs and is necessary for oocyte maturation in Xenopus. Embo J. 15, 2582–2592. Swiderski, R.E., Richter, J.D., 1988. Photocrosslinking of proteins to maternal mRNA in Xenopus oocytes. Dev. Biol. 128, 349–358.

B. Cosson et al. / Biology of the Cell 94 (2002) 217–231 Tarun Jr, S.Z., Sachs, A.B., 1995. A common function for mRNA 5 and 3 ends in translation initiation in yeast. Genes Dev. 9, 2997–3007. Tassan, J.P., Le Guellec, K., Kress, M., Faure, M., Camonis, J., Jacquet, M., Philippe, M., 1993. In Xenopus laevis, the product of a developmentally regulated mRNA is structurally and functionally homologous to a Saccharomyces cerevisiae protein involved in translation fidelity. Mol. Cell. Biol. 13, 2815–2821. Voeltz, G.K., Ongkasuwan, J., Standart, N., Steitz, J.A., 2001. A novel embryonic poly(A) binding protein, ePAB, regulates mRNA deadenylation in Xenopus egg extracts. Genes Dev. 15, 774–788. Wakiyama, M., Imataka, H., Sonenberg, N., 2000. Interaction of eIF4G with poly(A)-binding protein stimulates translation and is critical for Xenopus oocyte maturation. Curr. Biol. 10, 1147–1150. Wasserman, W.J., Richter, J.D., Smith, L.D., 1982. Protein synthesis during maturation promoting factor- and progesterone-induced maturation in Xenopus oocytes. Dev. Biol. 89, 152–158.

231

Wells, S.E., Hillner, P.E., Vale, R.D., Sachs, A.B., 1998. Circularization of mRNA by eukaryotic translation initiation factors. Mol. Cell. 2, 135–140. Wormington, M., Searfoss, A.M., Hurney, C.A., 1996. Overexpression of poly(A) binding protein prevents maturation-specific deadenylation and translational inactivation in Xenopus oocytes. Embo J. 15, 900–909. Xie, K., Lambie, E.J., Snyder, M., 1993. Nuclear dot antigens may specify transcriptional domains in the nucleus. Mol. Cell. Biol. 13, 6170–6179. Zelus, B.D., Giebelhaus, D.H., Eib, D.W., Kenner, K.A., Moon, R.T., 1989. Expression of the poly(A)-binding protein during development of Xenopus laevis. Mol. Cell. Biol. 9, 2756–2760. Zhouravleva, G., Frolova, L., Le Goff, X., Le Guellec, R., Inge-Vechtomov, S., Kisselev, L., Philippe, M., 1995. Termination of translation in eukaryotes is governed by two interacting polypeptide chain release factors, eRF1 and eRF3. Embo J. 14, 4065–4072.