- Email: [email protected]
Characterization of the swine U6 promoter for short hairpin RNA expression and its application to inhibition of virus replication
Journal of Biotechnology 168 (2013) 78–84
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Characterization of the swine U6 promoter for short hairpin RNA expression and its application to inhibition of virus replication Ching-Wei Wu a , Maw-Sheng Chien b , Chienjin Huang a,∗ a Graduate Institute of Microbiology and Public Health, College of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC b Graduate Institute of Veterinary Pathobiology, College of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC
a r t i c l e
i n f o
Article history: Received 18 April 2013 Received in revised form 8 July 2013 Accepted 10 July 2013 Available online 31 July 2013 Keywords: RNA interference Short hairpin RNAs U6 promoter Classical swine fever virus
a b s t r a c t Expression of short hairpin RNAs (shRNAs) by the RNA polymerase type III U6 promoter is an effective and widely used strategy for RNA interference (RNAi) which is a sequence-specific gene silencing mechanism. The U6 promoters from human, mouse, and swine were cloned, respectively for constructing various shRNA expression vectors. The transcription efficiency of each U6 promoter was analyzed for its activity to drive expression of shRNA targeting enhanced green fluorescent protein (EGFP) mRNA in different mammalian cells. All three U6 promoters were functional and the swine U6 promoter demonstrated the most efficient knockdown of EGFP synthesis in all these three species of cell lines including porcine kidney (PK-15), human embryonic kidney (HEK293T), and mouse fibroblast (LM) cells. Furthermore, the antiviral effect of shRNA targeting the classical swine fever virus (CSFV) NS5B driven by the swine U6 promoter was confirmed by the significant reduction of virus replication. © 2013 Elsevier B.V. All rights reserved.
1. Introduction RNA interference (RNAi) is a natural cellular process by which RNA duplexes known as short interfering RNA (siRNA) can reduce gene expression through mRNA targeting (Elbashir et al., 2001; Xia et al., 2002). RNAi has become a powerful biological tool for studying gene functions and fighting against viral diseases by targeting the mRNA of viral genes (Brummelkamp et al., 2002; Hamasaki et al., 2003; Daniel-Carlier et al., 2012). RNAi-mediated silencing is commonly achieved either by transfection of synthetic siRNA duplexes or DNA or viral vectors which express siRNA as short hairpin RNAs (shRNAs). The shRNA molecule is then further processed to become siRNA by cellular ribonuclease complexes (Taxman et al., 2006). Short interfering or short hairpin RNA synthesis systems in cells are most often driven by RNA polymerase III (pol III) promoters since the transcription efficiency of siRNA is high, resulting in uniform RNA molecules with defined 5 and 3 ends (Mäkinen et al., 2006; Henriksen et al., 2007). The typical pol III promoters contain a proximal sequence element (PSE), a TATA box, and a distal sequence element including an Oct-1 binding site (Jensen et al., 1998; Kunkel and Hixson, 1998). U6 promoters are most commonly
∗ Corresponding author. Tel.: +886 4 22853906; fax: +886 4 22851741. E-mail addresses: [email protected], [email protected] (C. Huang). 0168-1656/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jbiotec.2013.07.009
used in vector-based shRNA expression systems, and the currently commercially available shRNA expression vectors contain either the human or the murine U6 promoter (Nie et al., 2010; Roelz et al., 2010). For adaption and application of shRNA expression system for RNAi in pigs, the swine U6 promoter may be expected to be more efficient in swine cells. Therefore, we constructed various shRNA expression plasmids driven by the human, mouse, and swine U6 promoter, respectively, and further analyzed their activities to drive shRNA-mediated RNAi in different mammalian cell lines. The swine U6 promoter demonstrated better ability than the others to express the shRNA targeting enhanced green fluorescent protein (EGFP) mRNA, resulting in remarkable reduction of fluorescence. Expression of shRNA targeting the classical swine fever virus (CSFV) NS5B gene in the porcine kidney cells was also conducted for confirming the antiviral effect.
2. Materials and methods 2.1. Cells and virus Porcine kidney cell (PK-15), human embryonic kidney 293 cell (HEK 293T), and mouse fibroblast cells (LM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) containing 5% fetal bovine serum (Hyclone), 100 U/ml penicillin and 100 g/ml streptomycin at 37 ◦ C in a humidified 5% CO2 incubator. The stable EGFP-expressing PK-15 cell line was established by transfecting
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
79
Table 1 Sequences of oligonucleotides used for cloning the U6 promoters and detecting the CSFV viral RNA by real-time PCR. Oligonucleotide HU6 Forward primer Reverse primer MU6 Forward primer Reverse primer SU6 Forward primer Reverse primer NS5B Forward primer Reverse primer GAPDH Forward primer Reverse primer
Target genea
Sequence (5 –3 end)b
Human U6 promoter
ATAGATCTAAGGTCGGGCAGGAA TGAATTCGGTGTTTCGTCCTTTCC
Murine U6 promoter
ATAGATCTGATCCGACGCCGC TGAATTCAAACAAGGCTTTTCTCCAAG
Swine U6 promoter
ATAGATCTAGGAGGACTCCAGGGAC CTGAATTCGGGTCTTCTCAGAGG
CSFV NS5B gene
TGTCAGAAGTACCCGTAATCAGTG CCGTGGCCTCGCAGAAG
Swine GAPDH gene
GGCTGCCCAGAACATCATCC ACGCCTGCTTCACCACCTTC
a Target genes sequences for human U6, murine U6, and swine U6 promoters, as well as CSFV NS5B and swine GAPDH genes were referred to the GenBank accession nos. X07425.1, X06980.1, EU520423, AF352565.1, and NM 001206359.1, respectively. b The sequences recognized by the restriction enzyme BglII (AGATCT) and EcoRI (GAATTC) are underlined.
with the reporter plasmid pEGFP-N3 (Clontech), followed by selecting the stable transformant resistant to 500 g/ml G418 (Sigma). CSFV LPC vaccine strain was kindly provided by the Animal Health Research Institute, Council of Agriculture, Taiwan, ROC.
or 72 h post transfection using TRIADTM multimode plate reader (DYNEX) and photographed with a fluorescence microscope (Olympus). 2.5. Cell viability assays
2.2. Construction of shRNA expression vectors driven by human, mouse, or swine U6 promoter U6 promoters of human, mouse, and swine were cloned from HEK293T, LM, and PK-15 cells, respectively. The genomic DNA of each type of cells was extracted by QIAamp DNA Mini Kit (Qiagen), and then subjected to PCR amplification of each U6 promoter with the specific primer pair (Table 1). The BglII–EcoRI fragment of each U6 promoter was gel-purified and cloned into the expression vector pcDNA4/HisMax (Invitrogen) to replace its CMV promoter and generate the shRNA expression vectors driven by human U6 (pHU6), mouse U6 (pMU6), and swine U6 (pSU6) promoters, respectively. In addition, DNA fragments representing human U6 or swine U6 promoter with exchanged PSE motif were synthesized to replace the U6 promoter of pHU6 and generate plasmids pHU6pseS and pSU6pseH, respectively. 2.3. Construction of shRNA expressing plasmids targeting EGFP or CSFV NS5B gene The target sequence specific to the EGFP or CSFV NS5B gene was selected by the Thermo siDESIGN® Center or Invitrogen BLOCKiTTM RNAi Designer, and DNA oligonucleotides encoding the target shRNA (Table 2) were synthesized according to the methods described previously (Brummelkamp et al., 2002; Sui et al., 2002). The control shRNA (siC) comprised random sequences unrelated to the target gene or pig genome. The sense oligonucleotide was annealed with its antisense strand and then ligated to the EcoRI and XhoI sites of each shRNA expression vector to generate various shRNA-expressing plasmids targeting EGFP or CSFV NS5B driven by different species of U6 promoters (Fig. 1).
Cultured cells with 50% confluence in 96-well plates and transfected with 0.2 g of each shRNA-expressing plasmid, or treated with transfection reagent only or 2 mg/ml antibiotic Zeocin served as controls. After incubation for 48 h, cell proliferative responses were determined by WST-8 kit (Abnova) according to the manufacturer’s manual. 2.6. Western blot assay The transfected cell lysates were extracted using M-PER Mammalian Protein Extraction Reagent with HaltTM Protease Inhibitor Cocktail (Thermo Scientific), and equal volume of 2× sample buffer (125 mM Tris–Cl [pH 6.8], 20% glycerol, 4% SDS, 10% mercaptoethanol, 0.25% bromophenol blue) was added. Proteins were separated by 12% SDS-PAGE and transferred by electroblotting onto PolyScreen PVDF transfer membrane (Perkin Elmer) using a semi-dry transfer cell (Bio-Rad) according to the manufacturer’s manual. The membrane was then treated sequentially with phosphate buffer saline (PBS) containing 5% non-fat skim milk (blocking Table 2 List of shRNA sequences in this study.
shRNAa
Sequence (5’ end to 3’ end)b
siEGFP S
AATTCGGCACAAGCTGGAGTACAATTCAAGAGATTGTACTCCAGCT
siEGFP AS
TGTGCCTTTTTC TCGAGAAAAAGGCACAAGCTGGAGTACAATCTCTTGAATTGTACTC CAGCTTGTGCCG
siCSFV S
AATTCGAGAAGAAGCCTAGAGTTATTCAAGAGATAACTCTAGGCTT
siCSFV AS
CTTCTCTTTTTC TCGAGAAAAAGAGAAGAAGCCTAGAGTTATCTCTTGAATAACTCT AGGCTTCTTCTCG
2.4. Co-transfection of reporter and shRNA expressing plasmids Cultured cells with 50% confluence in 96-well plates were co-transfected with appropriated concentration of the reporter plasmid pEGFP-N3 and each shRNA-expressing plasmid using TurboFectTM in vitro Transfection Reagent (Thermo Scientific) in Opti-MEM medium (Gibco) according to the manufacturer’s manual. The inhibition efficacy of shRNA-expressing plasmid was analyzed by the intensity of remaining fluorescence at 24, 48,
siC S
AATTCGGACAGTGGGATGGATAGGTTCAAGAGACCTATCCATCCCA
siC AS
CTGTCCTTTTTC TCGAGAAAAAGGACAGTGGGATGGATAGGTCTCTTGAACCTATCC ATCCCACTGTCCG
a
S, sense strand; AS, antisense strand; C, control shRNA sequence. The shRNA target sequence in each target gene are underlined, and the sequences recognized by the restriction enzyme EcoRI (GAATTC) and XhoI (CTCGAG) are boxed. b
80
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
Fig. 1. Construction and schematic map of shRNA expression vectors. The shRNA cassette comprises the RNA polymerase III U6 promoter, a hairpin-forming sequence (two complimentary domains specific to the mRNA target separated by a loop), and a polythymidine tract to terminate transcripts. The alignment of swine U6 (SU6) and human U6 (HU6) promoters are shown and the predicted sites of TATA box, Oct and PSE motifs are boxed.
solution), with 1000-fold dilution of anti-EGFP or anti- actin antibody (Novus), and with 10,000-fold dilution of anti-mouse IgG goat antibody conjugated to horseradish peroxidase (Jackson). Finally, the signal was detected by chemiluminescence substrate (ECL reagent, Thermo Scientific) and visualized by autoradiography.
2.7. Real-time PCR PK-15 cells were transfected with 0.2 g pSU6siCSFV plasmid and incubated for 4 h. The transfected cells were washed once with DMEM and infected with 200 TCID50 of CSFV LPC strain. Total RNA
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
81
was extracted from the infected cells at 72 h post-infection using RNAzol reagent (Molecular Research Center) according to the manufacturer’s manual. The virus complementary DNA (cDNA) was first amplified by reverse transcription at 42 ◦ C for 60 min using RevertAidTM Premium First Strand cDNA Synthesis Kit with random primer (Thermo Scientific). The amplification of CSFV NS5B by realtime PCR was conducted using the Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific) with specific primer pairs listed in Table 1. 2.8. Indirect immunofluorescence assay CSFV-infected cells were washed three times with PBS followed by fixing with 4% paraformaldehyde for 10 min. After washing with PBS, the fixed cells were treated with PBS containing 0.25% Triton X-100 and 5% dimethyl sulfoxide (DMSO) for 10 min to increase the permeability of the cellular membrane. After washing with PBS, the cells were treated sequentially with blocking solution, with 1000fold dilution of monoclonal antibody (MAb) WH303 specific to CSFV E2 (Veterinary Laboratory Agency), respectively and with 1000-fold dilution of Alexa 488-conjugated goat anti-mouse IgG (Invitrogen). The cells were visualized with Olympus IX 70 phase-contrast fluorescence microscope. 2.9. Statistical analysis All numerical parameters, including fluorescence unit, relative fluorescence or CSFV RNAs, are expressed as the mean ± 1 standard deviation. Student’s t-test was used for the analysis of numeric parameters (GraphPad Prism, Version 5.0) and calculation of p values. All differences were considered significant at p value of <0.05 (*), <0.01 (**), and <0.001 (***), respectively.
3. Results 3.1. Efficiency analysis of shRNA expression vectors driven by different U6 promoters The type III RNA polymerase U6 promoter of swine, human, and mouse were cloned from PK-15, HEK293T, and LM cells, respectively, for further constructing shRNA expression vectors pSU6, pHU6, and pMU6, respectively (Fig. 1). The expression efficiency of these vectors was analyzed in terms of their ability to drive expression of EGFP shRNA, thus inhibiting synthesis of EGFP. First, 0.2 g reporter pEGFP-N3 and pSU6siEGFP mixtures of various compositions were co-tranfected into PK-15 cells, and the intensities of fluorescence were determined at 24, 48, and 72 h posttransfection. The intensity of EGFP in the pEGFP-N3 transfected cells increased gradually but remarkable inhibition was demonstrated in the co-transfected cells in the presence of as little as 0.05 g pSU6siEGFP (Fig. 2). The activity of swine U6 promoter was further compared with human and mouse U6 promoters in three different types of cells. All three species of U6 promoters could efficiently drive expression of EGFP shRNA in all types of cells, and the swine U6 promoter demonstrated the best efficacy (Fig. 3). All shRNA expressing-plasmids transfected cells did not show cytotoxic effects when compared with those transfected with transfection reagent only (data not shown). Furthermore, the siRNA effect on intracellular protein was examined by transfecting 0.2 g each EGFP shRNA-expressing plasmid into the stable EGFP-expressing PK-15 cells. Similar result was obtained as the cotransfection experiment. The percentages of EGFP reduction were 79%, 62%, and 56% for pSU6siEGFP, pHU6siEGFP, and pMU6siEGFP, respectively (Fig. 4A). The swine U6 promoter also showed the
Fig. 2. Expression activity of pSU6 vector. The efficiency of swine U6 promoter was analyzed by its ability to drive expression of EGFP shRNA and knock down synthesis of EGFP in PK-15 cells co-transfected with pEGFP-N3 and pSU6siEGFP. The fluorescence intensity was determined at 24, 48, and 72 h post-transfection, respectively.
greatest activity, leading to knockdown of EGFP synthesis, which was further confirmed by Western blot assay (Fig. 4B). 3.2. Enhancement of efficiency of human U6 promoter by PSE motif of swine U6 promoter in PK-15 cells Two EGFP shRNA expressing-plasmids, pHU6pseSsiEGFP and pSU6pseHsiEGFP, driven by the human or swine U6 promoter with exchanged PSE motif were constructed, and the promoter activity was analyzed by co-transfection experiment. Both PSE motif-exchanged U6 promoters demonstrated no apparent difference between their native forms in the transfected HEK293T cells (Fig. 5A). However, the efficiency of human U6 promoter could be significantly enhanced when the PSE motif was replaced with the swine motif in the transfected PK-15 cells (Fig. 5B). 3.3. Inhibition of CSFV replication in PK-15 cells by shRNA-expressing plasmid targeting NS5B gene The CSFV NS5B shRNA expressing plasmid, pSU6siCSFV, was transfected into PK-15 cells followed by CSFV infection, and the antiviral effect of NS5B siRNA on inhibition of virus replication was analyzed at 72 h post-infection by real-time PCR and IFA. The relative viral RNA was significantly decreased by 90.7% in pSU6siCSFV-transfected cells according to real-time PCR analysis (Fig. 6A), and only few viral protein-expressing cells could be detected by IFA (Fig. 6B). 4. Discussion Currently commercially available shRNA expression vectors contain either human or mouse U6 promoter. Pig is an important livestock animal and an useful model for biomedical researches. Construction of a shRNA expression vector driven by the swine U6 promoter may offer more efficient strategies for antiviral researches and gene function studies on pigs. Three recombinant shRNA expression vectors, pHU6, pMU6, and pSU6, which were respectively driven by the human, mouse, and swine U6 promoters, were successfully constructed. The transcription efficiency of swine U6 promoter was evaluated in term of its inhibition of EGFP synthesis due to expression of EGFP shRNA. A very small amount (0.05 g) of pSU6siEGFP-transfected PK-15 cells could efficiently knock down EGFP synthesis, indicating the high strength of swine U6 promoter (Fig. 2). The swine U6 promoter also revealed the best
82
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
Fig. 3. Comparison of U6 promoter activities for expressing EGFP shRNA in different type of cells. EGFP shRNA (siEGFP) expressing plasmid driven respectively by swine (SU6), human (HU6), and mouse (MU6) U6 promoters (0.1 g of each) were co-transfected with 0.1 g reporter pEGFP-N3 into PK-15 (A), HEK293T (B), and LM (C) cells, respectively. The relative fluorescence intensities were determined at 48 h post-transfection, and the average fluorescence intensities in the control shRNA (siC) driven by each U6 promoter were recorded as 100%.
efficacy when further compared with human and mouse U6 promoters in three different mammalian cell lines (Fig. 3), even in the chicken embryo fibroblast (DF-1) cell (data not shown). Roelz et al. (2010) have demonstrated that the human U6 promoter is more efficient than the mouse homologue for shRNA expression from a lentiviral vector in both human and murine cells. Our results also showed that the mouse U6 promoter was the least efficient. In contrast, the best performance of swine U6 promoter certainly expands
its potential utilization on the design and construction of shRNA vectors. Alignment of both swine and human U6 promoters revealed completely conserved Oct motif and TATA box but only 55.6% homology in the PSE motif (Fig. 1). The PSE has been shown to act as a dominant determinant for recruiting RNA pol III to U6 promoter and to play a major role in establishing the RNA polymerase specificity of Drosophila U-snRNA genes (Yoon et al., 1995; Jensen
Fig. 4. Knockdown expression of intracellular EGFP by transfection with each EGFP shRNA-expressing plasmid. EGFP shRNA (siEGFP) expressing plasmids driven respectively by swine (SU6), human (HU6), and mouse (MU6) U6 promoters (0.2 g of each) were transfected into EGFP-expressing PK-15 cells. The relative fluorescence intensities were determined at 48 h post-transfection (A) and the intracellular expressed EGFP was detected by Western blot assay (B).
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
83
Fig. 5. Comparison of promoter activities between swine and human U6 promoters with exchanged PSE motif. EGFP shRNA (siEGFP) expressing plasmids driven respectively by swine U6 (SU6), human U6 (HU6), SU6 with human PSE (SU6pseH), and HU6 with swine PSE (HU6pseS) promoters (0.1 g of each) were co-transfected with 0.1 g pEGFP-N3 into HEK293T (A) or PK-15 (B), and the relative fluorescence intensities were determined at 48 h post-transfection.
et al., 1998). When the human U6 promoter was modified with the swine PSE motif (HU6pseS), the activity was significantly enhanced in the swine PK-15 cell but not in the human HEK293T cell (Fig. 5), further confirming the important role of PSE motif in specificity determination. RNA interference is a sequence-specific gene silencing mechanism which has been employed successfully to inhibit the virus replication both in vitro (Hamasaki et al., 2003; Xu et al., 2008; Kim et al., 2010) and in vivo (Daniel-Carlier et al., 2012). Classical swine fever (CSF) caused by the CSFV is a highly contagious swine disease resulting in large economic losses worldwide (Lin et al., 2009). The CSFV NS5B gene encodes the RNA-dependent RNA polymerase responsible for viral RNA replication; and transfection of siRNA targeting to NS5B, which was prepared by in vitro transcription has demonstrated a 76.5% reduction in CSFV replication in PK-15 cells (Xu et al., 2008). Our result also revealed that the shRNA expressed by the vector pSU6 and targeting slightly more downstream NS5B region could mediate efficient RNAi in reducing CSFV replication by 90.7%. In conclusion, the swine U6 promoter is stronger than the human or mouse homologue and can efficiently mediate RNA interference in these three different species of mammalian cell lines. The shRNA expression vector driven by the swine U6 promoter might be widely used for vector-based RNAi-induced
Fig. 6. Inhibition of CSFV replication induced by shRNA targeting NS5B gene. The CSFV NS5B (siCSFV) or control (siC) shRNA expressing plasmid (0.2 g of each) was transfected into PK-15 cells followed by CSFV infection at 4 h post-transfection. The relative viral RNA compared with GAPDH RNAs was determined by real-time PCR (A), and the expressed viral proteins were detected by IFA (B) at 72 h post-infection.
gene silencing, especially to inhibit replication of other important swine viruses or production of transgenic animals in pig species.
Acknowledgement This work was supported in part by a grant 101AS-6.3.2-BQB2 from the Bureau of Animal and Plant Health Inspection and Quarantine, Council of Agriculture, Taiwan, ROC.
References Brummelkamp, T.R., Bernards, R., Agami, R., 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550–553. Daniel-Carlier, N., Sawafta, A., Passet, B., Thépot, D., Leroux-Coyau, M., Lefèvre, F., Houdebine, L.M., Jolivet, G., 2012. Viral infection resistance conferred on mice by siRNA transgenesis. Transgenic Research, http://dx.doi.org/10.1007/s11248-012-9649-4. Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., Tuschl, T., 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494–498. Hamasaki, K., Nakao, K., Matsumoto, K., Ichikawa, T., Ichikawa, H., Eguchi, K., 2003. Short interfering RNA-directed inhibition of hepatitis B virus replication. FEBS Letters 543, 51–54. Henriksen, J.R., Løkke, C., Hammerø, M., Geerts, D., Versteeg, R., Flægstad, T., Einvik, C., 2007. Comparison of RNAi efficiency mediated by tetracycline-responsive H1 and U6 promoter variants in mammalian cell lines. Nucleic Acid Research 35, e67. Jensen, R.C., Wang, Y., Hardin, S.B., Stumph, W.E., 1998. The proximal sequence element (PSE) plays a major role in establishing the RNA polymerase specificity of Drosophila U-snRNA genes. Nucleic Acid Research 26, 616–622. Kim, S.M., Lee, K.N., Lee, S.J., Ko, Y.J., Lee, H.S., Kweon, C.H., Kim, H.S., Park, J.H., 2010. Multiple shRNAs driven by U6 and CMV promoter enhances efficiency of antiviral effects against foot-and-mouth disease virus. Antiviral Research 87, 307–317. Kunkel, G.R., Hixson, J.D., 1998. The distal elements, OCT and SPH, stimulate the formation of preinitiation complexes on a human U6 snRNA gene promoter in vitro. Nucleic Acid Research 26, 1536–1543. Lin, G.J., Liu, T.Y., Tseng, Y.Y., Chen, Z.W., You, C.C., Hsuan, S.L., Chien, M.S., Huang, C., 2009. Yeast-expressed classical swine fever virus glycoprotein E2 induces a protective immune response. Veterinary Microbiology 139, 369–374. Mäkinen, P.I., Koponen, J.K., Kärkkäinen, A.M., Malm, T.M., Pulkkinen, K.H., Koistinaho, J., Turunen, M.P., Ylä-Herttuala, S., 2006. Stable RNA interference: comparison of U6 and H1 promoters in endothelial cells and in mouse brain. Journal of Gene Medicine 8, 433–441. Nie, L., Thakur, M.D., Wang, Y., Su, Q., Zhao, Y., Feng, Y., 2010. Regulation of U6 promoter activity by transcriptional interference in viral vector-based RNAi. Genomics Proteomics Bioinformatics 8, 170–179. Roelz, R., Pilz, I.H., Mutschler, M., Pahl, H.L., 2010. Of mice and men: human RNA polymerase III promoter U6 is more efficient than its murine homologue for shRNA expression from a lentiviral vector in both human and murine progenitor cells. Experimental Hematology 38, 792–797. Sui, G., Soohoo, C., Affar, E.B., Gay, F., Shi, Y., Forrester, W.C., Shi, Y., 2002. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proceedings of the National Academy of Sciences of the United States of America 99, 5515–5520. Taxman, D.J., Livingstone, L.R., Zhang, J., Conti, B.J., Iocca, H.A., Williams, K.L., Lich, J.D., Ting, J.P.Y., Reed, W., 2006. Criteria for effective design, construction, and gene knockdown by shRNA vectors. BMC Biotechnology 6, 7.
84
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
Yoon, J.B., Murphy, S., Bai, L., Wang, Z., Roeder, R.G., 1995. Proximal sequence element-binding transcription factor (PTF) is a multisubunit complex required for transcription of both RNA polymerase II- and RNA polymerase IIIdependent small nuclear RNA genes. Molecular and Cellular Biology 15, 2019–2027.
Xia, H., Mao, Q., Paulson, H.L., Davidson, B.L., 2002. siRNA-mediated gene silencing in vitro and in vivo. Nature Biotechnology 20, 1006–1010. Xu, X., Guo, H., Xiao, C., Zha, Y., Shi, Z., Xia, X., Tu, C., 2008. In vitro inhibition of classical swine fever virus replication by siRNAs targeting Npro and NS5B genes. Antiviral Research 78, 188–193.
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Characterization of the swine U6 promoter for short hairpin RNA expression and its application to inhibition of virus replication Ching-Wei Wu a , Maw-Sheng Chien b , Chienjin Huang a,∗ a Graduate Institute of Microbiology and Public Health, College of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC b Graduate Institute of Veterinary Pathobiology, College of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC
a r t i c l e
i n f o
Article history: Received 18 April 2013 Received in revised form 8 July 2013 Accepted 10 July 2013 Available online 31 July 2013 Keywords: RNA interference Short hairpin RNAs U6 promoter Classical swine fever virus
a b s t r a c t Expression of short hairpin RNAs (shRNAs) by the RNA polymerase type III U6 promoter is an effective and widely used strategy for RNA interference (RNAi) which is a sequence-specific gene silencing mechanism. The U6 promoters from human, mouse, and swine were cloned, respectively for constructing various shRNA expression vectors. The transcription efficiency of each U6 promoter was analyzed for its activity to drive expression of shRNA targeting enhanced green fluorescent protein (EGFP) mRNA in different mammalian cells. All three U6 promoters were functional and the swine U6 promoter demonstrated the most efficient knockdown of EGFP synthesis in all these three species of cell lines including porcine kidney (PK-15), human embryonic kidney (HEK293T), and mouse fibroblast (LM) cells. Furthermore, the antiviral effect of shRNA targeting the classical swine fever virus (CSFV) NS5B driven by the swine U6 promoter was confirmed by the significant reduction of virus replication. © 2013 Elsevier B.V. All rights reserved.
1. Introduction RNA interference (RNAi) is a natural cellular process by which RNA duplexes known as short interfering RNA (siRNA) can reduce gene expression through mRNA targeting (Elbashir et al., 2001; Xia et al., 2002). RNAi has become a powerful biological tool for studying gene functions and fighting against viral diseases by targeting the mRNA of viral genes (Brummelkamp et al., 2002; Hamasaki et al., 2003; Daniel-Carlier et al., 2012). RNAi-mediated silencing is commonly achieved either by transfection of synthetic siRNA duplexes or DNA or viral vectors which express siRNA as short hairpin RNAs (shRNAs). The shRNA molecule is then further processed to become siRNA by cellular ribonuclease complexes (Taxman et al., 2006). Short interfering or short hairpin RNA synthesis systems in cells are most often driven by RNA polymerase III (pol III) promoters since the transcription efficiency of siRNA is high, resulting in uniform RNA molecules with defined 5 and 3 ends (Mäkinen et al., 2006; Henriksen et al., 2007). The typical pol III promoters contain a proximal sequence element (PSE), a TATA box, and a distal sequence element including an Oct-1 binding site (Jensen et al., 1998; Kunkel and Hixson, 1998). U6 promoters are most commonly
∗ Corresponding author. Tel.: +886 4 22853906; fax: +886 4 22851741. E-mail addresses: [email protected], [email protected] (C. Huang). 0168-1656/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jbiotec.2013.07.009
used in vector-based shRNA expression systems, and the currently commercially available shRNA expression vectors contain either the human or the murine U6 promoter (Nie et al., 2010; Roelz et al., 2010). For adaption and application of shRNA expression system for RNAi in pigs, the swine U6 promoter may be expected to be more efficient in swine cells. Therefore, we constructed various shRNA expression plasmids driven by the human, mouse, and swine U6 promoter, respectively, and further analyzed their activities to drive shRNA-mediated RNAi in different mammalian cell lines. The swine U6 promoter demonstrated better ability than the others to express the shRNA targeting enhanced green fluorescent protein (EGFP) mRNA, resulting in remarkable reduction of fluorescence. Expression of shRNA targeting the classical swine fever virus (CSFV) NS5B gene in the porcine kidney cells was also conducted for confirming the antiviral effect.
2. Materials and methods 2.1. Cells and virus Porcine kidney cell (PK-15), human embryonic kidney 293 cell (HEK 293T), and mouse fibroblast cells (LM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) containing 5% fetal bovine serum (Hyclone), 100 U/ml penicillin and 100 g/ml streptomycin at 37 ◦ C in a humidified 5% CO2 incubator. The stable EGFP-expressing PK-15 cell line was established by transfecting
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
79
Table 1 Sequences of oligonucleotides used for cloning the U6 promoters and detecting the CSFV viral RNA by real-time PCR. Oligonucleotide HU6 Forward primer Reverse primer MU6 Forward primer Reverse primer SU6 Forward primer Reverse primer NS5B Forward primer Reverse primer GAPDH Forward primer Reverse primer
Target genea
Sequence (5 –3 end)b
Human U6 promoter
ATAGATCTAAGGTCGGGCAGGAA TGAATTCGGTGTTTCGTCCTTTCC
Murine U6 promoter
ATAGATCTGATCCGACGCCGC TGAATTCAAACAAGGCTTTTCTCCAAG
Swine U6 promoter
ATAGATCTAGGAGGACTCCAGGGAC CTGAATTCGGGTCTTCTCAGAGG
CSFV NS5B gene
TGTCAGAAGTACCCGTAATCAGTG CCGTGGCCTCGCAGAAG
Swine GAPDH gene
GGCTGCCCAGAACATCATCC ACGCCTGCTTCACCACCTTC
a Target genes sequences for human U6, murine U6, and swine U6 promoters, as well as CSFV NS5B and swine GAPDH genes were referred to the GenBank accession nos. X07425.1, X06980.1, EU520423, AF352565.1, and NM 001206359.1, respectively. b The sequences recognized by the restriction enzyme BglII (AGATCT) and EcoRI (GAATTC) are underlined.
with the reporter plasmid pEGFP-N3 (Clontech), followed by selecting the stable transformant resistant to 500 g/ml G418 (Sigma). CSFV LPC vaccine strain was kindly provided by the Animal Health Research Institute, Council of Agriculture, Taiwan, ROC.
or 72 h post transfection using TRIADTM multimode plate reader (DYNEX) and photographed with a fluorescence microscope (Olympus). 2.5. Cell viability assays
2.2. Construction of shRNA expression vectors driven by human, mouse, or swine U6 promoter U6 promoters of human, mouse, and swine were cloned from HEK293T, LM, and PK-15 cells, respectively. The genomic DNA of each type of cells was extracted by QIAamp DNA Mini Kit (Qiagen), and then subjected to PCR amplification of each U6 promoter with the specific primer pair (Table 1). The BglII–EcoRI fragment of each U6 promoter was gel-purified and cloned into the expression vector pcDNA4/HisMax (Invitrogen) to replace its CMV promoter and generate the shRNA expression vectors driven by human U6 (pHU6), mouse U6 (pMU6), and swine U6 (pSU6) promoters, respectively. In addition, DNA fragments representing human U6 or swine U6 promoter with exchanged PSE motif were synthesized to replace the U6 promoter of pHU6 and generate plasmids pHU6pseS and pSU6pseH, respectively. 2.3. Construction of shRNA expressing plasmids targeting EGFP or CSFV NS5B gene The target sequence specific to the EGFP or CSFV NS5B gene was selected by the Thermo siDESIGN® Center or Invitrogen BLOCKiTTM RNAi Designer, and DNA oligonucleotides encoding the target shRNA (Table 2) were synthesized according to the methods described previously (Brummelkamp et al., 2002; Sui et al., 2002). The control shRNA (siC) comprised random sequences unrelated to the target gene or pig genome. The sense oligonucleotide was annealed with its antisense strand and then ligated to the EcoRI and XhoI sites of each shRNA expression vector to generate various shRNA-expressing plasmids targeting EGFP or CSFV NS5B driven by different species of U6 promoters (Fig. 1).
Cultured cells with 50% confluence in 96-well plates and transfected with 0.2 g of each shRNA-expressing plasmid, or treated with transfection reagent only or 2 mg/ml antibiotic Zeocin served as controls. After incubation for 48 h, cell proliferative responses were determined by WST-8 kit (Abnova) according to the manufacturer’s manual. 2.6. Western blot assay The transfected cell lysates were extracted using M-PER Mammalian Protein Extraction Reagent with HaltTM Protease Inhibitor Cocktail (Thermo Scientific), and equal volume of 2× sample buffer (125 mM Tris–Cl [pH 6.8], 20% glycerol, 4% SDS, 10% mercaptoethanol, 0.25% bromophenol blue) was added. Proteins were separated by 12% SDS-PAGE and transferred by electroblotting onto PolyScreen PVDF transfer membrane (Perkin Elmer) using a semi-dry transfer cell (Bio-Rad) according to the manufacturer’s manual. The membrane was then treated sequentially with phosphate buffer saline (PBS) containing 5% non-fat skim milk (blocking Table 2 List of shRNA sequences in this study.
shRNAa
Sequence (5’ end to 3’ end)b
siEGFP S
AATTCGGCACAAGCTGGAGTACAATTCAAGAGATTGTACTCCAGCT
siEGFP AS
TGTGCCTTTTTC TCGAGAAAAAGGCACAAGCTGGAGTACAATCTCTTGAATTGTACTC CAGCTTGTGCCG
siCSFV S
AATTCGAGAAGAAGCCTAGAGTTATTCAAGAGATAACTCTAGGCTT
siCSFV AS
CTTCTCTTTTTC TCGAGAAAAAGAGAAGAAGCCTAGAGTTATCTCTTGAATAACTCT AGGCTTCTTCTCG
2.4. Co-transfection of reporter and shRNA expressing plasmids Cultured cells with 50% confluence in 96-well plates were co-transfected with appropriated concentration of the reporter plasmid pEGFP-N3 and each shRNA-expressing plasmid using TurboFectTM in vitro Transfection Reagent (Thermo Scientific) in Opti-MEM medium (Gibco) according to the manufacturer’s manual. The inhibition efficacy of shRNA-expressing plasmid was analyzed by the intensity of remaining fluorescence at 24, 48,
siC S
AATTCGGACAGTGGGATGGATAGGTTCAAGAGACCTATCCATCCCA
siC AS
CTGTCCTTTTTC TCGAGAAAAAGGACAGTGGGATGGATAGGTCTCTTGAACCTATCC ATCCCACTGTCCG
a
S, sense strand; AS, antisense strand; C, control shRNA sequence. The shRNA target sequence in each target gene are underlined, and the sequences recognized by the restriction enzyme EcoRI (GAATTC) and XhoI (CTCGAG) are boxed. b
80
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
Fig. 1. Construction and schematic map of shRNA expression vectors. The shRNA cassette comprises the RNA polymerase III U6 promoter, a hairpin-forming sequence (two complimentary domains specific to the mRNA target separated by a loop), and a polythymidine tract to terminate transcripts. The alignment of swine U6 (SU6) and human U6 (HU6) promoters are shown and the predicted sites of TATA box, Oct and PSE motifs are boxed.
solution), with 1000-fold dilution of anti-EGFP or anti- actin antibody (Novus), and with 10,000-fold dilution of anti-mouse IgG goat antibody conjugated to horseradish peroxidase (Jackson). Finally, the signal was detected by chemiluminescence substrate (ECL reagent, Thermo Scientific) and visualized by autoradiography.
2.7. Real-time PCR PK-15 cells were transfected with 0.2 g pSU6siCSFV plasmid and incubated for 4 h. The transfected cells were washed once with DMEM and infected with 200 TCID50 of CSFV LPC strain. Total RNA
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
81
was extracted from the infected cells at 72 h post-infection using RNAzol reagent (Molecular Research Center) according to the manufacturer’s manual. The virus complementary DNA (cDNA) was first amplified by reverse transcription at 42 ◦ C for 60 min using RevertAidTM Premium First Strand cDNA Synthesis Kit with random primer (Thermo Scientific). The amplification of CSFV NS5B by realtime PCR was conducted using the Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific) with specific primer pairs listed in Table 1. 2.8. Indirect immunofluorescence assay CSFV-infected cells were washed three times with PBS followed by fixing with 4% paraformaldehyde for 10 min. After washing with PBS, the fixed cells were treated with PBS containing 0.25% Triton X-100 and 5% dimethyl sulfoxide (DMSO) for 10 min to increase the permeability of the cellular membrane. After washing with PBS, the cells were treated sequentially with blocking solution, with 1000fold dilution of monoclonal antibody (MAb) WH303 specific to CSFV E2 (Veterinary Laboratory Agency), respectively and with 1000-fold dilution of Alexa 488-conjugated goat anti-mouse IgG (Invitrogen). The cells were visualized with Olympus IX 70 phase-contrast fluorescence microscope. 2.9. Statistical analysis All numerical parameters, including fluorescence unit, relative fluorescence or CSFV RNAs, are expressed as the mean ± 1 standard deviation. Student’s t-test was used for the analysis of numeric parameters (GraphPad Prism, Version 5.0) and calculation of p values. All differences were considered significant at p value of <0.05 (*), <0.01 (**), and <0.001 (***), respectively.
3. Results 3.1. Efficiency analysis of shRNA expression vectors driven by different U6 promoters The type III RNA polymerase U6 promoter of swine, human, and mouse were cloned from PK-15, HEK293T, and LM cells, respectively, for further constructing shRNA expression vectors pSU6, pHU6, and pMU6, respectively (Fig. 1). The expression efficiency of these vectors was analyzed in terms of their ability to drive expression of EGFP shRNA, thus inhibiting synthesis of EGFP. First, 0.2 g reporter pEGFP-N3 and pSU6siEGFP mixtures of various compositions were co-tranfected into PK-15 cells, and the intensities of fluorescence were determined at 24, 48, and 72 h posttransfection. The intensity of EGFP in the pEGFP-N3 transfected cells increased gradually but remarkable inhibition was demonstrated in the co-transfected cells in the presence of as little as 0.05 g pSU6siEGFP (Fig. 2). The activity of swine U6 promoter was further compared with human and mouse U6 promoters in three different types of cells. All three species of U6 promoters could efficiently drive expression of EGFP shRNA in all types of cells, and the swine U6 promoter demonstrated the best efficacy (Fig. 3). All shRNA expressing-plasmids transfected cells did not show cytotoxic effects when compared with those transfected with transfection reagent only (data not shown). Furthermore, the siRNA effect on intracellular protein was examined by transfecting 0.2 g each EGFP shRNA-expressing plasmid into the stable EGFP-expressing PK-15 cells. Similar result was obtained as the cotransfection experiment. The percentages of EGFP reduction were 79%, 62%, and 56% for pSU6siEGFP, pHU6siEGFP, and pMU6siEGFP, respectively (Fig. 4A). The swine U6 promoter also showed the
Fig. 2. Expression activity of pSU6 vector. The efficiency of swine U6 promoter was analyzed by its ability to drive expression of EGFP shRNA and knock down synthesis of EGFP in PK-15 cells co-transfected with pEGFP-N3 and pSU6siEGFP. The fluorescence intensity was determined at 24, 48, and 72 h post-transfection, respectively.
greatest activity, leading to knockdown of EGFP synthesis, which was further confirmed by Western blot assay (Fig. 4B). 3.2. Enhancement of efficiency of human U6 promoter by PSE motif of swine U6 promoter in PK-15 cells Two EGFP shRNA expressing-plasmids, pHU6pseSsiEGFP and pSU6pseHsiEGFP, driven by the human or swine U6 promoter with exchanged PSE motif were constructed, and the promoter activity was analyzed by co-transfection experiment. Both PSE motif-exchanged U6 promoters demonstrated no apparent difference between their native forms in the transfected HEK293T cells (Fig. 5A). However, the efficiency of human U6 promoter could be significantly enhanced when the PSE motif was replaced with the swine motif in the transfected PK-15 cells (Fig. 5B). 3.3. Inhibition of CSFV replication in PK-15 cells by shRNA-expressing plasmid targeting NS5B gene The CSFV NS5B shRNA expressing plasmid, pSU6siCSFV, was transfected into PK-15 cells followed by CSFV infection, and the antiviral effect of NS5B siRNA on inhibition of virus replication was analyzed at 72 h post-infection by real-time PCR and IFA. The relative viral RNA was significantly decreased by 90.7% in pSU6siCSFV-transfected cells according to real-time PCR analysis (Fig. 6A), and only few viral protein-expressing cells could be detected by IFA (Fig. 6B). 4. Discussion Currently commercially available shRNA expression vectors contain either human or mouse U6 promoter. Pig is an important livestock animal and an useful model for biomedical researches. Construction of a shRNA expression vector driven by the swine U6 promoter may offer more efficient strategies for antiviral researches and gene function studies on pigs. Three recombinant shRNA expression vectors, pHU6, pMU6, and pSU6, which were respectively driven by the human, mouse, and swine U6 promoters, were successfully constructed. The transcription efficiency of swine U6 promoter was evaluated in term of its inhibition of EGFP synthesis due to expression of EGFP shRNA. A very small amount (0.05 g) of pSU6siEGFP-transfected PK-15 cells could efficiently knock down EGFP synthesis, indicating the high strength of swine U6 promoter (Fig. 2). The swine U6 promoter also revealed the best
82
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
Fig. 3. Comparison of U6 promoter activities for expressing EGFP shRNA in different type of cells. EGFP shRNA (siEGFP) expressing plasmid driven respectively by swine (SU6), human (HU6), and mouse (MU6) U6 promoters (0.1 g of each) were co-transfected with 0.1 g reporter pEGFP-N3 into PK-15 (A), HEK293T (B), and LM (C) cells, respectively. The relative fluorescence intensities were determined at 48 h post-transfection, and the average fluorescence intensities in the control shRNA (siC) driven by each U6 promoter were recorded as 100%.
efficacy when further compared with human and mouse U6 promoters in three different mammalian cell lines (Fig. 3), even in the chicken embryo fibroblast (DF-1) cell (data not shown). Roelz et al. (2010) have demonstrated that the human U6 promoter is more efficient than the mouse homologue for shRNA expression from a lentiviral vector in both human and murine cells. Our results also showed that the mouse U6 promoter was the least efficient. In contrast, the best performance of swine U6 promoter certainly expands
its potential utilization on the design and construction of shRNA vectors. Alignment of both swine and human U6 promoters revealed completely conserved Oct motif and TATA box but only 55.6% homology in the PSE motif (Fig. 1). The PSE has been shown to act as a dominant determinant for recruiting RNA pol III to U6 promoter and to play a major role in establishing the RNA polymerase specificity of Drosophila U-snRNA genes (Yoon et al., 1995; Jensen
Fig. 4. Knockdown expression of intracellular EGFP by transfection with each EGFP shRNA-expressing plasmid. EGFP shRNA (siEGFP) expressing plasmids driven respectively by swine (SU6), human (HU6), and mouse (MU6) U6 promoters (0.2 g of each) were transfected into EGFP-expressing PK-15 cells. The relative fluorescence intensities were determined at 48 h post-transfection (A) and the intracellular expressed EGFP was detected by Western blot assay (B).
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
83
Fig. 5. Comparison of promoter activities between swine and human U6 promoters with exchanged PSE motif. EGFP shRNA (siEGFP) expressing plasmids driven respectively by swine U6 (SU6), human U6 (HU6), SU6 with human PSE (SU6pseH), and HU6 with swine PSE (HU6pseS) promoters (0.1 g of each) were co-transfected with 0.1 g pEGFP-N3 into HEK293T (A) or PK-15 (B), and the relative fluorescence intensities were determined at 48 h post-transfection.
et al., 1998). When the human U6 promoter was modified with the swine PSE motif (HU6pseS), the activity was significantly enhanced in the swine PK-15 cell but not in the human HEK293T cell (Fig. 5), further confirming the important role of PSE motif in specificity determination. RNA interference is a sequence-specific gene silencing mechanism which has been employed successfully to inhibit the virus replication both in vitro (Hamasaki et al., 2003; Xu et al., 2008; Kim et al., 2010) and in vivo (Daniel-Carlier et al., 2012). Classical swine fever (CSF) caused by the CSFV is a highly contagious swine disease resulting in large economic losses worldwide (Lin et al., 2009). The CSFV NS5B gene encodes the RNA-dependent RNA polymerase responsible for viral RNA replication; and transfection of siRNA targeting to NS5B, which was prepared by in vitro transcription has demonstrated a 76.5% reduction in CSFV replication in PK-15 cells (Xu et al., 2008). Our result also revealed that the shRNA expressed by the vector pSU6 and targeting slightly more downstream NS5B region could mediate efficient RNAi in reducing CSFV replication by 90.7%. In conclusion, the swine U6 promoter is stronger than the human or mouse homologue and can efficiently mediate RNA interference in these three different species of mammalian cell lines. The shRNA expression vector driven by the swine U6 promoter might be widely used for vector-based RNAi-induced
Fig. 6. Inhibition of CSFV replication induced by shRNA targeting NS5B gene. The CSFV NS5B (siCSFV) or control (siC) shRNA expressing plasmid (0.2 g of each) was transfected into PK-15 cells followed by CSFV infection at 4 h post-transfection. The relative viral RNA compared with GAPDH RNAs was determined by real-time PCR (A), and the expressed viral proteins were detected by IFA (B) at 72 h post-infection.
gene silencing, especially to inhibit replication of other important swine viruses or production of transgenic animals in pig species.
Acknowledgement This work was supported in part by a grant 101AS-6.3.2-BQB2 from the Bureau of Animal and Plant Health Inspection and Quarantine, Council of Agriculture, Taiwan, ROC.
References Brummelkamp, T.R., Bernards, R., Agami, R., 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550–553. Daniel-Carlier, N., Sawafta, A., Passet, B., Thépot, D., Leroux-Coyau, M., Lefèvre, F., Houdebine, L.M., Jolivet, G., 2012. Viral infection resistance conferred on mice by siRNA transgenesis. Transgenic Research, http://dx.doi.org/10.1007/s11248-012-9649-4. Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., Tuschl, T., 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494–498. Hamasaki, K., Nakao, K., Matsumoto, K., Ichikawa, T., Ichikawa, H., Eguchi, K., 2003. Short interfering RNA-directed inhibition of hepatitis B virus replication. FEBS Letters 543, 51–54. Henriksen, J.R., Løkke, C., Hammerø, M., Geerts, D., Versteeg, R., Flægstad, T., Einvik, C., 2007. Comparison of RNAi efficiency mediated by tetracycline-responsive H1 and U6 promoter variants in mammalian cell lines. Nucleic Acid Research 35, e67. Jensen, R.C., Wang, Y., Hardin, S.B., Stumph, W.E., 1998. The proximal sequence element (PSE) plays a major role in establishing the RNA polymerase specificity of Drosophila U-snRNA genes. Nucleic Acid Research 26, 616–622. Kim, S.M., Lee, K.N., Lee, S.J., Ko, Y.J., Lee, H.S., Kweon, C.H., Kim, H.S., Park, J.H., 2010. Multiple shRNAs driven by U6 and CMV promoter enhances efficiency of antiviral effects against foot-and-mouth disease virus. Antiviral Research 87, 307–317. Kunkel, G.R., Hixson, J.D., 1998. The distal elements, OCT and SPH, stimulate the formation of preinitiation complexes on a human U6 snRNA gene promoter in vitro. Nucleic Acid Research 26, 1536–1543. Lin, G.J., Liu, T.Y., Tseng, Y.Y., Chen, Z.W., You, C.C., Hsuan, S.L., Chien, M.S., Huang, C., 2009. Yeast-expressed classical swine fever virus glycoprotein E2 induces a protective immune response. Veterinary Microbiology 139, 369–374. Mäkinen, P.I., Koponen, J.K., Kärkkäinen, A.M., Malm, T.M., Pulkkinen, K.H., Koistinaho, J., Turunen, M.P., Ylä-Herttuala, S., 2006. Stable RNA interference: comparison of U6 and H1 promoters in endothelial cells and in mouse brain. Journal of Gene Medicine 8, 433–441. Nie, L., Thakur, M.D., Wang, Y., Su, Q., Zhao, Y., Feng, Y., 2010. Regulation of U6 promoter activity by transcriptional interference in viral vector-based RNAi. Genomics Proteomics Bioinformatics 8, 170–179. Roelz, R., Pilz, I.H., Mutschler, M., Pahl, H.L., 2010. Of mice and men: human RNA polymerase III promoter U6 is more efficient than its murine homologue for shRNA expression from a lentiviral vector in both human and murine progenitor cells. Experimental Hematology 38, 792–797. Sui, G., Soohoo, C., Affar, E.B., Gay, F., Shi, Y., Forrester, W.C., Shi, Y., 2002. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proceedings of the National Academy of Sciences of the United States of America 99, 5515–5520. Taxman, D.J., Livingstone, L.R., Zhang, J., Conti, B.J., Iocca, H.A., Williams, K.L., Lich, J.D., Ting, J.P.Y., Reed, W., 2006. Criteria for effective design, construction, and gene knockdown by shRNA vectors. BMC Biotechnology 6, 7.
84
C.-W. Wu et al. / Journal of Biotechnology 168 (2013) 78–84
Yoon, J.B., Murphy, S., Bai, L., Wang, Z., Roeder, R.G., 1995. Proximal sequence element-binding transcription factor (PTF) is a multisubunit complex required for transcription of both RNA polymerase II- and RNA polymerase IIIdependent small nuclear RNA genes. Molecular and Cellular Biology 15, 2019–2027.
Xia, H., Mao, Q., Paulson, H.L., Davidson, B.L., 2002. siRNA-mediated gene silencing in vitro and in vivo. Nature Biotechnology 20, 1006–1010. Xu, X., Guo, H., Xiao, C., Zha, Y., Shi, Z., Xia, X., Tu, C., 2008. In vitro inhibition of classical swine fever virus replication by siRNAs targeting Npro and NS5B genes. Antiviral Research 78, 188–193.