- Email: [email protected]
Characterization of the Trypanosoma brucei 5S ribosomal RNA gene and transcript: the 5S rRNA is a spliced-leader-independent species
Gene, 35 (1985) 131-141 Elsevier
131
GENE 1274
Characterization of the Trypamsoma brucei 5s ribosod is a splice-leader-inde~ndent species (R~ombin~t ferase)
RNA gene and transcript: the 5s rRNA
DNA; nucleotide sequencing; gene repeat; Southern blot; primer extension; ~~ylyl~~s-
Michael J. Lenardo, David M. Dorfman, Lekkala V. Reddy, and John E. Donelson Departmentof Biochemistry.Universityof Iowa, Iowa City, IA 52242 (U.S.A.) Tel. (319) 353-7331 (Received December 13th, 1984) (Revision received January ZQth, 1985) (Accepted January 3Oth, 1985)
SUMMARY
Recent studies have shown that transcription occurs discontinuously for many genes in TrVpanooma brucei. To further investigate details of transcription in trypanosomes, the genes for the 5s ribosomal RNA from Trypanosoma brucei &odes&se and Tvpanosoma brucei brueei were cloned. Sequence analysis and Southern blotting showed the genes to be arranged in highly conserved tandem repeats of approx. 740 bp, which have no relation to the conserved 3%base spliced-leader repeat element. The genes contain internal control regions similar to 5s genes of other species, and studies of the 5s gene transcript show that it does not contain the conserved 35-base spliced-leader found at the 5’ end of other trypanosome transcripts. Moreover, the 5s rRNA can be capped by guanylyltransferase from vaccinia virus, indicating that it has a 5’ di- or triphosphate terminus. These results strongly suggest that the spliced-leader does not take part in the transcription of the 5s gene and that discontinuous transcription may be limited to particular classes of transcripts determined, as in other species, by the type of RNA polymerase used in their transcription. The DNA sequences of the 5s gene repeat from T.b. brucei and T.b. rhodesiense are presented, and their evolutionary significance is discussed.
Studies of transcription in T.b. brucei have recently suggested that it may differ signiticantly from that of other eukaryotes (Campbell et al., 1984; Kooter
Abbreviations: bp, base pair; EtBr, ethidium bromide; kb, kilobases or 1000 bp; nt, nucleotide(s); orphons, members of a tandemly repeated gene family that are dispersed in the genome (Childs et al., 1981); rRNA, ribosomal RNA; TF IDA, transcription factor IDA for 5s gene transcription in X. luevLr(Pelham and Brown, 1980); VSG, variable surface glycoprotein. 0378-l 119/85/$03.30 0 1985 Elsevier Science publishers
et al., 1984). The transcripts of many genes are derived from two loci which are unlinked in the genome (De Lange et al., 1984). For example, the mRNAs for the VSGs of the trypanosome have two parts. The first is a conserved 35-base spliced-leader sequence which is common to the 5’ untranslated region of ah VSG mRNAs. This sequence is transcribed from a 1.35-kb DNA repeat unit present in about 200 copies in one or more tandem arrays in the genome (Nelson et al., 1983; De Lange et al., 1983; Dorfman and Donelson, 1984). The second part is approx. 1500 nucleotides in length and contains a
132
unique protein-coding region for each distinct serotype of VSG. This is encoded at a telomere-linked locus which is not necessarily identical for each VSG gene expressed (Longacre et al., 1983; Van der Ploeg et al., 1984; Lenardo et al., 1984). Many other mRNAs also appear to have the conserved 35mer, suggesting that discontinuous transcription may be a characteristic feature of this organism (De Lange et al., 1984; Parsons et al., 1984). Eukaryotes typically contain three DNA-dependent RNA polymerases, which can be resolved by DEAE-Sephadex chromatography (Lewis and Burgess, 1982). These are: RNA polymerase I, which transcribes the large ribosomal RNA precursors, RNA polymerase II, which transcribes messenger RNAs, and RNA polymerase III, which transcribes the 5s rRNA and transfer RNAs. Recently, it has been found that only a single peak of RNA polymerase activity is detected in T.6. brucei by standard chromatographic techniques (Kitchin et al., 1984; T. Weil, University of Iowa, personal communication). This is in contrast to the closely related insect trypanosome, Crithidiafasciculata, in which three typical peaks can be distinguished. However, it has not been clearly established whether the finding of a single peak indicates the absence of multiple classes of RNA polymerase. To approach this question and determine the relationship of discontinuous transcription to other trypanosome genes we have cloned and sequenced the 5s ribosomal RNA gene from T.b. bmcei and T.b. rhodesieme and studied its transcript.
MATERIALS
AND METHODS
cloned fragments, trypanosome 5s rRNA (Hasan et al., 1984) was isolated on 10% polyacrylamide-7 M urea gels (SutclifTe et al., 1984), eluted from the gel, and labeled with [ Y-~~P]ATP using T4 polynucleotide kinase (Bonen and Gray, 1980), for use as a hybridization probe (Ham&an and Meselson, 1980). (c) DNA and RNA analysis Genomic Southern blots and DNA sequence analysis of trypanosome 5s rRNA gene sequences were performed using methods previously described (Dorfman and Donelson, 1984). Northern blots of trypanosome RNA electrophoresed on polyacrylamide gels described above were accomplished using a Hoeffer electro-transfer apparatus and ETH-membrane (J.T. Baker Chemical Co.). Primer extension analysis (Kole and Weissman, 1982) of trypanosome 5s rRNA used a 20-mer oligonucleotide complementary to nucleotide positions 7-26 of the predicted 5s rRNA sequence (see below). The oligonucleotide was synthesized by Dr. Joseph Walder of the Molecular Biology Core of the Diabetes and Endocrine Research Center, Univ. of Iowa, using a Beckman System 1 DNA Synthesizer. (d) Cuanylyltransferase reactions Guanylyltransferase reactions were carried out using enzyme from Bethesda Research Laboratories as previously described (Moss, 1977; Monroy et al., 1978). Samples were analyzed by gel electrophoresis as described above. Total yeast RNA and purified yeast 5s rRNA were the kind gift of Mark Klekamp.
(a) Strains
(e) Computer analysis
Trypanosomes of clones Iatat 1.2 (T.b. brucei) and WRATat 1.1 (T.b. rhodesiense) were grown and DNA and RNA isolated as previously described (Lenardo et al., 1984; Campbell et al., 1979).
Computer analysis of DNA sequence data was performed using an IBM-PC/XT and the PCS DNA sequence analysis programs (Lagrimini et al., 1984).
(b) Cloning
RESULTS
Cloning the 5s rRNA gene from genomic restriction fragments into the plasmid pUC9 was performed using methods previously described (Dorfman and Donelson, 1984). To screen the library of
(a) Cloning of the 33 gene Fig. 1, lane b shows the pattern of five small rRNAs which results when total trypanosome RNA
133
(Cordingley and Turner, 1980). This unique pattern appears to be characteristic of protozoan species of other genera within the family Trypanosomatidae (Gray, 198 1). There is also a sixth species of approx. 70 nt (Hasan et al., 1984) which is not well visualized here. For size comparison, the first lane shows total yeast RNA which contains a 5.8s RNA of 158 nt and a 5s RNA of 120 nt (Rubin, 1973 ; Valenzuela et al., 1977). Previous studies suggested that the fifth small trypanosome rRNA (lower arrow in Fig. 1) is the trypanosome 5s RNA (Hasan et al., 1984). These studies also used this RNA as a labeled probe and found that it is encoded in the genome on a highly reiterated AlaI repeat unit of approx. 700-800 bp arranged in a tandem array. We prepared a partial genomic library in the plasmid pUC9 from 600-850-bp Ala1 fragments from T. b. brucei DNA. The putative 5S RNA species was gel-purified, labeled and used to screen the library. Numerous positive clones were obtained and two clones, ~5%2 and p5S-11.5, which both contained inserts of approx. 740 bp, were further studied. The insert from p5S-2 was nick-translated and used to probe a blot prepared from a gel electrophoresis of total trypanosome RNA identical to that shown in Fig. 1, lane b. As is shown in Fig. 1, lane c, this clone specifically hybridized to the putative 5S RNA species. Longer exposures of this blot revealed no cross-hybridization of the cloned DNA to any other small ribosomal RNA species and no significant hybridization to high molecular weight trypanosome RNA (not shown). (b) Sequence analysis of trypanosome 33 genes
Fig. 1. 10% polyacrylamide gel electrophoresis and Northern blot of small rRNAs. Lane A: total yeast RNA showing 5X (upper arrow) and 5S (lower arrow) rRNA species; lane B: total trypanosome RNA showing the fifth small rRNA species (lower arrow); lane C: autoradiogram of total trypanosome RNA electroblotted to nylon membrane and probed with nick-translated p5.S2 [32P]plasmid insert which hybridizes to the fifth small rRNA species (lower arrow).
is electrophoresed under denaturing conditions and stained with EtBr as has been previously described
To further analyze the inserts of ~5%2 and p5S-11.5, restriction mapping was performed. This revealed that the two clones had identical restriction maps, including the NcoI and Hinff sites, shown in Fig. 2A. Both inserts were subjected to DNA sequencing by the Maxam and Gilbert (1980) method using the strategy shown in Fig. 2A. These clones were sequenced on both strands to improve the accuracy of the sequence determination, and are presented in Fig. 2B. Both inserts are 742 bp in length and contain a 118-bp region near the 3 ’ end (underscored in Fig. 2B) which contains significant homology with the partial sequence of the trypanosome 5S RNA (Hasan et al., 1984) and other
134
A.
BP
Y
100 1
742 BP =,
200 I
300 I
1
RI
N
400 1
500 1
600 1
700 1
1
Hf
742 ~lCCC~CllflllCClAG~Cl) Al"
Fig. 2. Restriction map and DNA sequence of 5s RNA gene repeats. (A) Restriction map showing the DNA sequencing strategy; solid line indicates the tandem repeat; thicker portion, 5s RNA gene; dashed portion, vector sequence. Restriction enzymes: Rl, EcoRI; N, iVco1; Hf, HinfI; Hd, HindUI. Probes A, B, and C are 5’, 3’, and total insert probes, respectively, used in Fig. 3. (B) DNA sequence of 5s repeats from T.b. brucei ~5%11.5 (shown) and p5S-2 (changes above line), and T.6. rhodesiense p5S-7 (changes below line). Ah1 sites (parentheses) define the ends of the insert. Single base changes are shown substituted with the appropriate base. A, the site of a single bp deletion. The coding sequence of the 5s rRNA is underscored. Numbers refer to nt aligned with the last digit. (Bp = bp.)
eukaryotic 5s RNAs (Erdmann et al., 1984). To explore the evolutionary relationship between T.b. brucei and T.b. rhodesiense, a comparable AluI restriction fragment was cloned from T.b. rhodesiense and sequenced. This 74 1-bp clone, p5 S-7, also contained significant homology with the partial 5s RNA sequence (Fig. 2B). As shown, all cloned
repeats have a very high degree of sequence homology. Some microheterogeneity among the three repeat sequences was detected outside of the 5S gene itself. The insert of clone p5S-7 contains a single bp deletion at position 525 in addition to point differences. Significantly, the differences between the T.b. brucei clones p5S-11.5 and p5S-2 are more
135
numerous than between either T.b. brucei clone and the T.b. rhodedemeclone ~5%7. The DNA seqnence confirms that the cloned repeats encode the trypanosome 5s gene since the deduced coding sequence has secondary structure potential which closely matches the consensus described for other eukaryotes and is shown in Fig. 4A (Erdmann et at., 1984). Of several differences observed between the DNA sequence and the reported partial RNA sequence (Hasan
et al., 1984), at least some may be RNA-sequencing errors since they occnr at consensus bases required to conserve the secondary structure potential of the 5s RNA, and the DNA sequence predicts the expected bases. No significant homology could be found between the 5s gene repeat and that containing the spliced leader sequence of trypanosomes (Dorfman and Donelson, 1984; Campbell et al., 1984).
Fig 3. Autoradiograms of Southern blots using genomic DNA from T.b. brucei hybridized with 32P-nick-translated total p5S-2 insert (lanes 1-7, lo), its 5’ half (lane 8), or its 3 ‘ half(Iane 9) which correspond to probes C, A, and B, respectively, from Fig. 2A. Lane numbers indicate the following complete restriction digests: (1) Hid, (2) Smd, (3) S&I, (4) Pstf, (5) HindHI, (6) EcoRI, (7) AM. Lanes S-10 display partial restriction digests using: a. AM and b. SM. Numbers in the left margin indicate the sizes of& markers in kb, Numbers in the right margin indicate the positions of increasing multiples of the monomeric 5s repeat. Arrow indicates the position of the monomeric 55 repeat.
136
(c) Genomic organization of the 5s genes
Previous studies indicated that the 5 S gene occurs in the genome on a tandem array of repeats which is distinct from that containing the other ribosomal RNAs (Hasan et al., 1984). We have confirmed and extended these results using Southern blot analysis of restricted total genomic DNA, as shown in Fig. 3. Lanes 1 to 4 and 7 contain restriction digests using enzymes predicted from the DNA sequence to cut the 5s repeat once. These digests, for the most part, form unit repeat copies of approx. 740 bp. Lanes 5 and 6 contain digests using enzymes that should not cut within the repeat according to the sequence, and both produce hybridizing bands which appear larger than 23.6 kb. With the possible exception of faint bands at 4.5 kb, no orphons are observed in null digests (Nelson et al., 1983). Lanes 8 to 10 show partial digests with AlaI (a) and S&I (b) which generate a ‘ladder’ of multiples of the 5s repeat characteristic of a tandemly repeated array (Nelson et al., 1983). These results are strong evidence of one or more large tandem arrays of a 740-bp repeat. In the digests which generate the unit length band, other higher A4, species are also observed. These include: Hinff-3.2 kb; SmaI-0.9, 1.4, and 1.7 kb; ,%I-9.4 kb; PstI 1.5 kb and 2.0 kb. Some are multiples of the unit length and are probably the result of a polymorphism occurring within the recognition sequence for the restriction endonuclease (illustrated by the band of approx. 1500-bp size in lanes 4 and 7). Other bands which are not an integral multiple of the unit length are also present. These may be: (i) orphons, or (ii) repeats that occur at the end of a tandem array and are the result of cutting within the repeat and again at a variable distance into the flanking sequence. To evaluate the degree of conservation of different halves of the repeat unit, genomic Southern blots were performed with a 5’ end probe (lane 8), a 3’-end probe containing the 5s RNA coding sequence (lane 9), and the entire repeat unit (lane 10). These probes are shown as probes A, B, and C, respectively, on the restriction map (Fig. 2A). Partial digests using enzymes known to cut once within the repeat unit were performed to reduce the number of copies in each band and enhance the sensitivity of the analysis. Both the 5’ probe (lane 8) and the 3’ probe (lane 9) reveal similiar intensities in the bands
generated by the partial spite microheterogeneity, which does not contain conserved as that which
digest suggesting that, dethe half of the 5s repeat the 5s gene is as highly does.
(d) Transcription of the 5s gene is independent of the spliced-leader sequence
To determine whether the 5s gene is transcribed independently of the spliced-leader sequence, two experiments were carried out. A 20-nt oligonucleotide (described in MATERIALS AND METHODS, section c, and shown in Fig. 4A) was end-labeled and used in primer extension analyses of total trypanosome RNA, the results of which are shown in Fig. 4B. Lane a shows a DNA sequencing ladder used as a size standard. Lanes b and c show primerextension assays using 20 pg of nuclear trypanosome RNA and 6 pg of total trypanosome RNA, respectively. The single major extension product obtained in both cases was 26 nt long which corresponds to the expected transcript for the mature 5s RNA. No evidence was obtained on this autoradiogram or much longer exposures for the presence of an extended product which might contain the spliced-leader sequence. The minor 25- and 27-nt species observed may represent slippage in replicating the string of three Gs present at the 5’ terminus of the 5s RNA or minor heterogeneity in the 5’ end of the 5s rRNA. Lane d shows that a similar primer extension using 20 1(g of total Saccharomyces cerevisiae input RNA results in no extended product, indicating that the reaction is template-dependent on trypanosome RNA. The corresponding 20 nt of the yeast 5s rRNA contains seven mismatches and would not be expected to bind the oligonucleotide well (Valenzuela et al., 1977). The second experiment was based on the observation that guanylyltransferase purified from vaccinia virions can be used to ‘cap’ an RNA in vitro if a 5’ tri- or diphosphate terminus is present. If the mature 5s transcript were initiated at the expected 5 ’ end, it would retain a 5’-triphosphate terminus and should be efliciently capped (Moss, 1977; Monroy et al., 1978). If the mature 5s transcript is a product of processing a hypothetically larger and unstable precursor, it would bear only a monophosphate or hydroxyl at its 5’ end that could not be capped. As shown in Fig. 5, gel-purified trypanosome 5s RNA
137
a
bed
C-G 3,CUCAUGUUG,UG/GqACCGG GC
A’ A
GG C UG
ii
UUGGUGUU C
\,A
A.A
UAGC
e
Au
Fig. 4. Predicted secondary structure and primer-extension analysis of the 5s rRNA transcript. (A) Predicted secondary structure in conformance with the consensus for eukaryotes (Erdmann et al., 1984). Shown as boxed is the 20-nt oligonucleotide used for primer-extension analysis. (B) Autoradiogram of 10% polyactylamide gel electrophoresis of primer-extension analysis. Lane a: DNA sequencing ladder for size markers; lanes b and c: primer-extension using 20 pg nuclear RNA and 6 pg of total RNA, respectively; lane d: primer extension using 20 pg of total Saccharomyces cerevzkiae RNA. Numbers 20 and 26 indicate sizes of oligonucleotide species that are 20 nt (unextended primer) and 26 nt in length, respectively.
5.8S5s-
a
Fig. 5. Guanylyltransferase capping of 5s rRNAs. Autoradiogram of a 10% polyacrylamide gel through which were electrophoresed five different RNA species that had been treated with guanylyltransferase and [a-3ZP]GTP. The RNAs were: 5 pmol of gel-puritied, untreated (lane 1) or bacterial alkaline phosphatasetreated (lane 2) T.6. brucei 5s rRNA; 5 pmol of gel-purified T.6. brucei 5.8s rRNA (lane 3); and 15 pmol of gel-purified, untreated (lane 4) or bacterial alkaline phosphatase-treated (lane 5) S. cerevisiue 5s rRNA. The arrows indicate the positions of mature 5s and 5.8s rRNAs on an EtBr-stained gel. The spots in lanes 1 and 4 are the 5s rRNA species of T. brucei and S. cereviriae that were 5’ end-labeled by the guanylyltransferase reaction. The circular distortion of these 5s rRNA ‘bands’ is due to the addition ofdiethylpyrocarbonate in absolute ethanol to the samples to minimize RNA degradation.
138
(lane 1) can be capped to the same extent as purified yeast 5s RNA (lane 4), which is known to bear a 5’ triphosphate terminus (M. Klekamp, University of Iowa, personal communication). The removal of the phosphates by treatment with alkaline phosphatase completely abolishes the ability of the guanylyltransferase to cap either the trypanosome or yeast 5s RNAs (lanes 2 and 5). In lane 3, gel-purified trypanosome 5.8s rRNA, which is thought to be cleaved from a large ribosomal precursor RNA (Hasan et al., 1984), is not capped, indicating that it does not contain a 5’ tri- or diphosphate terminus. The smaller-M, labeled species in lanes 1 and 4 are due to degradation of the capped 5s rRNA species. These results suggest that the spliced-leader does not participate in either the transcription or a post-transcriptional modification of the 5s RNA species.
is most striking in the region that corresponds to the internal control region as defined by transcriptional studies (Sakonju et al., 1980; Bogenhagen et al., 1980). The strongest sequence conservation is in the region which, in Xenopus luevis, is protected from DNase I digestion by TF IIIA and where modified nucleotides and phosphates, when present, prevent TF IIIA from binding (Pieler et al., 1984). Also shown in Fig. 6 are Knuc values for the evolutionary divergence calculated by the method of Ohama et al. (1984). It is notable that, among the species shown, the sequence in T. brucei, a flagellated protozoan, is most distantly related to the sequence in Tetrahymena thermophila, a ciliated protozoan. Not surprisingly, the trypanosome sequence is most closely related to that of another Trypanosomatidae, Crithidiafasciculata.
(e) The trypanosome 5s RNA gene contains an internal control region DISCUSSION
To determine the evolutionary relationship of the trypanosome 5s RNA sequence with those of other species, the sequences were compared as shown in Fig. 6. It is evident that the sequence bears similarity to other even distantly related species. The homology
The presence in T.b. brucei of a single unresolved peak of DNA-dependent RNA-polymerase activity and the occurrence of a novel spliced-leader sequence present on many trypanosome transcripts
20 .
10
Knuc
. 1. 2. 3. 4. 5. 6. 7. a.
HOMO SAPIENS XENOPUS LAEVIS DROSOPHILA MELANOGASTER EUGLENA GRACILIS DICYEMA MISAKIENSE TETRAHYMENA THERMOPHILA CRITHIDIA FASCICULATA TRYPANOSOMA BRUCE1
50
60
t.511 C-57) t-551 t.42) C.49) t-69) t.25)
70
-GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATC -GCCTACGGCCACACCACCCTGAAAGTGCCTGCCTGATCTCGTCTGATC -GCCAACGACCATACCACGCTGAATACATCGGTTCTCGTCCGATC GGCGTACGGCCATACTACCGGGAATACACCTGAACCCCGTTCGATT -G--TACGATCATACTTGGCCGTAAGCACCCGTTCTCAGCCGACC -GTTGTCGGCCATACTAAGGTGAAAACACCGGATCCCATTCGAAC -GAGTACGACCATACTTGAGTGAAAACACCATATCCCGTCCGATT -GGGTACGACCATACTTGGCCGAATGCACCATATCCCGTCCGATT ** ** * ** ** ** ** *
80
1. 2. 3. 4. 5. 6. 7. 8.
***
*
*
***
40 .
30 .
********
120 . CGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTT TGGGAGACCGCCTGGGAATACCAGGTGTCGTAGGCTT TGRGGGACCGCTTGGGAACACCGCGTGTTGTTGGCCT TGGGCGACCACTTGGGAACACTGGGTGCTGTACGCTT GGGTGACGGCCTGGGAACTCACAGTGTCGTA--CTT TGGGGGACCGCTTGGGAAGTCCCAGTGTCGACAACCT TCAGTGATGACACGGGAACCCTGAGTGCCGTACTCCC TCAGTGATGGCGCTGGAACCCGGGGTGTTGTACTCTC * a** * * * ** **** * * 90
100
110
Fig. 6. Summary of DNA sequences deduced for 5s rRNAs. All sequences were taken from Erdmann et al. (1984) except 5 (Ohama et al., 1984) and 8 (this report). Shown in parentheses are divergence values, Knuc, of each species compared with Trypanosoma brucei derived according to the method of Ohama et al. (1984). Asterisks indicate exact matches among all sequences. Boxed is the predicted internal control region.
139
suggested the possibility of a primitive, single polymerase transcription system. To determine whether the spliced-leader sequence plays a role in all transcription in the trypanosome it is necessary to examine transcripts which are synthesized by each of the three RNA polymerase activities that are clearly resolved in other species. Previous studies have firmly established that at least some and probably many protein-coding messenger RNAs contain the spliced-leader sequence at their 5’ ends (DeLange et al., 1984; Nelson et al., 1983). Therefore, we have examined the transcription of the 5s RNA which is typically synthesized by RNA polymerase III in other eukaryotes. Similar studies are in progress for the other ribosomal RNAs which are part of the main ribosomal transcription unit and typically transcribed by RNA polymerase I. DNA sequence analysis allowed us to predict the size and sequence of the 5s transcript in trypanosomes. The 5s RNA gene repeat contains no sequences related to the spliced-leader RNA or its repeat, and is highly conserved with microheterogeneity limited to the nontranscribed spacer region. This is similiar to the 5s RNA genes from Xenopus luevis, where microheterogeneity is limited to the spacer region of the repeat (Federoff, 1979). The very close relation of the 5 S repeats from T. b. brucei and T.b. rhodesieme, which has also been found for the spliced-leader gene repeats (D.M.D., unpublished observations), constitutes strong molecular evidence that, while these two subspecies are nosologically distinct, they are probably closely related strains of the same species. Though we have not directly demonstrated that the cloned genes are functional, and in some species many 5s RNA gene repeats may encode pseudogenes (Sharp et al., 1984), we speculate that conservation of the internal control region is evidence for an RNA polymerase III transcription activity in trypanosomes (see below). Several lines of indirect evidence suggested that the spliced-leader sequence is not involved in the transcription of the 5s RNA gene of trypanosomes. As in other trypanosome genes studied, the 5s RNA gene repeat does not appear to include directly any sequences related to the spliced leader sequence. Moreover, the deduced sequence of the 5s transcript does not contain a splice acceptor site as its 5’ end, which is characteristic of genes that are destined to receive a spliced-leader sequence at their 5’ end.
Comparison of the consensus secondary structure determined by the DNA sequence analysis with the size of the 5s transcript, as determined by denaturing gel electrophoresis, indicated that the transcript did not include an additional 35 nt. Finally, as mentioned above, the 5s RNA gene sequence encodes an internal control region, suggesting a role for a typical RNA polymerase III in its transcription. Given these considerations it was unlikely that the mature 5s transcript contained the spliced-leader sequence but did not rule out a possible labile species in which the spliced-leader was part of a 5s precursor transcript. Additional experiments have made this possibility very unlikely. Northern blots and primer extension analyses confirm the predicted end of the 5s transcript and do not detect larger 5s transcripts of lower abundance. This is true even for the nuclear RNA preparations used in the primerextension analysis which would be expected to be enriched for such a precursor. The presence of a polyphosphate at the 5’ terminus which is able to accept a cap structure also argues against the possibility of processing of a larger intermediate. Therefore, we conclude that the 5s RNA represents a class of transcripts in the trypanosome which do not require the participation of the spliced-leader sequence either during or after transcription. The significance of the finding of a single peak of DNA-dependent RNA polymerase using standard techniques (Kitchin et al., 1984) is not clear. The above results seem to suggest that there are different classes of transcripts in trypanosomes which are synthesized by different mechanisms. The 5s RNA, in particular, would likely be transcribed in a manner similar to that in other species, though this has not been directly demonstrated. Supporting this conclusion are studies of the a-amanitin sensitivity of RNA polymerase activity in isolated nuclei, which suggests there are three RNA polymerases (D.M.D., M.J.L. and J.E.D., manuscript in preparation). The inability to chromatographically resolve multiple species of RNA polymerase may be due to aggregation of the various polymerases, similar surface charges, or to the loss of required subunits during the purification protocol. Further experiments are now in progress to resolve the RNA polymerase species in trypanosomes so that characterization of their enzymatic properties can be carried out.
140
We would like to thank Mark Klekamp and Tony Weil for providing invaluable assistance and advice and for communicating unpublished r&ults, Murray Schnare for advice, and Steve Brentano for assistance with computer work. This research was supported by U.S. Army Grant DAMD 17-82-C-2228, USPHS Grants AI 18954, AM 25295 and AM 07018, and the Burroughs Wellcome Foundation. D.M.D. was supported by a Medical Scientist Training Program grant from the NIH to the University of Iowa. REFERENCES Bogenhagen, D.F., Sakonju, S. and Brown, D.: A control region in the center of the 5s RNA gene directs specific initiation of transcription, II. The 3’ border of the region. Cell 19 (1980) 21-35. Bonen, L. and Gray, M.W.: Organization and expression of the ~tochondr~~ genome of plants, 1. The genes for wheat mitochon~~ ribosomal and transfer RNA: evidence for an unusual arrangement. Nucl. Acids Res. 8 (1980) 319-335. Campbell, G.H., Esser, KM., Wellde, B.T. and D&s, C.L.: Isolation and characterization of a new serodeme of Trypanesoma rhodesiense. Am. J. Trop. Med. Hyg. 28 (1979) 974-983. Campbell, D.A., Thorton, D.A. and Boothroyd, J.C.: Apparent discontinuous transcription of Trypanosoma brucei variant antigen surface genes. Nature 311 (1984) 350-355. Childs, G., Maxson, R., Cohn, R. and Kedes, L.: Orphons: dispersed genetic elements derived from tandem repetitive genes in eukaryotes. Cell 23 (1981) 651-663. C?ordix@ey, J.S. and Turner, M.J.: 6.5s RNA; preliminary characte~ation of unusual small RNAs in T~pu~o~o~ brucei. Mol. Biochem. Parasit. I (1980) 9-96. De Lange, T., Liu, A.Y.C., Van der Ploeg, L., Borst, P., Tromp, MC. and Van Boom, J.H.: Tandem repetition of the 5’ mini-exon of variant surface glycoprotein genes: a multiple promoter for VSG gene transcription? Cell 34 (1983) 891-900. De Lange, T., Michels, P.A.M., Veerman, H.J.G., Comelisson, A.W.C.A. and Borst, P.: Many trypanosome messenger RNAs share a common 5’ terminal sequence. Nucl. Acids Res. 12 (1984) 3777-3790. Dorfinan, D.M. and Donelson, J.E.: Characterization ofthe 1.35 kilobase DNA repeat unit containing the conserved 35 nucleotides at the 5’ termini of the variable surface glycoprotein mRNAs in ~~unoso~u brwei. Nucl. Acids Res. 12 (1984) 4907-4920. Erdmann, V.A., Wolters, J., Huysmans, E., Vandenberghe, A. and De Wachter, R.: Collection of published 5s and 5.8s ribosomal RNA sequences. Nucl. Acids Res. 12 (1984) r133-r166. Fedoroff, N.: On spacers. Cell 16 (1979) 697-710.
Gray, M.W.: Unusual pattern of ribonucleic acid components in the ribosome of Criiitidiafusckzdata. a trypanosomatid protozoan. Mol. Cell. Biol. 1 (1981) 347-357. Hanahan, D. and Meselson, M.: Plasmid screening at high colony density. Gene 10 (1980) 63-67. Hasan, G., Turner, M.J. and Cordingley, J.S.: Ribosomal RNA genes of Trypanosoma brucei: mapping the regions specifying the six small ribosomal RNAs. Gene 27 (1984) 75-86. Kitchin, P.A., Ryley, J.F. and Gutteridge, W.E.: The presence of unique DNA dependent RNA polymerases in trypanosomes. Comp. Biochem. Physiol. 77B (1984) 223-231. Kole, R. and Weissman, S.: Accurate in vitro splicing of human beta-globin RNA. Nucl. Acids Res. 10 (1982) 5429-5445. Kooter, J.M.; De Lange, T. and Borst, P.: Discontinuous synthesis of mRNA in trypanosomes. EMBO J. 3 (1984) 2387-2392. Lagrimini, L.M., Brentano, S.T. and Donelson, J.E.: A DNA sequence analysis package for the IBM personal computer. Nucl. Acids Res. 12 (1984) 605-614. Lenardo, M.J., Rice-Ficht, AC., Kelly, G., Esser, K.M. and Donelson, J.: Characterization of the genes specifying two metacyclic variable antigen types in Trypnnosoma brucei rhodesiense. Proc. Natl. Acad. Sci. 81 (1984) 6642-6646. Lewis, M.K. and Burgess, R.R.: Eukaryotic RNA polymerases, in Boyer, P. (Ed.), The Enzymes, 3rd ed., Vol. 15, Nucleic Acids, part B. Academic Press, New York, 1982, pp. 109-152. Longacre, S., Hibner, U., Raibaud, A., Eisen, G., Bahz, T., Giroud, C. and Baltz, D.: DNA rearrangements and antigenie variation in Trypanosoma equiperdum: multiple expression-linked sites in independent isolates of trypanosomes expressing the same antigen. Mol. Cell. Biol. 3 (1983) 399-409. Maxam, A. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560. Monroy, G., Spencer, E. and Hurwitz, J.: Purification of mRNA gu~ylyltr~sferase from vaccmia virions. J. Biol. C&em. 253 (1978) 4481-4489. Moss, B.: Utilization of the ~~ylyl~~sferase and methyltransferase of vaccinia virus to modify and identify the 5’ terminals of heterologous RNA species. Biochem. Biophys. Res. Commun. 74 (1977) 374-383. Nelson, R.G., Parsons, M., Barr, P.J., Stuart, K., Selkirk, M. and Agabian, N.: Sequences homologous to the variant antigen mRNA spliced leader are located in tandem repeats and variable orphons in Trypanosoma brucei. Cell 34 (1983) 901-909. Ohama, T., Kumazaki, T., Hori, H. and Osawa, S.: Evolution of multicell~~ animals as deduced from 5s rRNA sequences: a possible early emergence of the Mesozoa Nucl. Acids Res. 12 (1984) 5101-5108. Parsons, M., Nelson, R. Watkins, K.P. and Agabian, N.: Trypanosome mRNAs share a common 5’ spliced leader sequence. Cell 38 (1984) 309-316. Pelham, H.R.B. and Brown, D.D.: A specific transcription factor that can bind either the 5s RNA gene to 5s RNA. Proc. Natl. Acad. Sci. USA 77 (1980) 4170-4174.
141 Pieler, T., Erdmau, V.A. and Appel, B.: Structural requirements for the interaction of SS rRNA with the eukaryotic transcription factor IIIA. Nucl. Acids Res. 12 (1984) 8393-8406. Rubii, G.M.: The nucleotide sequence of SaccharomycescereMae 5.8S ribosomal ribonucleic acid. J. Biol. Chem. 248 (1973) 3860-3875. Sakonju, S., Bogenhagen, D.F. and Brown, D.D.: A control region iu the center of the SS RNA gene directs specitic initiation of transcription I. The 5’ border of the region. Cell 19 (1980) 13-25. Sharp, S., Garcia, A., Cooley, L. and Soil, D.: Transcriptionally active and inactive gene repeats within the D. melanogaster 5s RNA gene cluster. Nucl. Acids Res. 12 (1984) 7617-7632.
Sutclitfe, J.G., Milner, RJ., Gottesfeld, J.M., and Lemer, R.A.: Identifier sequences are transcribed specifically in brain. Nature 308 (1984) 237-241. Valenzuela, P., Bell, G.I., Masiarz, F.R., DeGennaro, LJ. and Rutter, W.J.: Nucleotide sequence of the yeast SS ribosomal RNA gene and adjacent putative control regions. Nature 267 (1977) 641-643. Van der Roeg, L.H.T., Schwartz, DC, Cantor, C. and Borst, P.: Antigenic variation in Rypanosomabrucei analyzed by electrophoretic separation of chromosome-sized DNA molecules. Cell 37 (1984) 77-84. Communicated by G.N. Godson.
131
GENE 1274
Characterization of the Trypamsoma brucei 5s ribosod is a splice-leader-inde~ndent species (R~ombin~t ferase)
RNA gene and transcript: the 5s rRNA
DNA; nucleotide sequencing; gene repeat; Southern blot; primer extension; ~~ylyl~~s-
Michael J. Lenardo, David M. Dorfman, Lekkala V. Reddy, and John E. Donelson Departmentof Biochemistry.Universityof Iowa, Iowa City, IA 52242 (U.S.A.) Tel. (319) 353-7331 (Received December 13th, 1984) (Revision received January ZQth, 1985) (Accepted January 3Oth, 1985)
SUMMARY
Recent studies have shown that transcription occurs discontinuously for many genes in TrVpanooma brucei. To further investigate details of transcription in trypanosomes, the genes for the 5s ribosomal RNA from Trypanosoma brucei &odes&se and Tvpanosoma brucei brueei were cloned. Sequence analysis and Southern blotting showed the genes to be arranged in highly conserved tandem repeats of approx. 740 bp, which have no relation to the conserved 3%base spliced-leader repeat element. The genes contain internal control regions similar to 5s genes of other species, and studies of the 5s gene transcript show that it does not contain the conserved 35-base spliced-leader found at the 5’ end of other trypanosome transcripts. Moreover, the 5s rRNA can be capped by guanylyltransferase from vaccinia virus, indicating that it has a 5’ di- or triphosphate terminus. These results strongly suggest that the spliced-leader does not take part in the transcription of the 5s gene and that discontinuous transcription may be limited to particular classes of transcripts determined, as in other species, by the type of RNA polymerase used in their transcription. The DNA sequences of the 5s gene repeat from T.b. brucei and T.b. rhodesiense are presented, and their evolutionary significance is discussed.
Studies of transcription in T.b. brucei have recently suggested that it may differ signiticantly from that of other eukaryotes (Campbell et al., 1984; Kooter
Abbreviations: bp, base pair; EtBr, ethidium bromide; kb, kilobases or 1000 bp; nt, nucleotide(s); orphons, members of a tandemly repeated gene family that are dispersed in the genome (Childs et al., 1981); rRNA, ribosomal RNA; TF IDA, transcription factor IDA for 5s gene transcription in X. luevLr(Pelham and Brown, 1980); VSG, variable surface glycoprotein. 0378-l 119/85/$03.30 0 1985 Elsevier Science publishers
et al., 1984). The transcripts of many genes are derived from two loci which are unlinked in the genome (De Lange et al., 1984). For example, the mRNAs for the VSGs of the trypanosome have two parts. The first is a conserved 35-base spliced-leader sequence which is common to the 5’ untranslated region of ah VSG mRNAs. This sequence is transcribed from a 1.35-kb DNA repeat unit present in about 200 copies in one or more tandem arrays in the genome (Nelson et al., 1983; De Lange et al., 1983; Dorfman and Donelson, 1984). The second part is approx. 1500 nucleotides in length and contains a
132
unique protein-coding region for each distinct serotype of VSG. This is encoded at a telomere-linked locus which is not necessarily identical for each VSG gene expressed (Longacre et al., 1983; Van der Ploeg et al., 1984; Lenardo et al., 1984). Many other mRNAs also appear to have the conserved 35mer, suggesting that discontinuous transcription may be a characteristic feature of this organism (De Lange et al., 1984; Parsons et al., 1984). Eukaryotes typically contain three DNA-dependent RNA polymerases, which can be resolved by DEAE-Sephadex chromatography (Lewis and Burgess, 1982). These are: RNA polymerase I, which transcribes the large ribosomal RNA precursors, RNA polymerase II, which transcribes messenger RNAs, and RNA polymerase III, which transcribes the 5s rRNA and transfer RNAs. Recently, it has been found that only a single peak of RNA polymerase activity is detected in T.6. brucei by standard chromatographic techniques (Kitchin et al., 1984; T. Weil, University of Iowa, personal communication). This is in contrast to the closely related insect trypanosome, Crithidiafasciculata, in which three typical peaks can be distinguished. However, it has not been clearly established whether the finding of a single peak indicates the absence of multiple classes of RNA polymerase. To approach this question and determine the relationship of discontinuous transcription to other trypanosome genes we have cloned and sequenced the 5s ribosomal RNA gene from T.b. bmcei and T.b. rhodesieme and studied its transcript.
MATERIALS
AND METHODS
cloned fragments, trypanosome 5s rRNA (Hasan et al., 1984) was isolated on 10% polyacrylamide-7 M urea gels (SutclifTe et al., 1984), eluted from the gel, and labeled with [ Y-~~P]ATP using T4 polynucleotide kinase (Bonen and Gray, 1980), for use as a hybridization probe (Ham&an and Meselson, 1980). (c) DNA and RNA analysis Genomic Southern blots and DNA sequence analysis of trypanosome 5s rRNA gene sequences were performed using methods previously described (Dorfman and Donelson, 1984). Northern blots of trypanosome RNA electrophoresed on polyacrylamide gels described above were accomplished using a Hoeffer electro-transfer apparatus and ETH-membrane (J.T. Baker Chemical Co.). Primer extension analysis (Kole and Weissman, 1982) of trypanosome 5s rRNA used a 20-mer oligonucleotide complementary to nucleotide positions 7-26 of the predicted 5s rRNA sequence (see below). The oligonucleotide was synthesized by Dr. Joseph Walder of the Molecular Biology Core of the Diabetes and Endocrine Research Center, Univ. of Iowa, using a Beckman System 1 DNA Synthesizer. (d) Cuanylyltransferase reactions Guanylyltransferase reactions were carried out using enzyme from Bethesda Research Laboratories as previously described (Moss, 1977; Monroy et al., 1978). Samples were analyzed by gel electrophoresis as described above. Total yeast RNA and purified yeast 5s rRNA were the kind gift of Mark Klekamp.
(a) Strains
(e) Computer analysis
Trypanosomes of clones Iatat 1.2 (T.b. brucei) and WRATat 1.1 (T.b. rhodesiense) were grown and DNA and RNA isolated as previously described (Lenardo et al., 1984; Campbell et al., 1979).
Computer analysis of DNA sequence data was performed using an IBM-PC/XT and the PCS DNA sequence analysis programs (Lagrimini et al., 1984).
(b) Cloning
RESULTS
Cloning the 5s rRNA gene from genomic restriction fragments into the plasmid pUC9 was performed using methods previously described (Dorfman and Donelson, 1984). To screen the library of
(a) Cloning of the 33 gene Fig. 1, lane b shows the pattern of five small rRNAs which results when total trypanosome RNA
133
(Cordingley and Turner, 1980). This unique pattern appears to be characteristic of protozoan species of other genera within the family Trypanosomatidae (Gray, 198 1). There is also a sixth species of approx. 70 nt (Hasan et al., 1984) which is not well visualized here. For size comparison, the first lane shows total yeast RNA which contains a 5.8s RNA of 158 nt and a 5s RNA of 120 nt (Rubin, 1973 ; Valenzuela et al., 1977). Previous studies suggested that the fifth small trypanosome rRNA (lower arrow in Fig. 1) is the trypanosome 5s RNA (Hasan et al., 1984). These studies also used this RNA as a labeled probe and found that it is encoded in the genome on a highly reiterated AlaI repeat unit of approx. 700-800 bp arranged in a tandem array. We prepared a partial genomic library in the plasmid pUC9 from 600-850-bp Ala1 fragments from T. b. brucei DNA. The putative 5S RNA species was gel-purified, labeled and used to screen the library. Numerous positive clones were obtained and two clones, ~5%2 and p5S-11.5, which both contained inserts of approx. 740 bp, were further studied. The insert from p5S-2 was nick-translated and used to probe a blot prepared from a gel electrophoresis of total trypanosome RNA identical to that shown in Fig. 1, lane b. As is shown in Fig. 1, lane c, this clone specifically hybridized to the putative 5S RNA species. Longer exposures of this blot revealed no cross-hybridization of the cloned DNA to any other small ribosomal RNA species and no significant hybridization to high molecular weight trypanosome RNA (not shown). (b) Sequence analysis of trypanosome 33 genes
Fig. 1. 10% polyacrylamide gel electrophoresis and Northern blot of small rRNAs. Lane A: total yeast RNA showing 5X (upper arrow) and 5S (lower arrow) rRNA species; lane B: total trypanosome RNA showing the fifth small rRNA species (lower arrow); lane C: autoradiogram of total trypanosome RNA electroblotted to nylon membrane and probed with nick-translated p5.S2 [32P]plasmid insert which hybridizes to the fifth small rRNA species (lower arrow).
is electrophoresed under denaturing conditions and stained with EtBr as has been previously described
To further analyze the inserts of ~5%2 and p5S-11.5, restriction mapping was performed. This revealed that the two clones had identical restriction maps, including the NcoI and Hinff sites, shown in Fig. 2A. Both inserts were subjected to DNA sequencing by the Maxam and Gilbert (1980) method using the strategy shown in Fig. 2A. These clones were sequenced on both strands to improve the accuracy of the sequence determination, and are presented in Fig. 2B. Both inserts are 742 bp in length and contain a 118-bp region near the 3 ’ end (underscored in Fig. 2B) which contains significant homology with the partial sequence of the trypanosome 5S RNA (Hasan et al., 1984) and other
134
A.
BP
Y
100 1
742 BP =,
200 I
300 I
1
RI
N
400 1
500 1
600 1
700 1
1
Hf
742 ~lCCC~CllflllCClAG~Cl) Al"
Fig. 2. Restriction map and DNA sequence of 5s RNA gene repeats. (A) Restriction map showing the DNA sequencing strategy; solid line indicates the tandem repeat; thicker portion, 5s RNA gene; dashed portion, vector sequence. Restriction enzymes: Rl, EcoRI; N, iVco1; Hf, HinfI; Hd, HindUI. Probes A, B, and C are 5’, 3’, and total insert probes, respectively, used in Fig. 3. (B) DNA sequence of 5s repeats from T.b. brucei ~5%11.5 (shown) and p5S-2 (changes above line), and T.6. rhodesiense p5S-7 (changes below line). Ah1 sites (parentheses) define the ends of the insert. Single base changes are shown substituted with the appropriate base. A, the site of a single bp deletion. The coding sequence of the 5s rRNA is underscored. Numbers refer to nt aligned with the last digit. (Bp = bp.)
eukaryotic 5s RNAs (Erdmann et al., 1984). To explore the evolutionary relationship between T.b. brucei and T.b. rhodesiense, a comparable AluI restriction fragment was cloned from T.b. rhodesiense and sequenced. This 74 1-bp clone, p5 S-7, also contained significant homology with the partial 5s RNA sequence (Fig. 2B). As shown, all cloned
repeats have a very high degree of sequence homology. Some microheterogeneity among the three repeat sequences was detected outside of the 5S gene itself. The insert of clone p5S-7 contains a single bp deletion at position 525 in addition to point differences. Significantly, the differences between the T.b. brucei clones p5S-11.5 and p5S-2 are more
135
numerous than between either T.b. brucei clone and the T.b. rhodedemeclone ~5%7. The DNA seqnence confirms that the cloned repeats encode the trypanosome 5s gene since the deduced coding sequence has secondary structure potential which closely matches the consensus described for other eukaryotes and is shown in Fig. 4A (Erdmann et at., 1984). Of several differences observed between the DNA sequence and the reported partial RNA sequence (Hasan
et al., 1984), at least some may be RNA-sequencing errors since they occnr at consensus bases required to conserve the secondary structure potential of the 5s RNA, and the DNA sequence predicts the expected bases. No significant homology could be found between the 5s gene repeat and that containing the spliced leader sequence of trypanosomes (Dorfman and Donelson, 1984; Campbell et al., 1984).
Fig 3. Autoradiograms of Southern blots using genomic DNA from T.b. brucei hybridized with 32P-nick-translated total p5S-2 insert (lanes 1-7, lo), its 5’ half (lane 8), or its 3 ‘ half(Iane 9) which correspond to probes C, A, and B, respectively, from Fig. 2A. Lane numbers indicate the following complete restriction digests: (1) Hid, (2) Smd, (3) S&I, (4) Pstf, (5) HindHI, (6) EcoRI, (7) AM. Lanes S-10 display partial restriction digests using: a. AM and b. SM. Numbers in the left margin indicate the sizes of& markers in kb, Numbers in the right margin indicate the positions of increasing multiples of the monomeric 5s repeat. Arrow indicates the position of the monomeric 55 repeat.
136
(c) Genomic organization of the 5s genes
Previous studies indicated that the 5 S gene occurs in the genome on a tandem array of repeats which is distinct from that containing the other ribosomal RNAs (Hasan et al., 1984). We have confirmed and extended these results using Southern blot analysis of restricted total genomic DNA, as shown in Fig. 3. Lanes 1 to 4 and 7 contain restriction digests using enzymes predicted from the DNA sequence to cut the 5s repeat once. These digests, for the most part, form unit repeat copies of approx. 740 bp. Lanes 5 and 6 contain digests using enzymes that should not cut within the repeat according to the sequence, and both produce hybridizing bands which appear larger than 23.6 kb. With the possible exception of faint bands at 4.5 kb, no orphons are observed in null digests (Nelson et al., 1983). Lanes 8 to 10 show partial digests with AlaI (a) and S&I (b) which generate a ‘ladder’ of multiples of the 5s repeat characteristic of a tandemly repeated array (Nelson et al., 1983). These results are strong evidence of one or more large tandem arrays of a 740-bp repeat. In the digests which generate the unit length band, other higher A4, species are also observed. These include: Hinff-3.2 kb; SmaI-0.9, 1.4, and 1.7 kb; ,%I-9.4 kb; PstI 1.5 kb and 2.0 kb. Some are multiples of the unit length and are probably the result of a polymorphism occurring within the recognition sequence for the restriction endonuclease (illustrated by the band of approx. 1500-bp size in lanes 4 and 7). Other bands which are not an integral multiple of the unit length are also present. These may be: (i) orphons, or (ii) repeats that occur at the end of a tandem array and are the result of cutting within the repeat and again at a variable distance into the flanking sequence. To evaluate the degree of conservation of different halves of the repeat unit, genomic Southern blots were performed with a 5’ end probe (lane 8), a 3’-end probe containing the 5s RNA coding sequence (lane 9), and the entire repeat unit (lane 10). These probes are shown as probes A, B, and C, respectively, on the restriction map (Fig. 2A). Partial digests using enzymes known to cut once within the repeat unit were performed to reduce the number of copies in each band and enhance the sensitivity of the analysis. Both the 5’ probe (lane 8) and the 3’ probe (lane 9) reveal similiar intensities in the bands
generated by the partial spite microheterogeneity, which does not contain conserved as that which
digest suggesting that, dethe half of the 5s repeat the 5s gene is as highly does.
(d) Transcription of the 5s gene is independent of the spliced-leader sequence
To determine whether the 5s gene is transcribed independently of the spliced-leader sequence, two experiments were carried out. A 20-nt oligonucleotide (described in MATERIALS AND METHODS, section c, and shown in Fig. 4A) was end-labeled and used in primer extension analyses of total trypanosome RNA, the results of which are shown in Fig. 4B. Lane a shows a DNA sequencing ladder used as a size standard. Lanes b and c show primerextension assays using 20 pg of nuclear trypanosome RNA and 6 pg of total trypanosome RNA, respectively. The single major extension product obtained in both cases was 26 nt long which corresponds to the expected transcript for the mature 5s RNA. No evidence was obtained on this autoradiogram or much longer exposures for the presence of an extended product which might contain the spliced-leader sequence. The minor 25- and 27-nt species observed may represent slippage in replicating the string of three Gs present at the 5’ terminus of the 5s RNA or minor heterogeneity in the 5’ end of the 5s rRNA. Lane d shows that a similar primer extension using 20 1(g of total Saccharomyces cerevisiae input RNA results in no extended product, indicating that the reaction is template-dependent on trypanosome RNA. The corresponding 20 nt of the yeast 5s rRNA contains seven mismatches and would not be expected to bind the oligonucleotide well (Valenzuela et al., 1977). The second experiment was based on the observation that guanylyltransferase purified from vaccinia virions can be used to ‘cap’ an RNA in vitro if a 5’ tri- or diphosphate terminus is present. If the mature 5s transcript were initiated at the expected 5 ’ end, it would retain a 5’-triphosphate terminus and should be efliciently capped (Moss, 1977; Monroy et al., 1978). If the mature 5s transcript is a product of processing a hypothetically larger and unstable precursor, it would bear only a monophosphate or hydroxyl at its 5’ end that could not be capped. As shown in Fig. 5, gel-purified trypanosome 5s RNA
137
a
bed
C-G 3,CUCAUGUUG,UG/GqACCGG GC
A’ A
GG C UG
ii
UUGGUGUU C
\,A
A.A
UAGC
e
Au
Fig. 4. Predicted secondary structure and primer-extension analysis of the 5s rRNA transcript. (A) Predicted secondary structure in conformance with the consensus for eukaryotes (Erdmann et al., 1984). Shown as boxed is the 20-nt oligonucleotide used for primer-extension analysis. (B) Autoradiogram of 10% polyactylamide gel electrophoresis of primer-extension analysis. Lane a: DNA sequencing ladder for size markers; lanes b and c: primer-extension using 20 pg nuclear RNA and 6 pg of total RNA, respectively; lane d: primer extension using 20 pg of total Saccharomyces cerevzkiae RNA. Numbers 20 and 26 indicate sizes of oligonucleotide species that are 20 nt (unextended primer) and 26 nt in length, respectively.
5.8S5s-
a
Fig. 5. Guanylyltransferase capping of 5s rRNAs. Autoradiogram of a 10% polyacrylamide gel through which were electrophoresed five different RNA species that had been treated with guanylyltransferase and [a-3ZP]GTP. The RNAs were: 5 pmol of gel-puritied, untreated (lane 1) or bacterial alkaline phosphatasetreated (lane 2) T.6. brucei 5s rRNA; 5 pmol of gel-purified T.6. brucei 5.8s rRNA (lane 3); and 15 pmol of gel-purified, untreated (lane 4) or bacterial alkaline phosphatase-treated (lane 5) S. cerevisiue 5s rRNA. The arrows indicate the positions of mature 5s and 5.8s rRNAs on an EtBr-stained gel. The spots in lanes 1 and 4 are the 5s rRNA species of T. brucei and S. cereviriae that were 5’ end-labeled by the guanylyltransferase reaction. The circular distortion of these 5s rRNA ‘bands’ is due to the addition ofdiethylpyrocarbonate in absolute ethanol to the samples to minimize RNA degradation.
138
(lane 1) can be capped to the same extent as purified yeast 5s RNA (lane 4), which is known to bear a 5’ triphosphate terminus (M. Klekamp, University of Iowa, personal communication). The removal of the phosphates by treatment with alkaline phosphatase completely abolishes the ability of the guanylyltransferase to cap either the trypanosome or yeast 5s RNAs (lanes 2 and 5). In lane 3, gel-purified trypanosome 5.8s rRNA, which is thought to be cleaved from a large ribosomal precursor RNA (Hasan et al., 1984), is not capped, indicating that it does not contain a 5’ tri- or diphosphate terminus. The smaller-M, labeled species in lanes 1 and 4 are due to degradation of the capped 5s rRNA species. These results suggest that the spliced-leader does not participate in either the transcription or a post-transcriptional modification of the 5s RNA species.
is most striking in the region that corresponds to the internal control region as defined by transcriptional studies (Sakonju et al., 1980; Bogenhagen et al., 1980). The strongest sequence conservation is in the region which, in Xenopus luevis, is protected from DNase I digestion by TF IIIA and where modified nucleotides and phosphates, when present, prevent TF IIIA from binding (Pieler et al., 1984). Also shown in Fig. 6 are Knuc values for the evolutionary divergence calculated by the method of Ohama et al. (1984). It is notable that, among the species shown, the sequence in T. brucei, a flagellated protozoan, is most distantly related to the sequence in Tetrahymena thermophila, a ciliated protozoan. Not surprisingly, the trypanosome sequence is most closely related to that of another Trypanosomatidae, Crithidiafasciculata.
(e) The trypanosome 5s RNA gene contains an internal control region DISCUSSION
To determine the evolutionary relationship of the trypanosome 5s RNA sequence with those of other species, the sequences were compared as shown in Fig. 6. It is evident that the sequence bears similarity to other even distantly related species. The homology
The presence in T.b. brucei of a single unresolved peak of DNA-dependent RNA-polymerase activity and the occurrence of a novel spliced-leader sequence present on many trypanosome transcripts
20 .
10
Knuc
. 1. 2. 3. 4. 5. 6. 7. a.
HOMO SAPIENS XENOPUS LAEVIS DROSOPHILA MELANOGASTER EUGLENA GRACILIS DICYEMA MISAKIENSE TETRAHYMENA THERMOPHILA CRITHIDIA FASCICULATA TRYPANOSOMA BRUCE1
50
60
t.511 C-57) t-551 t.42) C.49) t-69) t.25)
70
-GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATC -GCCTACGGCCACACCACCCTGAAAGTGCCTGCCTGATCTCGTCTGATC -GCCAACGACCATACCACGCTGAATACATCGGTTCTCGTCCGATC GGCGTACGGCCATACTACCGGGAATACACCTGAACCCCGTTCGATT -G--TACGATCATACTTGGCCGTAAGCACCCGTTCTCAGCCGACC -GTTGTCGGCCATACTAAGGTGAAAACACCGGATCCCATTCGAAC -GAGTACGACCATACTTGAGTGAAAACACCATATCCCGTCCGATT -GGGTACGACCATACTTGGCCGAATGCACCATATCCCGTCCGATT ** ** * ** ** ** ** *
80
1. 2. 3. 4. 5. 6. 7. 8.
***
*
*
***
40 .
30 .
********
120 . CGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTT TGGGAGACCGCCTGGGAATACCAGGTGTCGTAGGCTT TGRGGGACCGCTTGGGAACACCGCGTGTTGTTGGCCT TGGGCGACCACTTGGGAACACTGGGTGCTGTACGCTT GGGTGACGGCCTGGGAACTCACAGTGTCGTA--CTT TGGGGGACCGCTTGGGAAGTCCCAGTGTCGACAACCT TCAGTGATGACACGGGAACCCTGAGTGCCGTACTCCC TCAGTGATGGCGCTGGAACCCGGGGTGTTGTACTCTC * a** * * * ** **** * * 90
100
110
Fig. 6. Summary of DNA sequences deduced for 5s rRNAs. All sequences were taken from Erdmann et al. (1984) except 5 (Ohama et al., 1984) and 8 (this report). Shown in parentheses are divergence values, Knuc, of each species compared with Trypanosoma brucei derived according to the method of Ohama et al. (1984). Asterisks indicate exact matches among all sequences. Boxed is the predicted internal control region.
139
suggested the possibility of a primitive, single polymerase transcription system. To determine whether the spliced-leader sequence plays a role in all transcription in the trypanosome it is necessary to examine transcripts which are synthesized by each of the three RNA polymerase activities that are clearly resolved in other species. Previous studies have firmly established that at least some and probably many protein-coding messenger RNAs contain the spliced-leader sequence at their 5’ ends (DeLange et al., 1984; Nelson et al., 1983). Therefore, we have examined the transcription of the 5s RNA which is typically synthesized by RNA polymerase III in other eukaryotes. Similar studies are in progress for the other ribosomal RNAs which are part of the main ribosomal transcription unit and typically transcribed by RNA polymerase I. DNA sequence analysis allowed us to predict the size and sequence of the 5s transcript in trypanosomes. The 5s RNA gene repeat contains no sequences related to the spliced-leader RNA or its repeat, and is highly conserved with microheterogeneity limited to the nontranscribed spacer region. This is similiar to the 5s RNA genes from Xenopus luevis, where microheterogeneity is limited to the spacer region of the repeat (Federoff, 1979). The very close relation of the 5 S repeats from T. b. brucei and T.b. rhodesieme, which has also been found for the spliced-leader gene repeats (D.M.D., unpublished observations), constitutes strong molecular evidence that, while these two subspecies are nosologically distinct, they are probably closely related strains of the same species. Though we have not directly demonstrated that the cloned genes are functional, and in some species many 5s RNA gene repeats may encode pseudogenes (Sharp et al., 1984), we speculate that conservation of the internal control region is evidence for an RNA polymerase III transcription activity in trypanosomes (see below). Several lines of indirect evidence suggested that the spliced-leader sequence is not involved in the transcription of the 5s RNA gene of trypanosomes. As in other trypanosome genes studied, the 5s RNA gene repeat does not appear to include directly any sequences related to the spliced leader sequence. Moreover, the deduced sequence of the 5s transcript does not contain a splice acceptor site as its 5’ end, which is characteristic of genes that are destined to receive a spliced-leader sequence at their 5’ end.
Comparison of the consensus secondary structure determined by the DNA sequence analysis with the size of the 5s transcript, as determined by denaturing gel electrophoresis, indicated that the transcript did not include an additional 35 nt. Finally, as mentioned above, the 5s RNA gene sequence encodes an internal control region, suggesting a role for a typical RNA polymerase III in its transcription. Given these considerations it was unlikely that the mature 5s transcript contained the spliced-leader sequence but did not rule out a possible labile species in which the spliced-leader was part of a 5s precursor transcript. Additional experiments have made this possibility very unlikely. Northern blots and primer extension analyses confirm the predicted end of the 5s transcript and do not detect larger 5s transcripts of lower abundance. This is true even for the nuclear RNA preparations used in the primerextension analysis which would be expected to be enriched for such a precursor. The presence of a polyphosphate at the 5’ terminus which is able to accept a cap structure also argues against the possibility of processing of a larger intermediate. Therefore, we conclude that the 5s RNA represents a class of transcripts in the trypanosome which do not require the participation of the spliced-leader sequence either during or after transcription. The significance of the finding of a single peak of DNA-dependent RNA polymerase using standard techniques (Kitchin et al., 1984) is not clear. The above results seem to suggest that there are different classes of transcripts in trypanosomes which are synthesized by different mechanisms. The 5s RNA, in particular, would likely be transcribed in a manner similar to that in other species, though this has not been directly demonstrated. Supporting this conclusion are studies of the a-amanitin sensitivity of RNA polymerase activity in isolated nuclei, which suggests there are three RNA polymerases (D.M.D., M.J.L. and J.E.D., manuscript in preparation). The inability to chromatographically resolve multiple species of RNA polymerase may be due to aggregation of the various polymerases, similar surface charges, or to the loss of required subunits during the purification protocol. Further experiments are now in progress to resolve the RNA polymerase species in trypanosomes so that characterization of their enzymatic properties can be carried out.
140
We would like to thank Mark Klekamp and Tony Weil for providing invaluable assistance and advice and for communicating unpublished r&ults, Murray Schnare for advice, and Steve Brentano for assistance with computer work. This research was supported by U.S. Army Grant DAMD 17-82-C-2228, USPHS Grants AI 18954, AM 25295 and AM 07018, and the Burroughs Wellcome Foundation. D.M.D. was supported by a Medical Scientist Training Program grant from the NIH to the University of Iowa. REFERENCES Bogenhagen, D.F., Sakonju, S. and Brown, D.: A control region in the center of the 5s RNA gene directs specific initiation of transcription, II. The 3’ border of the region. Cell 19 (1980) 21-35. Bonen, L. and Gray, M.W.: Organization and expression of the ~tochondr~~ genome of plants, 1. The genes for wheat mitochon~~ ribosomal and transfer RNA: evidence for an unusual arrangement. Nucl. Acids Res. 8 (1980) 319-335. Campbell, G.H., Esser, KM., Wellde, B.T. and D&s, C.L.: Isolation and characterization of a new serodeme of Trypanesoma rhodesiense. Am. J. Trop. Med. Hyg. 28 (1979) 974-983. Campbell, D.A., Thorton, D.A. and Boothroyd, J.C.: Apparent discontinuous transcription of Trypanosoma brucei variant antigen surface genes. Nature 311 (1984) 350-355. Childs, G., Maxson, R., Cohn, R. and Kedes, L.: Orphons: dispersed genetic elements derived from tandem repetitive genes in eukaryotes. Cell 23 (1981) 651-663. C?ordix@ey, J.S. and Turner, M.J.: 6.5s RNA; preliminary characte~ation of unusual small RNAs in T~pu~o~o~ brucei. Mol. Biochem. Parasit. I (1980) 9-96. De Lange, T., Liu, A.Y.C., Van der Ploeg, L., Borst, P., Tromp, MC. and Van Boom, J.H.: Tandem repetition of the 5’ mini-exon of variant surface glycoprotein genes: a multiple promoter for VSG gene transcription? Cell 34 (1983) 891-900. De Lange, T., Michels, P.A.M., Veerman, H.J.G., Comelisson, A.W.C.A. and Borst, P.: Many trypanosome messenger RNAs share a common 5’ terminal sequence. Nucl. Acids Res. 12 (1984) 3777-3790. Dorfinan, D.M. and Donelson, J.E.: Characterization ofthe 1.35 kilobase DNA repeat unit containing the conserved 35 nucleotides at the 5’ termini of the variable surface glycoprotein mRNAs in ~~unoso~u brwei. Nucl. Acids Res. 12 (1984) 4907-4920. Erdmann, V.A., Wolters, J., Huysmans, E., Vandenberghe, A. and De Wachter, R.: Collection of published 5s and 5.8s ribosomal RNA sequences. Nucl. Acids Res. 12 (1984) r133-r166. Fedoroff, N.: On spacers. Cell 16 (1979) 697-710.
Gray, M.W.: Unusual pattern of ribonucleic acid components in the ribosome of Criiitidiafusckzdata. a trypanosomatid protozoan. Mol. Cell. Biol. 1 (1981) 347-357. Hanahan, D. and Meselson, M.: Plasmid screening at high colony density. Gene 10 (1980) 63-67. Hasan, G., Turner, M.J. and Cordingley, J.S.: Ribosomal RNA genes of Trypanosoma brucei: mapping the regions specifying the six small ribosomal RNAs. Gene 27 (1984) 75-86. Kitchin, P.A., Ryley, J.F. and Gutteridge, W.E.: The presence of unique DNA dependent RNA polymerases in trypanosomes. Comp. Biochem. Physiol. 77B (1984) 223-231. Kole, R. and Weissman, S.: Accurate in vitro splicing of human beta-globin RNA. Nucl. Acids Res. 10 (1982) 5429-5445. Kooter, J.M.; De Lange, T. and Borst, P.: Discontinuous synthesis of mRNA in trypanosomes. EMBO J. 3 (1984) 2387-2392. Lagrimini, L.M., Brentano, S.T. and Donelson, J.E.: A DNA sequence analysis package for the IBM personal computer. Nucl. Acids Res. 12 (1984) 605-614. Lenardo, M.J., Rice-Ficht, AC., Kelly, G., Esser, K.M. and Donelson, J.: Characterization of the genes specifying two metacyclic variable antigen types in Trypnnosoma brucei rhodesiense. Proc. Natl. Acad. Sci. 81 (1984) 6642-6646. Lewis, M.K. and Burgess, R.R.: Eukaryotic RNA polymerases, in Boyer, P. (Ed.), The Enzymes, 3rd ed., Vol. 15, Nucleic Acids, part B. Academic Press, New York, 1982, pp. 109-152. Longacre, S., Hibner, U., Raibaud, A., Eisen, G., Bahz, T., Giroud, C. and Baltz, D.: DNA rearrangements and antigenie variation in Trypanosoma equiperdum: multiple expression-linked sites in independent isolates of trypanosomes expressing the same antigen. Mol. Cell. Biol. 3 (1983) 399-409. Maxam, A. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560. Monroy, G., Spencer, E. and Hurwitz, J.: Purification of mRNA gu~ylyltr~sferase from vaccmia virions. J. Biol. C&em. 253 (1978) 4481-4489. Moss, B.: Utilization of the ~~ylyl~~sferase and methyltransferase of vaccinia virus to modify and identify the 5’ terminals of heterologous RNA species. Biochem. Biophys. Res. Commun. 74 (1977) 374-383. Nelson, R.G., Parsons, M., Barr, P.J., Stuart, K., Selkirk, M. and Agabian, N.: Sequences homologous to the variant antigen mRNA spliced leader are located in tandem repeats and variable orphons in Trypanosoma brucei. Cell 34 (1983) 901-909. Ohama, T., Kumazaki, T., Hori, H. and Osawa, S.: Evolution of multicell~~ animals as deduced from 5s rRNA sequences: a possible early emergence of the Mesozoa Nucl. Acids Res. 12 (1984) 5101-5108. Parsons, M., Nelson, R. Watkins, K.P. and Agabian, N.: Trypanosome mRNAs share a common 5’ spliced leader sequence. Cell 38 (1984) 309-316. Pelham, H.R.B. and Brown, D.D.: A specific transcription factor that can bind either the 5s RNA gene to 5s RNA. Proc. Natl. Acad. Sci. USA 77 (1980) 4170-4174.
141 Pieler, T., Erdmau, V.A. and Appel, B.: Structural requirements for the interaction of SS rRNA with the eukaryotic transcription factor IIIA. Nucl. Acids Res. 12 (1984) 8393-8406. Rubii, G.M.: The nucleotide sequence of SaccharomycescereMae 5.8S ribosomal ribonucleic acid. J. Biol. Chem. 248 (1973) 3860-3875. Sakonju, S., Bogenhagen, D.F. and Brown, D.D.: A control region iu the center of the SS RNA gene directs specitic initiation of transcription I. The 5’ border of the region. Cell 19 (1980) 13-25. Sharp, S., Garcia, A., Cooley, L. and Soil, D.: Transcriptionally active and inactive gene repeats within the D. melanogaster 5s RNA gene cluster. Nucl. Acids Res. 12 (1984) 7617-7632.
Sutclitfe, J.G., Milner, RJ., Gottesfeld, J.M., and Lemer, R.A.: Identifier sequences are transcribed specifically in brain. Nature 308 (1984) 237-241. Valenzuela, P., Bell, G.I., Masiarz, F.R., DeGennaro, LJ. and Rutter, W.J.: Nucleotide sequence of the yeast SS ribosomal RNA gene and adjacent putative control regions. Nature 267 (1977) 641-643. Van der Roeg, L.H.T., Schwartz, DC, Cantor, C. and Borst, P.: Antigenic variation in Rypanosomabrucei analyzed by electrophoretic separation of chromosome-sized DNA molecules. Cell 37 (1984) 77-84. Communicated by G.N. Godson.