Characterization of three pro-inflammatory cytokines, TNFα1, TNFα2 and IL-1β, in cage-reared Atlantic bluefin tuna Thunnus thynnus

Characterization of three pro-inflammatory cytokines, TNFα1, TNFα2 and IL-1β, in cage-reared Atlantic bluefin tuna Thunnus thynnus

Fish & Shellfish Immunology 36 (2014) 98e112 Contents lists available at ScienceDirect Fish & Shellfish Immunology journal homepage: www.elsevier.com/...
Download PDF
4MB Sizes 1 Downloads 27 Views
Report

Fish & Shellfish Immunology 36 (2014) 98e112

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Characterization of three pro-inflammatory cytokines, TNFa1, TNFa2 and IL-1b, in cage-reared Atlantic bluefin tuna Thunnus thynnus Ivana Lepen Plei c a, *, Christopher J. Secombes b, Steve Bird c, Ivona Mladineo a a

Laboratory for Aquaculture, Institute of Oceanography and Fisheries, Setaliste Ivana Mestrovica 63, 21000 Split, Croatia Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, AB24 2TZ Aberdeen, UK c Department of Biological Sciences, University of Waikato, Hamilton, New Zealand b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 9 August 2012 Received in revised form 2 October 2013 Accepted 14 October 2013 Available online 26 October 2013

Atlantic bluefin tuna (BFT) (Thunnus thynnus) is of great economic significance for world aquaculture and therefore it is necessary to ensure optimal and sustainable conditions for the farming of this species. Intensive culture of fish may be limited by infectious diseases that can impact on growth performance and cause heavy losses. However, to date there are no reports of cloning and expression analysis of any major immune genes of Atlantic BFT although some immune genes are known in other BFT species. Therefore the aim of this study was to characterize the first cytokine molecules in Atlantic BFT, through: 1) Isolation of full-length cDNA and gene sequences of TNFa1, TNFa2 and IL-1b, 2) comparison of these molecules to known sequences in other vertebrates, especially teleost fish, by multiple sequence alignment, phylogenetic tree analysis and homology modeling; 3) Quantification of in vivo expression of these cytokines in selected tissues in reared BFT over the duration of the farming process. The results indicated that these three cytokines could have value for monitoring Atlantic BFT health status. Curiously, the liver seemed to be an important site of cytokine production during poor health conditions in this species, perhaps reflecting its role as an important organ involved in fish defenses. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Bluefin tuna Innate immunity Tumor necrosis factor a Interleukin 1b Homology modeling

1. Introduction Bluefin tunas (BFT) are the largest of the Thunnus species (Scombridae) and are characterized by a long life span, wide geographic distribution and endothermy [1]. Three species are known, namely Atlantic BFT (Thunnus thynnus), Southern BFT (Thunnus maccoyii) and Pacific BFT (Thunnus orientais). Since their introduction into Mediterranean aquaculture in the early nineties, Atlantic BFT have become the most valuable finfish aquaculture product currently known, with more than half of the world’s total production concentrated in the Mediterranean Sea [2]. In Croatia, the first BFT culture began two decades ago, and currently 50% of the total national fisheries export goes to the Japanese market. Tuna aquaculture is a capture-based activity, where wild caught tuna are

Abbreviations: BFT, bluefin tuna; TNFa, tumor necrosis factor alpha; IL-1b, interleukin 1 beta; NW, North-West; TACE, TNFa converting enzyme; RACE, rapid amplification of cDNA ends; BLAST, Blast Local Alignment Search Tool; ORF, open reading frame; UTR, untranslated region; ARE, AU-rich elements; bp, base pairs; 3D, three-dimensional; NK, natural killer cells; NKT, natural killer T cells; LPS, lipopolysaccharide; PBL, peripheral blood lymphocytes. * Corresponding author. Tel.: þ385 21 408 047; fax: þ385 21 385 650. E-mail address: [email protected] (I. Lepen Plei c). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.10.011

cultured in marine cages for a specific period of time, in order to increase the commercial value by increasing their protein and fat content. Farms are supplied with fish of 8e15 kg that are then kept in cages for prolonged periods (usually one and a half years but up to two or three years), depending on their initial size and market requests. During that period unpredictable environmental factors, microorganisms and unbalanced diet can contribute to the onset of disease in the tuna [3]. Although disease problems have rarely been reported in adult BFT, juvenile BFT are highly susceptible to various pathogens [4,5], with stress associated with intensive farming conditions possibly affecting individual fish immunocompetence and growth performance [6,7]. To date, most research carried out on tuna immunology has been focused on the Pacific and Southern BFT [8e13], with no reports of the cloning and expression analysis of any important immune genes in Atlantic BFT. The innate immune response is the first line of host defense against pathogenic organisms [14], helping to control infection until the adaptive immune response develops to provide specific immunity [15]. After detection and recognition of pathogens, the innate immune system initiates and activates other components via the release of cytokines, small cell signaling proteins that act as intercellular mediators. One large family of structurally related cytokines involved in the innate immune response are the ‘Tumor

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

necrosis factor (TNF) Ligand Superfamily’, whose members have a wide range of diverse activities, such as inflammation, apoptosis, cell proliferation and stimulation of different aspects of immunity [16]. A member of this family, Tumor necrosis factor alpha (TNFa), is a major mediator of pro-inflammatory and antimicrobial defense mechanisms, able to eliminate various pathogens by inducing a variety of cellular responses such as phagocytosis and chemotaxis, and is considered an excellent biomarker and health indicator for both mammals and fish [16e19]. TNFa is currently one of the most well-studied fish cytokines, having been described in several teleost fish [9,13,20e34]. In mammals, TNFa exists in two biologically active forms: a 26 kDa membrane-bound protein and a 17 kDa secreted form, generated by proteolytic cleavage of the 26 kDa protein at its C terminus with TNFa converting enzyme (TACE) [35e 37]. The cleaved mature peptide forms a trimer and binds to its receptor eliciting a response. The 17 kDa TNFa has a structure typical of TNF family members, composed of eight anti-parallel bstrands, forming a “jelly-roll” b-structure [38]. The interleukin-1 (IL-1) family of cytokines, with eleven members in mammals, is another major mediator of inflammation and can induce the expression of a wide variety of non-structural, function-associated genes during infection [39]. IL-1b is a particularly important component of the inflammasome and is produced by a variety of cells, mainly blood monocytes and tissue macrophages. It plays a key role in the host response to microbial invasion, tissue injury and even autoimmune diseases [40] due its ability to enhance phagocyte activity, macrophage proliferation, lysozyme synthesis and leukocyte migration [41] and has also been characterized in various fish species [13,39,42e53]. IL-1b is expressed as a 30 kDa non-functional precursor in mammals, that is fully activated only after it is proteolytically cleaved into a 17.3 kDa mature peptide by a cysteine protease, IL-1b converting enzyme (ICE), associated with transport out of the cell [54e56]. The mature peptide, as with other IL-1 family members, contains 12 b-sheets that form a b-trefoil structure [57]. In this study we have characterized the first cytokine molecules in Atlantic BFT, through: 1) Isolation of full-length cDNA and gene sequences of Atlantic BFT TNFa1, TNFa2 and IL-1b, 2) Comparison of these molecules to known sequences in other vertebrates, especially teleost fish, and 3) Quantification of their in vivo expression in selected tissues in reared BFT over the duration of the farming process, in order to evaluate their importance as potential biomarkers for tuna aquaculture. 2. Materials and methods

99

Table 1 Oligonucleotide primers used to clone and/or amplify the Atlantic bluefin tuna (BFT) TNFa1, TNFa2, IL-1b and b-actin genes. Name

Nucleotide sequence (50 / 30 )

bftTNF1-F bftTNF1-R mbactin-F mbactin-R bftTNF2-F bftTNF2-R bftIL1-F bftIL1-R

CCAGGCRGCCATCCATTTAGAAG CGCTGACCTCACCGCGCTCATCAG ATCGTGGGGCGCCCCAGGCACA CTCCTTAATGTCACGCACGAT TTC TGAATGCAAGGTAGCGCTGGATG TGGTCTGGTCGGAACTTGTGGCG GTGGCTCTGGGCATCAAG GGTGCTGATGTACCAGTTGG

Universal T7 Universal SP6

GTAATACGACTCACTATAGGG ATTTAGGTGACACTATAG

bftTNF1-30 F1 bftTNF1-30 F2 bftTNF1-30 F3 bftTNF1-30 F4 bftTNF2-30 F1 bftTNF2-30 F2 bftIL1-30 F1 bftIL1-30 F2 GeneRacerÔ 30 Primer GeneRacerÔ 30 Nested Primer

GGATTTGCGACGACTGTG GCTGGAGTGGAGAGTTGAT TCTTGGTGCCGTGTTTCAG ACGGAAACCAATCAGCAAT CCCTCAATCCGGCCTCTACTTTG CCATCTGAGCCATACTGTGAAGCG AGTGGACGACAAAAACAGCC GAGCGACAAGGTACGGTTTC GCTGTCAACGATACGCTACGTAACG

bftTNF1-50 R1 bftTNF1-50 R2 bftTNF2-50 R1 bftTNF2-50 R2 bftIL1-50 R1 bftIL1-50 R2 bftIL1-50 R3 bftIL1-50 R4 GeneRacerÔ 50 Primer GeneRacerÔ 50 Nested Primer

TTTCCCGCTCCCTGCTCGTCG TGGCTGTAGACGAAGTAGAGGC CATTGTCCTCTCCTTGTCCTGTCC CAACAAGGAGAGCAGTAGCAGCCG AAGGTTCGGTAGCGGTTGGCGG GGTGCTAATATTCTTCCCAGTGTCC CTCACTCTCTAACACACTTTGCTCC CCAGCAAGATGTTGAGCAGG CGACTGGAGCACGAGGACACTGA

bftTNF1-gF bftTNF1-gR bftTNF2-gF bftTNF2-gR bftIL1-gF

GAGAGAAGTATCACCACAGAGCG CTTCGTATCCTCTCAATTAGTATCACAGC Primers used to AGGAAACACACAACGCAGAG obtain genomic AGGCAAACACACCAAAGAAGG DNA GGGATAACCAACCAAACTAACAGAAC

bftbactin-rtF bftbactin-rtR bftTNF1-rtF bftTNF1-rtR bftTNF2-rtF bftTNF2-rtR bftIL1-rtF bftIL1-rtR

CAGGGAGTGATGGTGGGTATGG GAAGGTCTCGAACATGATCTGGGTC GAAAACGTCTCACACCTCTCAGCC CAGCTGAAACACGGCACCAA CAGTGGAATGGAAAAATCAGG CTTCACAGTATGGCTCAGATGG GAAATGAGATGCAACGTGAGCG CACTTTGCTCCTCTAAAATGCTGTCC

Use

Primers used to obtain initial fragments

Universal primers

Primers for 30 RACE

CGCTACGTAACGGCATGACAGTG

Primers for 50 RACE

GGACACTGACATGGACTGAAGGAGTA

Primers for expression studies

2.1. Atlantic BFT sampling All fish handling procedures followed established standards for the care and use of animals, which were previously approved by the Ethical committee for animal welfare at the Institute of Oceanography and Fisheries, Croatia. Atlantic BFT were sampled three times during the rearing process (total N ¼ 29). The first group comprised juvenile fish (8e10 kg) that were caught in the central part of the South Adriatic Sea, transferred in a towing cage tugged to the farming site and left for acclimation for two weeks in the farming cage (newly caught). The second group were reared juvenile BFT with wounds and lesions on the skin that led to mortalities in some instances during the acclimation period (damaged BFT). Lastly, the third group were tuna reared for one and a half years and sampled at harvest time (farm-acclimated BFT). Fish necropsy included assessment of gross pathology and histopathology, bacteriology and parasitology as previously described [3,5]. Damaged fish showed signs of septicemia (data not shown).

2.2. cDNA production Liver and head kidney tissues were extracted from 29 fish (9 newly caught BFT, 10 damaged BFT, 10 farm-acclimated BFT) and stored in RNAlater (Qiagen) at 20  C until RNA extraction. Total RNA was extracted from 50 to 100 mg of tissue using Tri Reagent (Sigma Aldrich, USA) following the manufacturer’s instructions and dissolved in 20e40 ml RNase/DNase free water (Sigma Aldrich). RNA was quantified using a Nanodrop Spectrophotometer (Nanodrop Technologies) and stored at 80  C if not used immediately. Prior to cDNA synthesis, total RNA was treated with 1 unit/ml RNase free DNase I (Fermentas Life Sciences, Germany) following the manufacturer’s instructions. cDNA was then synthesized from 5 mg of total RNA using BioscriptÔ (Bioline, UK) with oligo dT, following the manufacturer’s instructions, and used as a template for PCR and real-time PCR. Production of cDNA for 30 and 50 RACE was performed also from 5 mg of total RNA, but using a GeneRacerÔ Kit (Life

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

100

Technologies, instructions.

Invitrogen)

following

the

manufacturer’s

2.3. Genomic DNA extraction Genomic DNA (gDNA) was isolated from BFT tail or dorsal fin clips, preserved in absolute ethanol, following a simplified DNA isolation procedure [58] and stored in TE buffer. DNA quantity and quality were assessed using a spectrophotometer (Eppendorf, Qiagen, Ilden, Germany), at 260 and 280 nm. Samples with a 260/ 280 ratio between 1.7 and 1.9 were used as templates in PCR reactions. After isolation the gDNA was kept at 20  C for long-term storage.

2.4. Cloning and sequencing of Atlantic BFT IL-1b, TNFa1 and TNFa2 cDNA and gene organization The initial BFT TNFa1, TNFa2 and IL-1b fragments were isolated using cDNA derived from liver tissue RNA and the primers bftTNF1F/bftTNF1-R, bftTNF2-F/bftTNF2-R and bftIL1-F/bftIL1-R respectively (Table 1; Fig. 1), designed to areas of highest homology of aligned teleost TNF sequences. Obtained fragments were cloned, sequenced and subsequently used to design BFT-specific primers for later use with GeneRacerÔ 50 and 30 Primers (Table 1; Fig. 1). All PCR reactions were run in 25 ml reactions combining 1 ml of each primer (10 mM), 1 ml of cDNA, along with 2.5 ml of 10 X PCR buffer, 1 ml of MgCl2 (50 mM), 0.5 ml of dNTP (0.25 mM each), 0.1 ml of

Fig. 1. Positions of primers used to clone the Atlantic BFT TNFa1, TNFa2 and IL-1b cDNA and gDNA sequences. Primers are illustrated with arrows and lines represent relative size and positions of the resulting products (Prod).

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

BIOTAQÔ DNA Polymerase (5 u/ml; Bioline, UK) and DNase/RNase free PCR water, to a volume of 25 ml. PCR conditions were as follows: 1 cycle of 94  C for 5 min, 35 cycles of 94  C for 30 s, annealing at temperatures specific to each primer pair (58e65  C) for 30 s and 72  C for 1 min, followed by 1 cycle of 72  C for 10 min. PCR products were visualized on a 1% agarose gel containing ethidium bromide (100 ng/ml). Products of the expected size were ligated into pGEM-T Easy Vector (Promega, Madison, WI) following the manufacturer’s instructions. After transfection into RapidTrans TAM1 competent Escherichia coli (Active Motif, US), cells were grown on MacConkey agar (Sigma Aldrich, USA) at 37  C overnight. Clones were than screened for PCR insert using T7 and SP6 primers (Table 1). Colonies containing the correct size insert were grown overnight in 5 ml LB medium containing ampicillin (100 mg/ml), in a shaking incubator at 200 rpm and 37  C. Plasmid DNA from at least 5 independent colonies was purified using a QIAprep Spin Miniprep Kit (Qiagen) following the manufacturer’s instructions. The purified plasmid was sequenced with the vector specific primers T7 forward and SP6 reverse, using Eurofins MWG Operon (UK). Sequences were analyzed for similarity with other known vertebrate sequences using Blast Local Alignment Search Tool (BLAST) [59]. Comparison between more than two sequences was performed using the CLUSTAL W (v1.60) multiple sequence alignment package [60]. Calculation of amino acid and nucleotide homology between sequences was performed using MatGat (Matrix Global Alignment Tool) [61]. The transmembrane region predictions were made using TMpred [62]. Phylogenetic trees were generated with MEGA 5 [63] using the neighbor-joining method, p-distance and complete deletion of gaps. The branches were validated by bootstrap analysis from 10 000 repetitions, which are represented by numbers at the branch nodes. Predicted amino acid sequences were analyzed by SignalP version 3.0 [64] and the hydrophobicity profile was determined using Kyte and Doolittle plots [65]. Protein family signatures were predicted using the PROSITE database [66] and glycosylation sites were determined using NetNGlyc 1.0. Server [67]. 2.5. Protein modeling The three-dimensional models of BFT TNFa1, TNFa2 and IL-1b were predicted by homology modeling using the SWISS-MODEL Protein Modeling Server [68]. Prediction tools PsiPred [69], DISOPRED [70] and MEMSAT [71] within SWISS-MODEL Workspace were used to predict the secondary structure elements, occurrence of disordered regions and putative transmembrane regions, respectively, in order to optimize selection of possible modeling templates. Identification of a suitable template for the BFT protein structures prediction was performed using a BLAST [72] search implemented in SWISS-MODEL Workspace [68]. As the sequence identities between BFT proteins and potential homologous templates with known three-dimensional structure were, in all three

101

cases, less than 50% alternative sequence alignment methods were used to improve quality of the modeling results. Alignments of the protein sequences were made with the ClustalW program in MEGA 5 [63] and some manual refinements were carried out to account for the positions of critical structural features. Several templates and associated alignments were tested and stereo chemical plausibility, packaging quality and global structure quality of the resulting models were evaluated using the PROCHECK [73], ANOLEA [74] and QMEAN [75] programs. Finally, on the basis of the best results, human TNFa (PDB id: 1tnf), human TNFa (PDB id: 2zjc, chain B) and human IL-1b (PDB id: 1iob, chain A) were identified as the most suitable structural templates for model prediction of the BFT TNFa1, TNFa2 and IL-1b, respectively. The resulting theoretical models were displayed as protein monomers and analyzed with SWISS-PDB viewer DeepView [76]. While the IL-1b molecule seemed to exist as a monomer, the trimeric models of BFT TNFa1 and TNFa2 were generated by superposing the homology model with each of the template’s chains (A, B and C). 2.6. Expression studies using real-time PCR For expression analysis of the three BFT cytokines, BFT b-actin was used as the reference gene. The initial BFT b-actin fragment was isolated using mbactin-F and mbactin-R, designed initially to the mouse b-actin sequence (Table 1). PCR conditions for amplification of b-actin were 1 cycle of 94  C for 5 min, 20 cycles of 94  C for 30 s, 58  C for 30 s and 72  C for 1 min, followed by 1 cycle of 72  C for 10 min. PCR products were cloned and sequenced as described in Section 2.4. and the partial sequence of BFT b-actin was used to create specific primers for real-time PCR. The expression of IL-1b, TNFa1, TNFa2 and b-actin was analyzed using real-time PCR target-specific primers bftIL1-rtF/rtR, bftTNF1rtF/rtR, bftTNF2-rtF/rtR and bftbactin-rtF/rtR (Table 1). The suitability of each primer pair in real-time PCR assays was tested using conventional PCR with cDNA and genomic DNA as templates. Samples loaded onto an agarose gel stained with ethidium bromide confirmed that primer pairs did amplify a product of the correct size from the cDNA and that there was no genomic DNA contamination. A negative control (no template) reaction was also performed for each primer pair tested. Real-time PCR was carried out using SYBR green I (Invitrogen Life Technologies) in a LightCycler 480 System (Roche Applied Science, UK). Template cDNA (prepared as described previously) was diluted with 200 ml of TE buffer (pH 8.0) and each sample was run in duplicate. The cycling protocols were as follows: an initial denaturation of 10 min at 95  C, followed by 40 cycles of 95  C for 30 s, annealing at primer specific temperature (58e64  C) for 30 s and 72  C for 30 s, with the melting curve acquired from 75 to 98  C. Fluorescence outputs were measured and recorded at 80  C after each cycle for 40 cycles and quantified by comparison with a serial

Fig. 2. Exon/intron size of Atlantic BFT TNFa1 and TNFa2 vs other known TNFs. The exon/intron sizes of the human, mouse and selected fish species TNFa were obtained from NCBI Human Genome Resources (http://www.ncbi.nlm.nih.gov/genome/).

102

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

Fig. 3. Multiple alignment of the predicted Atlantic BFT TNFa1 and TNFa2 (shown in bold type) with selected known vertebrate TNFa molecules. Identical (*) and similar (: or.) residues identified using CLUSTAL W (v1.60) are indicated. The TNF family signature is boxed. The transmembrane domain is highlighted in light gray, while a potential cleavage site that generates the mature peptide and two cysteine residues crucial for correct folding of the mature TNFa are in dark gray. The only aa difference to the Pacific BFT TNFa1 sequence is indicated with (;). No differences are seen between Atlantic and Pacific BFT TNFa2 sequences. The EMBL accession numbers of the TNFa genes are: Pacific BFT TNFa1, BAG72141.1; Seabream, CAC88353.1; Flounder, BAA94969.1; Trout TNFa1, CAB92316.1; Trout TNFa2, CAC16408.1; Pacific BFT TNFa2, BAG72142.1; Carp TNFa1, CAC84641.2; Carp TNFa2, CAC84642.2; Zebrafish, NP_998024.2; Mouse, BAA19513.1; Human, NP_000585.2.

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

10-fold dilution of reference samples for each primer pair used. Two reference samples were amplified during each run in order to ensure consistency between PCR runs. Transcript levels of both genes were calculated using the LightCycler 480 System integrated software. Expression levels of BFT IL-1b, TNFa1 and TNFa2 cDNAs were normalized to the reference gene, BFT b-actin, which had an average (SEM) ct value of 16.70  0.26 in all samples. The relative expression (presented as arbitrary units) was calculated as the expression of the target gene divided by that of b-actin times 100 000. The results represent the average þ SEM of each group of fish. One-way PERMANOVA based on Euclidae distance was used to test the null hypothesis of no differences in expression level of all three cytokines between three groups of BFT (newly caught BFT, damaged BFT and farm-acclimated BFT). Significance was set at p ¼ 0.05, with p-values being obtained using 999 permutations of unrestricted permutation of row data with Monte-Carlo simulation included. PERMANOVA is a flexible and robust test that can be used with any distance similarity matrix and it constructs an F-ratio from sums of squared distances within and between groups that is analogous to Fisher’s F-ratio [77]. 3. Results 3.1. Cloning and analysis of Atlantic BFT TNFa1 and TNFa2 Using primer pairs bftTNF1-F/bftTNF1-R and bftTNF2-F/ bftTNF2-R (Table 1; Fig. 1A, B) products of 231(Fig. 1A) and 527 bp (Fig. 1B), respectively, were amplified and showed homology to other known TNF genes, especially Pacific BFT (Thunnus orientalis) TNFa genes. These sequences were used to synthesize primers for 30 and 50 RACE (Table 1; Fig. 1). The 30 end of the TNFa1 cDNA was obtained in two parts. PCR was first carried out with bftTNF1-30 F1/GeneRacerÔ 30 Primer, with the second semi-nested PCR carried out with bftTNF1-30 F2/GeneRacerÔ 30 Primer. This led to the amplification of an incomplete 30 untranslated region (UTR). The complete 30 UTR was obtained by PCR carried out with bftTNF1-30 F3/GeneRacerÔ 30 Primer followed by a nested PCR carried out with bftTNF1-30 F4/ GeneRacerÔ 30 Nested Primer (Fig. 1A). The 50 end of TNFa1 was obtained using PCR carried out with bftTNF1-50 R1/GeneRacerÔ 50 Primer, followed by the second nested PCR carried out with bftTNF1-50 R2/GeneRacerÔ 50 Nested Primer (Fig. 1A). The 30 end of TNFa2 cDNA sequence was obtained using bftTNF2-30 F1/GeneRacerÔ 30 Primer, with the second nested PCR carried out with bftTNF2-30 F2/GeneRacerÔ 30 Nested Primer (Fig. 1B). The complete 50 UTR of the TNFa2 sequence was obtained using nested PCR carried out first with bftTNF2-50 R1/GeneRacerÔ 50 Primer and then bftTNF2-50 R2/GeneRacerÔ 50 Nested Primer (Fig. 1B). The TNFa1 cDNA sequence is 1386 bp long (GenBank ID: JQ807663; Supplementary Fig. 1) and consists of a 147 bp 50 UTR, a 744 bp open reading frame (ORF) encoding a protein of 247 amino acids and a 495 bp 30 UTR containing AU-rich elements (ARE), including seven instability motifs (ATTTA), two endotoxinresponsive motifs (ATATTTAT and TTATTTA) and one polyadenylation signal (ATTAAA) located 17 bp upstream of the polyA tail. Primer pair bftTNF1-gF/bftTNF1-gR (Table 1; Fig. 1A) was designed within the 50 and 30 UTR’s of the cDNA sequence to isolate the TNFa1 gene sequence (GenBank ID: JQ807664; Supplementary Fig. 1) that measured 1889 bp, and contained four exons interrupted with three short introns. The first exon includes the 50 UTR and the first 186 bp of the TNFa1 ORF. Exon two contains 52 bp and exon three contains 54 bp of the ORF. Finally, exon four includes 452 bp of the ORF and the entire 30 UTR region. The three introns contain 121, 111 and 271 nucleotides, respectively (Fig. 2), with intron three 1 bp smaller than in Pacific BFT.

103

The TNFa2 cDNA sequence is 999 bp (GenBank ID: KF134538; Supplementary Fig. 2) long with a 738 bp ORF encoding a protein of 245 amino acids. The 50 UTR consists of 63 bp and the 30 UTR of 197 bp, containing two non-canonical polyadenylation signals (ACTAAA), one located 16 bp upstream of the polyA tail. Since the 30 UTR was relatively short compared to Pacific BFT TNFa2 it is possible that the full-length 30 UTR was not fully cloned. No ARE or endotoxin-responsive elements were present. The primer pair bftTNF2-gF/bftTNF2-gR (Table 1; Fig. 1B) was used to isolate the TNFa2 gene sequence (GenBank ID: KF134537; Supplementary Fig. 2) that measured 1908 bp, and also contained four exons and three introns. The first exon includes the 50 UTR and the first 174 bp of the ORF. Exon two contains 28 bp and exon three contains 57 bp of the ORF, while exon four includes 479 bp of the ORF and the entire 30 UTR region. The three TNFa2 introns contain 127, 372 and 411 nucleotides, respectively (Fig. 2; Supplementary Fig. 3), with introns one and two being 2 and 1 bp smaller than in Pacific BFT. Both TNFa genes have the intron splicing consensus (GT/AG) conserved at the 50 and 30 ends of the introns. The gene organization of 4 exons and 3 introns is found in all known vertebrate TNFa molecules determined so far (Fig. 2; Supplementary Fig. 3). Analysis of both BFT TNFa predicted proteins (Fig. 3) revealed a sequence IVIPQSGLYFVYSQA with excellent homology to the TNFa family signature [LV]-x-[LIVM]-x3-G-[LIVMF]-Y-[LIVMFY]2-x2[QEKHL]. The putative TNF-alpha converting enzyme (TACE) cut site is in position E84 e L85 of the TNFa1 amino acid sequence and in position T72 e L73 of the TNFa2 sequence, resulting in mature peptides of 163 and 173 amino acids as in Pacific BFT. A potential transmembrane domain located at position 35e55 (VSGTLLIILLCLGGILLFSWY) of TNFa1 sequence and at position 31e53 (LTTAVLAFTFCFAAAAAT ALLVV) of TNFa2 sequence, were identified using the TMpred software indicating that both BFT TNFa proteins can be membrane-bound. In comparison with other known vertebrate TNFa amino acid sequences it was revealed that two cysteine residues crucial for correct folding of the mature TNFa are conserved in both BFT TNFa1 (C150 and C190) and TNFa2 (C143and C187). While the TNFa1 molecule contained one potential N-glycosylation site at position 94e96, none were found in TNFa2.

Table 2 Amino acid and nucleotide homology of T. thynnus TNFa1 and TNFa2 with human and selected fish sequences. Species

Pacific BFT_TNFa1 Striped beakfish Seabass Yellow Croaker Orange-spotted grouper Seabream Sea perch Turbot Pufferfish Flounder Trout_TNFa1 Trout_TNFa2 Pacific BFT_TNFa2 Carp_TNFa1 Carp_TNFa3 Channel catfish Zebrafish Ayu Carp_TNFa2 Human

TNFa1

TNFa2

Amino acid identity (%)

Nucleotide identity (%)

Amino acid identity (%)

Nucleotide identity (%)

99.6 75.1 73.4 72.6 72.3 70.8 69.7 68.3 60.0 52.5 50.8 49.8 39.0 39.0 39.0 37.8 37.7 35.2 34.8 29.8

98.0 52.4 69.2 75.6 49.8 55.2 54.9 70.4 60.5 62.9 44.0 55.2 46.2 53.7 44.6 46.1 34.5 46.8 31.9 45.7

38.2 40.8 38.4 38.9 40.0 40.0 40.4 41.2 39.2 39.2 40.3 39.6 100.0 37.5 38.3 42.0 37.0 44.0 36.0 25.5

45.8 38.9 41.3 45.3 53.3 37.5 52.4 46.3 45.9 49.6 35.8 44.1 95.6 46.6 42.6 51.6 43.4 38,5 51.4 39.5

104

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

Fig. 4. Phylogenetic analysis of the Atlantic BFT TNFa1 and TNFa2 with other known vertebrate TNFa molecules. The sequences were aligned using CLUSTALW and the tree was generated with MEGA 4 using the neighbor-joining method. The branches were validated by bootstrap analysis from 2000 repetitions and are represented by numbers at the branch nodes. Human Fas ligand was used as an outgroup. The GenBank accession numbers of the TNFa sequences used in this study are as follows: Striped Beakfish TNFa, ACM69339.1; Sea perch TNFa, AAR02413.2; Yellow croaker TNFa, ABK62876.1; Seabass TNFa, AAZ20770.1; Striped trumpeter TNFa, ACQ98509; Orange-spotted grouper TNFa, AEH59794.1; Seabream TNFa, CAC88353.1; Red seabream TNFa, AAP76392.1; Pacific BFT TNFa1, BAG72141.1; Green chromide TNFa, AEM59514.1; Turbot TNFa, ACN41911; Flounder TNFa, BAA94969.1; Pufferfish TNFa, NP_001033074.1; Trout TNFa1, CAB92316.1; Trout TNFa2, CAC16408.1; Pacific BFT TNFa2, BAG72142.1; Ayu TNFa, DD019003; Channel catfish TNFa, NP_001187101.1; Zebrafish TNFa, NP_998024.2; Grass carp TNFa, ADY80577.1; Carp TNFa3, BAC77690.1; Carp TNFa1, CAC84641.2; Carp TNFa2, CAC84642.2; Common brushtail possum TNFa, AAB49506.1; Rat TNFa, AAR91624.1; Mouse TNFa, BAA19513.1; Guinea pig TNFa, AAB06492.1; Rabbit TNFa, NP_001075732.1; Human TNFa, NP_000585.2; Chimpanzee TNFa, BAE92774.1; Macaque TNFa, BAD69724.1; Wolf TNFa, AAB32391.1; Horse TNFa, AAA30959.1; Pig TNFa, NP_999187.1; Llama TNFa, BAC75383.1; Sheep TNFa, CAA39437.1; Red deer TNFa, AAA50759.1; Rough-toothed dolphin TNFa, ABC68490.1; Beluga whale TNFa, AAL56946.1; Human FasL, AAH17502.1.

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

Atlantic BFT TNFa1 and TNFa2 shared highest amino acid and nucleotide identity with the Pacific BFT TNFa homologs (Table 2). BFT TNFa1 also had relatively high identity to other perciformes TNFa molecules but had only 39% amino acid identity to BFT TNFa2. This homology was reflected in the phylogenetic tree analysis (Fig. 4), constructed using the NJ method, that grouped Atlantic BFT TNFa1 with TNFa1 from the Pacific BFT and the other Perciformes, branching away from Cypriniformes and Siluriformes. BFT TNFa2, however, grouped with its homolog in Pacific BFT and appeared closer to the Cyprinid and Silurid molecules. 3.2. Cloning and analysis of Atlantic BFT IL-1b In order to get the initial sequence of IL-1b touchdown PCR was performed using primer pair bftIL1-F/bftIL1-R (Table 1; Fig. 1C). The sequence showed homology with other vertebrate IL-1b genes and was therefore used to design primers for 30 and 50 RACE. The IL-1b 30 end was obtained using bftIL1-30 F1/GeneRacerÔ 30 Primer, with the second nested PCR carried out with bftIL1-30 F2/GeneRacerÔ 30 Nested Primer (Fig. 1C). The 50 end was obtained in two parts. PCR was first carried out with bftIL1-50 R1/GeneRacerÔ 50 Primer, with the second nested PCR carried out with bftIL1-50 R2/GeneRacerÔ 50 Nested Primer, but gave an incomplete 50 UTR. The complete IL-1b 50 UTR was obtained using PCR carried out with bftIL1-50 R3/GeneRacerÔ 50 Primer followed by a nested PCR carried out with bftIL150 R4/GeneRacerÔ 50 Nested Primer (Fig. 1C). The IL-1b cDNA consists of 1294 bp (GenBank ID: KF134540; Supplementary Fig. 4) containing a 177 bp 50 UTR, 459 bp 30 UTR and a 724 bp ORF encoding a protein of 246 amino acids. The IL-1b 30 UTR contains nine instability motifs (ATTTA), three endotoxin-responsive motifs (TTATTTAT) and one polyadenylation signal (AATAAA) 16 bp upstream of the polyA tail. Five instability motifs are also found within the introns. The BFT IL-1b translation contains three potential Nglycosylation sites at positions 8e10, 132e134 and 203e205, respectively. The IL-1b gene organization was obtained by PCR amplification of genomic DNA, using primer pair bftIL1-gF/bftIL150 R1 (Table 1; Fig. 1) that amplified a 2443 bp IL-1b gDNA sequence (GenBank ID: KF134539) (Supplementary Fig. 4). The first exon contains 141 bp of 50 UTR, exon two contains 36 bp of 50 UTR and the first 206 bp of the ORF, exons three and four contain 165 and 134 bp, respectively, of the ORF. Finally, exon five includes 219 bp of the ORF and the entire 30 UTR region. The four introns contain 543, 225, 157 and 224 nucleotides, respectively (Fig. 5, Supplementary Fig. 5). After PCR amplification with bftIL1-gF/bftIL1-gR primer pair with “damaged” BFT liver and head kidney cDNA as template, two transcripts were revealed: a fully spliced RNA transcript (exons 1e5) and a transcript containing exon 1e5 plus intron 1. Analysis of the BFT IL-1b amino acid sequence (Fig. 6) showed a good level of conservation in the predicted 12 b-sheets but the

105

absence of an aspartic acid responsible for the cleavage of mammalian IL-1b, typical of non-mammalian IL-1b’s. The predicted protein revealed a sequence LMSARFPDWYISTAGQDNKPL with homology to the modified IL-1b family signature [FCL]-x-S-[ASLV]xx-[PRS]-xx-[FYLIV]-[LI]-[SCAT]-T-xxxxxxx-[LIVMK]. BFT IL-1b shared highest amino acid identity (96.3%) with its homolog in Southern BFT, followed by lemonfish, trumpeter, mandarin fish, turbot, halibut and olive flounder IL-1b aa molecules, all with more than 60% identity (Table 3). Phylogenetic tree analysis reflected the amino acid homology (Fig. 7), where Atlantic BFT IL-1b branched together with Southern BFT IL-1b inside a larger group consisting of other Perciformes and members of the Pleuronectiformes, separate from the Cypriniformes, and was clearly a member of the fish type II IL-1b0 s [78]

3.3. Homology modeling of bluefin TNFa1, TNFa2 and IL-1b In order to find a suitable template among different sequences in the protein databases, for structure prediction of the first 3D models of immune proteins in tuna, the Atlantic BFT TNFa1, TNFa2 and IL-1b amino acid sequences were analyzed using a BLAST [72] search implemented within the SWISS-MODEL Workspace [68]. The search identified 31 homologous sequences with significant similarity (E-value set at 1  107 and using the blosum62 matrix) with the Atlantic BFT TNFa1, 23 with TNF2 and 20 with IL-1b. Sequences with more than 30% identity with BFT sequences were considered as possible templates. All alignments were performed using ClustalW implemented in MEGA 5 [63]. Three-dimensional models were constructed using human templates identified as the most suitable: TNFa (PDB id: 1tnf, chain B) as template for BFT TNFa1, TNFa (PDB id: 2zjc, chain B) as template for BFT TNFa2, and IL-1b (PDB id: 1iob, chain A) as template for BFT IL-1b. Structure assessments of all three models showed that more than 90% of residues (according to PROCHECK [73]) lie within the allowed regions, with the majority of model parts built correctly and the overall model showing good structural quality. The predicted model of the BFT TNFa1 and TNFa2 monomers form a “jelly roll’’ sandwich composed mainly of b-strands, with an intra molecular disulfide bridge C150eC190 (TNFa1) and C143eC187 (TNFa2) stabilizing each monomer, and showing excellent compatibility with the human TNFa tertiary structures (Fig. 8A,C). The quaternary structure of BFT TNFa1 and TNFa2 trimers were obtained by superposing the predicted BFT TNFa1/TNFa2 monomers onto each of the human trimer chains (Fig. 8B,D). All eight amino acids crucial for maintenance of the human TNFa conformation and two of eleven amino acids involved in receptor binding in human TNFa [79,80] were conserved in both BFT TNFa molecules (Supplementary Fig. 6).

Fig. 5. Comparison of the exon/intron sizes of known IL-1b genes vs Atlantic BFT IL-1b. The intron sizes of the human and mouse IL-1b and selected fish species were obtained from NCBI Human Genome Resources (http://www.ncbi.nlm.nih.gov/genome/).

106

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

Fig. 6. Multiple alignment of the predicted Atlantic BFT IL-1b (shown in bold type) with selected known vertebrate IL-1b molecules. Identical (*) and similar (: or .) residues identified using CLUSTAL W (v1.60) are indicated. Areas of high conservation within the 12 b e sheets are indicated in bold, below the alignment. The IL-1b family signature is shaded. The mammalian ICE cut site crucial for full activation of the mature IL-1b peptide is indicated with (:). Nine aa differences between Atlantic and Southern BFT IL-1b sequence are boxed. The EMBL accession numbers of the IL-1b genes are: Southern BFT AGH24759.1; Seabass, CAC80553.1; Seabream, CAC81783.2; Turbot, CAC33867.2; Trout IL1b1, CAA11684.1; Goldfish IL-1b1, CAC80551.1; Carp IL-1b1, BAA24538.1; Zebrafish, AAH98597.1; Mouse, AAA39276.1; Human, AAA59135.1.

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112 Table 3 Amino acid and nucleotide homology of T. thynnus IL-1b with human and selected fish IL-1b sequences. Species

Amino acid identity (%)

Nucleotide identity (%)

Souther BFT Lemonfish Trumpeter Halibut Turbot Mandarin fish Olive flounder Sea perch Striped beakfish European seabass Orange-spotted grouper Trout IL-1b1 Gilthead seabream Trout IL-1b2 Atlantic cod Haddock Goldfish IL-1b2 Common carp IL-1b2-1 Common carp IL-1b2-2 Zebrafish Common carp IL-1b1 Goldfish IL-1b1 Human Leopard shark Small spotted catshark

96.3 67.5 67.0 65.4 65.4 64.8 63.6 59.8 58.2 57.3 56.5 54.6 52.8 51.6 50.0 50.0 31.3 29.5 28.5 29.3 28.1 27.8 27.2 24.1 23.5

98.2 61.4 56.6 65.6 67.8 71.5 61.1 69.2 64.8 66.4 65.8 57.4 65.1 31.6 52.5 21.2 48.3 39.7 42.7 46.9 49.5 51.0 52.5 50.6 48.5

Atlantic BFT IL-1b showed 40% overall sequence identity with its human homolog (1iobA) but within the 12 b-strands identity was even higher (45%) (Supplementary Fig. 7), suggesting similar folding patterns and therefore similar tertiary structure (Fig. 8E). The predicted Atlantic BFT IL-1b, like the human IL-1b protein, exists as a monomer and forms a so-called b-trefoil structure. However, only one of seven residues important for binding of human IL-1b to its receptor (IL-1RI) [81] were conserved in BFT IL-1b, suggesting a diverse receptor-ligand binding pattern. 3.4. BFT cytokine expression in newly caught, farm-acclimated and damaged fish Initially, a partial Atlantic BFT b-actin sequence was determined (GenBank ID: JF271923), to allow the design of primers to measure real-time expression of this housekeeping gene in this species. The expression levels of BFT b-actin, TNFa1, TNFa2 and IL-1b were measured using real-time PCR in head kidney and liver tissue taken from newly caught Atlantic BFT, farm-acclimated BFT at harvest and damaged juvenile BFT with wounds and lesions on the skin. Using the b-actin gene as a reference, the results showed that all three cytokines were constitutively expressed to some degree in all samples examined, with no significant differences in expression levels of TNFa1 and TNFa2 between the liver and head kidney (p ¼ 0.308 and p ¼ 0.15, respectively) (Fig. 9A,B). However, expression of IL-1b was found to be significantly higher in liver tissue compared to head kidney (p ¼ 0.029) (Fig. 9C). The putative influence of Atlantic BFT health condition on expression level of the three cytokines was further investigated in both liver and head kidney tissue. Damaged fish with wounds showed significantly higher levels of TNFa1 expression in liver tissue compared to newly caught fish (approximately 6 times greater; p ¼ 0.007) and farmacclimated fish at harvest (approximately 8 times greater; p ¼ 0.037) (Fig. 10A). TNFa2 and IL-1b expression was also significantly higher in liver tissue of damaged fish compared to newly caught fish, where expression of TNFa2 was approximately 2.5 times greater (p ¼ 0.034) and expression of IL-1b was approximately 10 times greater (p ¼ 0.003). However, when compared to

107

expression levels in farm-acclimated fish, no significant differences were found (Fig. 10B,C). In head kidney tissue no significant differences in expression of all three cytokines were found between the three groups of tuna. 4. Discussion In this study, we have cloned, sequenced, described and modeled the first cytokine molecules in Atlantic BFT. Additionally the expression of the TNFa1, TNFa2 and IL-1b genes are described at various stages of the farming process. Since activation of proinflammatory cytokines is the first response to any infection or injury, monitoring their expression levels during tuna farming could give information about possible health shifts in reared Atlantic BFT. 4.1. Atlantic BFT TNFa1 and TNFa2 sequences Atlantic BFT TNFa mRNA molecules were comprised of a 744 bp (TNFa1) and 738 bp (TNFa2) open reading frame (ORF) that encoded a protein of 247 (TNFa1) and 245 (TNFa2) amino acids (Figs. 2 and 3), close to the average size of known fish TNFa’s, which is 242 amino acids. Interestingly, the Atlantic BFT TNFa1 mRNA sequence was the same length as it’s homolog in Pacific BFT with identical intron regions, while TNFa2 mRNA was 60 bp shorter with occasion differences within the first two introns. Whilst similar to that reported in Southern BFT TNFa2, it is possible that the 30 UTR was not cloned completely. Although genes with transient expression, like cytokines, often contain within the 30 UTR at least one, but usually several AU-rich sequences which influence the stability of their mRNA [82e84], the TNFa2 30 UTR contained no ARE or endotoxinresponsive elements. This was also found in Pacific BFT TNFa2, giving a rather unique situation compared to other teleost TNFa mRNAs [25,34,85]. The Atlantic BFT TNFa amino acid sequences showed relatively good homology to other known TNFa’s, having high amino acid identity with Pacific BFT TNFa sequences as expected: BFT TNFa2 was identical to its homolog in Pacific bluefin, whereas TNFa1 differed in one amino acid (Proline P29 instead of Alanine). 4.2. Atlantic BFT IL-1b sequence The coding region of the Atlantic BFT IL-1b mRNA sequence comprised 724 bp (Supplementary Fig. 4). The predicted translation of 246 amino acids showed highest identity with Southern BFT IL1b (Table 3) with total of nine different amino acids (Fig. 6). Interestingly, instability motifs (ATTTA) were found in the Atlantic BFT 30 UTR and in all introns, except intron 3. Since the same pattern was seen in trout IL-1b, there is a possibility that these intron instability motifs influence or have a role in regulating splicing of pre-RNA as well as mRNA expression [86]. Furthermore, gene organization analysis revealed that the Atlantic BFT IL-1b gene contains only four introns, in contrast to trout with five introns, and carp and mammals with six introns (Fig. 8). As reported in tilapia, seabream, trout, seabass, carp and human [47,49,53,87,88,40], Atlantic BFT IL-1b has an intron within the 50 UTR and therefore exon 1 is untranslated. The size of Atlantic BFT IL-1b intron 1 was larger than in other fish and human genes, while the remaining introns were typically much shorter than in mammals, resulting in a smaller gene. In cDNA from “damaged” BFT liver and head kidney a second transcript was detected, containing exons 1e5 plus intron 1. Incomplete splicing is often reported in IL-1b genes, as seen in trout where two variants occur: one that retains intron 5 and another with introns 4 and 5 [86]. Retention of introns in IL-1b transcripts is also reported in carp

Fig. 7. Phylogenetic analysis of the Atlantic BFT IL-1b with other known vertebrate IL-1b molecules. The sequences were aligned using CLUSTALWand the tree was generated with MEGA 4 using the neighbor-joining method. The branches were validated by bootstrap analysis from 2000 repetitions and are represented by numbers at the branch nodes. Human and Mouse IFN-g were used as outgroups. The GenBank accession numbers of the IL-1b sequences used in this study are as follows: Yellowfin seabream, AAV74185.1; Blackhead seabream, AFM93777.1; Gilthead seabream, CAC81783.2; Red seabream, AAP33156.1; European seabass, CAC80553.1; Striped beakfish, ACH87392.1; Mandarin fish, AAV65041.1; Trumpeter, ACQ99510.1; Sea perch, ABP38359.1; Orange-spotted grouper, ABV02594.1; Roughskin sculpin, AFH88676.1; Southern BFT, AGH24759.1; Lemonfish, AAT65502.1; Turbot, CAC33867.2; Halibut, ACY54774.1; Olive flounder, BAB86882.1; Tonguefish, ACU55137.1; CCH6376.1; Salmon IL-1b1, NP_001117054.1; Trout IL-1b1, CAA11684.1; Salmon IL-1b2, AGKD01067865; Trout IL-1b2, CAB53541.3; Atlantic cod, CAD79352.2; Haddock, AJ550166.2; Salmon IL-1b3, CCH6376.1; Trout IL-1b3, AJ557021; Zebrafish, AAH98597.1; Goldfish IL-1b2, CAC80552; Common carp IL-1b1, BAA24538.1; Goldfish IL-1b1, CAC80551.1 Common carp IL-1b2-1, CAC19887.1; Common carp IL-1b2-2, CAC19888.1; Chicken, CAA75239.1; African clawed frog, CAB53499; Brush-tailed possum, AAD21871.1; Cow, AAA30585.1; Red deer, AAA62234.1; Sheep, CAA38566.1; Goat, BAA09675.1; Bottle-nosed dolphin, BAA87947.1; Pig, AAA02584.1; Horse, BAA07718.1; Cat, AAA30814.1; Mouse, AAA39276.1; Norway rat, AAA41426.1; Hispid cotton rat, AAL18817.1; Rabbit, BAA04863.1; Human, AAA59135.1; Red-crowned mangabey, AAA86704.1; Pig-tailed macaque, AAA86715.1; Crab-eating macaque, BAA09677; Rhesus monkey, AAA86709.1; Small spotted catshark, CAC80866.1; Leopard shark, AB074142.1; Human IFN-g, 56786138; Mouse IFN-g, 33468859.

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

109

Fig. 8. Homology modeling of Atlantic BFT TNFa1, TNFa2 and IL-1b. Modeling results represented as ribbon diagrams showing: (A,C) superposition of the predicted BFT TNFa1 and TNFa2 monomers (shown in blue and red, respectively) with the human TNFa counterpart (shown in green), with arrows representing beta-strands; (B,D) predicted quaternary structure of BFT TNFa1 and TNFa2 trimers, with each chain represented by a different color and disulfide bridges shown as spheres; (E) superposition of the predicted BFT IL-1b monomer (shown in purple) with the human IL-1b counterpart (shown in green), with arrows representing beta-strands.

[88] and seabass [87], however, it is rather unlikely that these transcript variants have any biological activity [89,90]. 4.3. Homology modeling of Atlantic BFT TNFa1, TNFa2 and IL-1b Atlantic BFT TNFa1 showed good compatibility with the human TNFa tertiary structure, due to the conservation of residues and motifs crucial for the secondary and tertiary structures. These conserved residues included eight amino acids important for the maintenance of the human TNFa conformation [79,80] and were also observed previously within seabass TNFa [32]. On the other hand, the amino acids important for receptor-ligand binding in human TNFa [79,80] are poorly conserved in the Atlantic BFT

TNFa1, indicating that this protein may share the same quaternary structure as the mammalian protein but have different receptorligand binding interactions. Analysis of the human IL-1 (PDB id: 1iobA) protein model interfaces did not reveal any specific interactions that could result in the formation of stable quaternary structures [91]. Likewise, the predicted model of BFT IL-1b suggests it does not form a complex in solution. Like other members of the IL-family, it forms a b-trefoil fold characterized by 12 b-strands; six strands forming a tapered bbarrel, which is closed at the wide end by another six strands [92]. Although BFT IL-1b has similar tertiary structure with its human homolog, it probably binds differently to its receptor (IL-1R1), sharing only one of seven residues essential for that interaction.

110

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

Fig. 9. Atlantic BFT TNFa1 (A), TNFa2 (B) and IL-1b (C) expression in liver and head kidney. Gene expression was normalized against BFT b-actin. Data are presented as means  SD of 5e8 fish per group. The asterisk indicates a significant difference (p < 0.05) in expression of IL-1b between the two tissues.

4.4. Expression of TNFa1/TNFa2 in cage-reared Atlantic BFT Atlantic BFT, like Pacific BFT [9], carp [25], trout [34], and salmon [85] express at least two TNFa genes. In contrast, Southern blot analysis revealed the presence of only one TNFa copy in Japanese flounder [20]. In Atlantic BFT TNFa1 and TNFa2 mRNAs are constitutively expressed in liver and head kidney tissue but with no significant difference, although a trend for higher expression in liver was noticeable (Fig. 9A,B). Expression levels of TNFa1 and TNFa2 in liver and head kidney tissue of healthy tuna, were approximately the same magnitude indicating equivalent expression patterns of these genes in Atlantic BFT, as reported in seabream [23]. On the other hand, Kadowaki et al. [9] suggested that in Pacific BFT TNFa1 and TNFa2 are regulated independently. However, it must be highlighted that this conclusion related to up-regulation of TNFa2 in blood compared to other tissues, while liver and head kidney did not show different expression levels of the TNFa genes. Expression of TNFa1 and TNFa2 and their importance as potential biomarkers for cage-reared Atlantic BFT was also evaluated in liver and head kidney in three groups of BFT: 1) healthy, newly caught fish, 2) farm-acclimated fish at harvest, and 3) unacclimated damaged tuna (Fig. 10A,B). The first two groups were apparently healthy tuna, while the latter group exhibited wounds and lesions in different parts of their body, suggesting entrapment in the cage net or abrasions from fast swimming in high density. They also showed behavioral changes, in the form of slower and unbalanced swimming, disorientation and lack of appetite, suggesting they may have ongoing infections. While TNFa1 showed a significantly higher expression level in liver of damaged tuna compared to newly caught and farm-acclimated fish, TNFa2 was only significantly

higher in damaged tuna compared to newly caught fish. The magnitude of TNFa1 expression was also higher than for TNFa2. Other studies have also seen different expression patterns when two or more TNFa genes are present [9,13,25,34,85,93]. It has also been speculated that in some cases different expression of TNFa1 and TNFa2 is a result of different numbers of instability motifs in 30 UTR that may influence the mRNA half-life and translation efficiency. In contrast, Atlantic BFT TNFa2 has no instability motifs whilst TNFa1 has seven, but they have the same expression pattern. These diverse findings probably result from differences in the cells and tissues being examined, the duration of stimulation or infection, as well as mechanisms influencing mRNA stability. The abundance of melano-macrophage centers in liver could be one explanation for the increased cytokine gene expression seen in damaged fish at this site, especially as it is well known in mammals that the liver can produce acute phase proteins and pro-inflammatory cytokines such as TNFa and interleukins [94e96]. 4.5. Expression of IL-1b in cage-reared Atlantic BFT Atlantic BFT IL-1b was constitutively expressed in all samples examined, with a significantly higher expression in liver than in head kidney (Fig. 9C). In other in vivo studies in fish [43,47,50,88] IL1b was not expressed constitutively but was induced after stimulation. Our results are therefore rather unique, although we speculate that because we examined cage-reared tuna in the natural environment there is a possibility that newly caught and farmacclimated tuna, although not infected or injured, were under low levels of stimulation from environmental conditions or stress that induced the IL-1b expression seen. IL-1b had the highest

Fig. 10. Expression analysis of TNFa1, TNFa2 and IL-1b in different groups of cage-reared Atlantic BFT. TNFa1 (A), TNFa2 (B) and IL-1b (C) expression in liver and head kidney of newly caught, damaged and farm-acclimated tuna, normalized against BLT b-actin. Data are presented as means  SD of 5e10 fish per group. Asterisks indicate significant differences (p < 0.05) in expression relative to damaged juveniles.

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

expression level of all three cytokines examined, and it was significantly increased in damaged tuna compared to newly caught fish (but not farm-acclimated fish) (Fig. 10C). Induction of IL-1b is usually a transient phenomenon, as seen in tilapia stimulated with LPS [47]. However, precedents for a more chronic impact on IL-1b expression are seen in fish with ectoparasite infections [97,98]. Thus, chronic injuries, similar to chronic parasite infections, may lead to the prolonged responses seen in this study. In conclusion, our study on Atlantic BFT, where an mixture of diverse (a)biotic factors affect the caged fish, has indicated that all three target cytokines (TNFa1, TNFa2 and IL-1b) may be useful biomarkers for Atlantic BFT health status. Their transcriptional regulation in natural conditions should continue to be investigated in order to better understand the optimal rearing process for future Atlantic BFT cultivation. It is clear from this investigation, and from what has been found in other species, that a lot more work needs to be done to determine the role of genes involved in the immune response of tuna. Ultimately, having these tools will allow more informative studies into the issues that are emerging with the farming of tuna, eventually helping to improve farming practice, ensuring more sustainable and welfare centered rearing conditions. Acknowledgments The authors gratefully acknowledge Marimar Costa Portela, Rino   Stanic and Tanja Segvi c Bubi c for their advice and assistance in different aspects of this study. This work was supported by the Croatian Ministry of Science, Education and Technology (0010000000-3633) and Unity Through Knowledge Fund (23/08). Ivana Lepen Plei c was funded by the Croatian Science Foundation through its Fellowships for Doctoral Students (I-3922-2010). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2013.10.011. References [1] Block BA, Stevens ED. Tuna: physiology, ecology, and evolution. Amsterdam: Gulf Professional Publishing; 2001. [2] Ottolenghi F. Capture-based aquaculture of bluefin tuna. In: Lovatelli A, Holthus PF, editors. Capture-based aquaculture. Global overview 2008. p. 169e82. FAO Fisheries Technical Paper 508. [3] Mladineo I, Mileti c I, Bo cina I. Photobacterium damselae subsp piscicida outbreak in cage-reared Atlantic bluefin tuna Thunnus thynnus. J Aquat Anim Health 2006;1:51e4. [4] Hayward CJ, Ellis D, Foote D, Wilkinson RJ, Crosbie PBB, Bott NJ, et al. Concurrent epizootic hyperinfections of sea lice (predominantly Caligus chiastos) and blood flukes (Cardiocola forsteri) in ranched Southern bluefin tuna. Vet Parasitol 2010;173:107e15.   [5] Mladineo I, Segvi c T, Petri c M. Do captive conditions favor shedding of parasites in the reared Atlantic bluefin tuna (Thunnus thynnus)? Parasitol Int 2011;60:25e33. [6] Saeij JP, Van Muiswinkel WB, Groeneveld A, Wiegertjes GF. Immune modulation by fish kinetoplastid parasites: a role for nitric oxide. Parasitology 2002;124:77e86. [7] Tort L, Balasch JC, MacKenzi S. Fish health challenge after stress. Indicators of immunocompetence. Contrib Sc 2004;2:443e54. [8] Watts M, Kato K, Munday BL, Burke CM. Ontogeny of immune system in northern bluefin tuna (Thunnus orientalis, Temmnick and Schlegel 1844). Aquac Res 2003;34:13e21. [9] Kadowaki T, Harada H, Sawada Y, Kohchi C, Soma GI, Takahashi Y, et al. Two types of tumor necrosis factor-a in bluefin tuna (Thunnus orientalis) genes: molecular cloning and expression profile in response to several immunological stimulants. Fish Shellfish Immunol 2009;27:585e94. [10] Aiken HM, Hayward CJ, Crosbie P, Watts M, Nowak BF. Serological evidence of an antibody response in farmed Southern bluefin tuna naturally infected with the blood fluke Cardicola forsteri. Fish Shellfish Immunol 2008;25:66e75. [11] Mladineo I, Block BA. Expression of cytokines IL-1beta and TNF-alpha in tissues and cysts surrounding Didymocystis wedli (Digenea, Didymozoidae) in the Pacific bluefin tuna (Thunnus orientalis). Fish Shellfish Immunol 2010;29: 487e93.

111

[12] Kirchhoff NT, Rough KM, Nowak BF. Moving cages further offshore: effects on Southern bluefin tuna, T. maccoyii, parasites, health and performance. PLoS One 2011;6:2370e5. [13] Polinski M, Bridle A, Nowak B. Temperature-induced transcription of inflammatory mediators and the influence of Hsp70 following LPS stimulation of southern bluefin tuna peripheral blood leukocytes and kidney homogenates. Fish Shellfish Immunol 2013;34:1147e57. [14] Whyte SK. The innate immune response of finfish e a review of current knowledge. Fish Shellfish Immunol 2007;23:1127e51. [15] Janeway Jr CA, Travers P. Immunobiology. The immune system in health and disease. 3rd ed. New York: Garland Publishing Inc/Current Biology Ltd; 1997. [16] Frederick WG, Planas JV, MacKenzie S. Tumor necrosis factor. Dev Comp Immunol 2004;28:487e97. [17] Cunha FQ, Assreuy J, Moss DW, Rees D, Leal LM, Moncada S, et al. Differential induction of nitric oxide synthase in various organs of the mouse during endotoxaemia: role of TNF-alpha and IL-1-beta. Immunology 1994;8:211e5. [18] Kisich KO, Higgins M, Diamond G, Heifets L. Tumor necrosis factor alpha stimulates killing of Mycobacterium tuberculosis by human neutrophils. Infect Immun 2002;70:4591e9. [19] Kohchi C, Inagawa H, Nishizawa T, Yamaguchi T, Nagai S, Soma G. Applications of lipopolysaccharide derived from Pantoea agglomerans (IP-PA1) for health care based on macrophage network theory. J Biosci Bioeng 2006;10:485e96. [20] Hirono I, Nam BH, Kurobe T, Aoki T. Molecular cloning, characterization, and expression of TNF cDNA and gene from Japanese flounder Paralychthys olivaceus. J Immunol 2000;16:4423e7. [21] Bobe J, Goetz FW. Molecular cloning and expression of a TNF receptor and two TNF ligands in the fish ovary. Comp Biochem Physiol B Biochem Mol Biol 2001;129:475e81. [22] Laing KJ, Wang T, Zou J, Holland J, Hong S, Bols N, et al. Cloning and expression analysis of rainbow trout Oncorhynchus mykiss tumour necrosis factor-alpha. Eur J Biochem 2001;268:1315e22. [23] Garcia-Castillo J, Pelegrin P, Mulero V, Meseguer J. Molecular cloning and expression analysis of tumor necrosis factor alpha from marine fish reveal its constitutive expression and ubiquitous nature. Immunogenetics 2002;54: 200e7. [24] Cai ZH, Song LS, Gao CP, Wu LT, Qiu LH, Xiang JH. Cloning and expression of tumor necrosis factor (TNFalpha) cDNA from red seabream Pagrus major. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) e Acta Bioch Biophy Sinica 2003;35:1111e6. [25] Saeij JP, Stet RJ, de Vries BJ, van Muiswinkel WB, Wiegertjes GF. Molecular and functional characterization of carp TNF: a link between TNF polymorphism and trypanotolerance? Dev Comp Immunol 2003;27:29e41. [26] Zou J, Secombes CJ, Long S, Miller N, Clem LW, Chinchar VG. Molecular identification and expression analysis of tumor necrosis factor in channel catfish (Ictalurus punctatus). Dev Comp Immunol 2003;27:845e58. [27] Savan R, Kono T, Igawa D, Sakai M. A novel tumor necrosis factor (TNF) gene present in tandem with the TNF-alpha gene on the same chromosome in teleosts. Immunogenetics 2005;57:140e50. [28] Praveen K, Evans DL, Jaso-Friedmann L. Constitutive expression of tumor necrosis factor-alpha in cytotoxic cells of teleosts and its role in regulation of cell-mediated cytotoxicity. Mol Immunol 2006;43:279e91. [29] Ordas MC, Costa MM, Roca FJ, Lopez-Castejon G, Mulero V, Meseguer J, et al. Turbot TNF-alpha gene: molecular characterization and biological activity of the recombinant protein. Mol Immunol 2007;44:389e400. [30] Grayfer L, Walsh JG, Belosevic M. Characterization and functional analysis of goldfish (Carassius auratus L.) tumor necrosis factor-alpha. Dev Comp Immunol 2008;32:532e43. [31] Uenobe M, Kohchi C, Yoshioka N, Yuasa A, Inagawa H, Morii K, et al. Cloning and characterization of a TNF-like protein of Plecoglossus altivelis (ayu fish). Mol Immunol 2007;44:1115e22. [32] Nascimento DS, Pereira PJ, Reis MI, do Vale A, Zou J, Silva MT, et al. Molecular cloning and expression analysis of sea bass (Dicentrarchus labrax L.) tumor necrosis factor-alpha (TNF-alpha). Fish Shellfish Immunol 2007;23: 701e10. [33] Morrison RN, Zou J, Secombes CJ, Scapigliati G, Adams MB, Nowak BF. Molecular cloning and expression analysis of tumour necrosis factor-alpha in amoebic gill disease (AGD)-affected Atlantic salmon (Salmo salar L.). Fish Shellfish Immunol 2007;23:1015e31. [34] Zou J, Wang T, Hirono I, Aoki T, Inagawa H, Honda T, et al. Differential expression profiles of two tumor necrosis factor genes in rainbow trout, Oncorhynchus mykiss. Dev Comp Immunol 2002;26(2):161e72. [35] Gearing AJ, Beckett P, Christodoulou M, Churchill M, Clements J, Davidson AH, et al. Processing of tumour necrosis factor-alpha precursor by metalloproteinases. Nature 1994;370:555e7. [36] McGeehan GM, Becherer JD, Bast RC, Boyer CM, Champion B, Connolly KM. Regulation of tumour necrosis factor e a processing by a metalloproteinase inhibitor. Nature 1994;370:558e61. [37] Moss ML, Jin SL, Milla ME, Bickett DM, Burkhart W, Carter HL, et al. Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha. Nature 1997;385:733e6. [38] Ware CF, Santee S, Glass A. Tumor necrosis factor related ligands and receptors. In: Thomson A, editor. The cytokine handbook. San Diego: Academic Press; 1998. p. 549e92. [39] Bird S, Zou J, Wang T, Munday B, Cunningham C, Secombes CJ. Evolution of interleukin-1b. Cytokine Growth Factor Rev 2002;13:483e502.

112

I. Lepen Pleic et al. / Fish & Shellfish Immunology 36 (2014) 98e112

[40] Dinarello CA. Interleukin-1 family (IL-1F1, F2). In: Thomson A, Lotze M, editors. The cytokine handbook. London: Elsevier Science Ltd; 2003. p. 643e68. [41] Dinarello CA. Interleukin-1. Cytokine Growth Factor Rev 1997;8:253e65. [42] Bird S, Wang T, Zou J, Cunningham C, Secombes CJ. The first cytokine sequence within cartilaginous fish: IL-1b in the small spotted catshark (Scyliorhinus canicula). J Immunol 2002;168:3329e40. [43] Corripio-Miyar Y, Bird S, Tsamopoulos K, Secombes CJ. Cloning and expression analysis of two pro-inflammatory cytokines, IL-1b and IL-8, in haddock (Melanogrammus aeglefinus). Mol Immunol 2007;44:1361e73. [44] Fujiki K, Shin D-H, Nakao M, Yano T. Molecular cloning and expression analysis of carp (Cyprinus carpio) interleukin-1b, high affinity immunoglobulin E Fc receptor gamma subunit and serum amyloid A. Fish Shellfish Immunol 2000;20:229e42. [45] Hong S, Zou J, Crampe M, Peddie S, Scapigliata G, Bols N, et al. The production and bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant IL-1b. Vet Immunol Immunopathol 2001;81:1e14. [46] Jiang SG, Zhang DC, Li JZ, Liu ZX. Molecular characterization, recombinant expression and bioactivity analysis of the interleukin-1 beta from the yellowfin sea bream, Acanthopagrus latus (Houttuyn). Fish Shellfish Immunol 2008;24:323e36. [47] Lee D-S, Hong SH, Lee H-J, Jun LJ, Chung J-K, Kim KH, et al. Molecular cDNA cloning and analysis of the organization and expression of the IL-1b gene in Nile tilapia, Oreochromis niloticus. Comp Biochem Physiol 2006;143:307e14. [48] Lu DQ, Bei JX, Feng LN, Zhang Y, Liu XC, Wang L, et al. Interleukin-1 beta gene in orange-spotted grouper, Epinephelus coioides: molecular cloning, expression, biological activities and signal transduction. Mol Immunol 2008;45: 857e67. [49] Pelegrin P, Garcia-Castillo J, Mulero V, Meseguer J. Interleukin-1b isolated from a marine fish reveals up-regulated expression in macrophages following activation with lipopolysaccharide and lymphokines. Cytokines 2001;16:67e 72. [50] Scapigliati G, Buonocore F, Bird S, Zou J, Pelegrin P, Falasca C, et al. Phylogeny of cytokines: molecular cloning and expression analysis of sea bass Dicentrarchus labrax interleukin-1b. Fish Shellfish Immunol 2001;11:711e26. [51] Wang T, Johnson N, Zou J, Bols N, Secombes CJ. Sequencing and expression of the second allele of the interleukin-1b1 gene in rainbow trout (Oncorhynchus mykiss): identification of a novel SINE in the third intron. Fish Shellfish Immunol 2004;16:335e58. [52] Wang YP, Wang Q, Baoprasertkul P, Peatman E, Liu ZJ. Genomic organization, gene duplication, and expression analysis of interleukin-1b in channel catfish (Ictalurus punctatus). Mol Immunol 2006;43:1653e64. [53] Zou J, Grabowski PS, Cunningham C, Secombes CJ. Molecular cloning of interleukin 1b from rainbow trout Oncorhynchus mykiss reveals no evidence of an ICE cut site. Cytokines 1999;11:552e60. [54] Carretti D, Kozlosky C, Mosley B, Nelson N, Vanness K, Greenstreet T, et al. Molecular cloning of the interleukin-1 beta converting enzyme. Science 1992;256:97e100. [55] Thornberry N, Bull H, Calaycay J, Chapman K, Howard A, Kostura M, et al. A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 1992;356:768e74. [56] Tocci M. Structure and function of interleukin-1 b converting enzyme. Vitam Horm 1997;53:27e63. [57] Nicola N. Guidebook to cytokine and their receptors. Oxford: Sambrook and Tooze; 1994. [58] Laird PW, Zijderveld A, Linders K, Rudnicki MA, Jaenisch R, Berns A. Simplified mammalian DNA isolation procedure. Nucleic Acids Res 1991;19:4293. [59] Altschul S, Gish W, Miller W, Myers E, Lipman D. Basic local alignment research tool. J Mol Biol 1990;215:403e10. [60] Thomson J, Higgins D, Gibson T. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22: 4673e80. [61] Campanella JJ, Bitnicka L, Smalley J. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinformatics 2003;4:29. [62] Hofmann K, Stoffel W. TMbase e a database of membrane spanning proteins segments. Biol Chem Hoppe-Seyeler 1993;374:166e70. [63] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28: 2731e9. [64] Dirløv Bendtsen J, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 2004;340:783e95. [65] Kyte J, Doolittle R. A simple method for displaying the hydropathic character of a protein. J Mol Biol 1982;157:105e42. [66] Hulo N, Bairoch V, Cerutti L, Cuche BA, de Castro E, Lachaize C, et al. The 20 years of PROSITE. Nucleic Acids Res 2007;36:D245e9. [67] Gupta R, Jung E, Brunak S. Prediction of N-glycosylation sites in human proteins. NetNGlyc 10, http://www.cbs.dtu.dk/services/NetGlyc/; 2004. [68] Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a webbased environment for protein structure homology modelling. Bioinformatics 2006;22:195e201. [69] Jones DT. Protein secondary structure prediction based on position-specific scoring matrices. J Mol Biol 1999;292:195e202.

[70] Jones DT, Ward JJ. Prediction of disordered regions in proteins from position specific score matrices. Proteins 2003;53:573e8. [71] Jones DT, Taylor WR, Thornton JM. A model recognition approach to the prediction of all-helical membrane protein structure and topology. Biochemistry 1994;33:3038e49. [72] Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389e402. [73] Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Cryst 1993;26:283e91. [74] Melo F, Feytmans E. Assessing protein structures with a non-local atom in interaction energy. J Mol Biol 1998;277:1141e52. [75] Benkert P, Tosatto SC, Schomburg D. QMEAN: a comprehensive scoring function for model quality assessment. Proteins 2008;71:261e77. [76] Guex N, Peitsch MC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 1997;18:2714e23. [77] Anderson MJ. A new method for non-parametric multivariate analysis of variance. Austral Ecol 2001;26:32e46. [78] Husain M, Bird S, van Zwieten R, Secombes CJ, Wang T. Cloning of the IL-1b3 gene and IL-1b4 pseudogene in salmonids uncovers a second type of IL-1b1 gene in teleost fish. Dev Comp Immunol 2012;38:431e46. [79] Van Ostade X, Tavernier J, Prange T, Fiers W. Localization of the active site of human tumour necrosis factor (hTNF) by mutational analysis. EMBO J 1991;10:827e36. [80] Zhang XM, Weber I, Chen MJ. Site-directed mutational analysis of human tumor necrosis factor-alpha receptor binding site and structure functional relationship. J Biol Chem 1992;267:24069e75. [81] Labriola-Tompkins E, Chandran C, Kaffka KL, Biondi D, Graves BJ, Hatada M, et al. Identification of the discontinuous binding site in human interleukin 1 beta for the type I interleukin 1 receptor. Proc Natl Acad Sci U S A 1991;8: 11182e6. [82] Caput D, Beutler B, Hartog K, Thayer R, Brown-Shimer S, Cerami A. Identification of a common nucleotide sequence in the 30-untranslated region of mRNA molecules specifying inflammatory mediators. Proc Natl Acad Sci U S A 1986;83:1670e4. [83] Roca FJ, Cayuele ML, Secombes CJ, Meseguer J, Mulero V. Post-transcriptional regulation of cytokine genes in fish: a role for conserved AU-rich elements located in the 3’ untranslated region of their mRNAs. Mol Immunol 2007;44: 472e8. [84] Sachs AB. Messenger RNA degradation in eukaryotes. Cell 1993;74:413e21. [85] Haugland Ø, Mercy IS, Romøren K, Torgersen J, Evensen Ø. Differential expression profiles of two tumor necrosis factor-a variants in Atlantic salmon (Salmo salar L.). Mol Immunol 2007;44:1652e63. [86] Zou J, Cunningham C, Secombes CJ. The rainbow trout Oncorhynchus mykiss interleukin-1b gene has different organization to mammals and undergoes incomplete splicing. Eur J Biochem 1999;259:901e8. [87] Buonocore F, Prugnoli D, Falasca C, Secombes CJ, Scapigliati D. Peculiar gene organization and incomplete splicing of sea bass (Dicentrarchus labrax) interleukin-1b. Cytokines 2003;21:257e64. [88] Engelsma MY, Stet RJ, Schipper H, Verburg-van Kemenade BM. Regulation of interleukin 1b RNA expression in common carp, Cyprinus carpio L. Dev Comp Immunol 2001;25:195e203. [89] Scapigliati G, Costantini S, Colonna G, Facchiano A, Buonocore F, Bossu P, et al. Modelling of fish interleukin-1 and its receptor. Dev Comp Immunol 2004;28: 429e41. [90] Peddie S, Zou J, Cunningham C, Secombes CJ. Rainbow trout (Oncorhynchus mykiss) recombinant IL-1beta and derived peptides induce migration of headkidney leucocytes in vitro. Fish Shellfish Immunol 2001;11:697e709. [91] Shaanan B, Gronenborn AM, Cohen GH, Gilliland GL, Veerapandian B, Davies DR, et al. Combining experimental information from crystal and solution studies: joint X-ray and NMR refinement. Science 1992;257: 961e4. [92] Murzin AG, Lesk AM, Chothia C. beta-Trefoil fold. Patterns of structure and sequence in the Kunitz inhibitors interleukins-1 beta and 1 alpha and fibroblast growth factors. J Mol Biol 1992;223:531e43. [93] Sigh J, Lindenstrom T, Buchmann K. Expression of pro-inflammatory cytokines in rainbow trout (Oncorhynchus mykiss) during an infection with Ichthyophthirius multifiliis. Fish Shellfish Immunol 2004;17:75e86. [94] Gao B, Jeong W-I, Tian Z. Liver: an organ with predominant innate immunity. Hepatology 2007;47:729e36. [95] González-Amaro R, García-Monzón C, García-Buey L, Moreno-Otero R, Alonso JL, Yagüe E, et al. Induction of tumor necrosis factor alpha production by human hepatocytes in chronic viral hepatitis. J Exp Med 1994;179:841e8. [96] Li Z, Diehl AM. Innate immunity in the liver. Curr Opin Gastroenterol 2003;19: 565e71. [97] Cavello JM, Bird S, Morrison RN, Battaglene SC, Secombes CJ, Nowak BF. Cloning and expression analysis of three striped trumpeter (Latris lineata) proinflammatory cytokines, TNF-a, IL-1b and IL-8, in response to infection by the ectoparasitic, Chondracanthus goldsmidi. Fish Shellfish Immunol 2009;26: 773e86. [98] Fast MD, Muise DM, Easy DM, Ross NW, Johnson SC. The effects of Lepeophtheirus salmonis infections on the stress response and immunological status of Atlanic salmon (Salmon salar). Fish Shellfish Immunol 2006;21: 228e41.