Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle

GENE-40602; No. of pages: 8; 4C: Gene xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle Feng-Gong Lü a, Kai-Yun Fu a, Wen-Chao Guo b, Guo-Qing Li a,⁎ a b

Education Ministry Key Laboratory of Integrated Management of Crop Diseases and Pests, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China Department of Plant Protection, Xinjiang Academy of Agricultural Sciences, Urumqi 830091, China

a r t i c l e

i n f o

Article history: Received 11 January 2015 Received in revised form 29 April 2015 Accepted 11 June 2015 Available online xxxx Keywords: Leptinotarsa decemlineata Juvenile hormone epoxide hydrolase RNA interference Juvenile hormone titer Performance

a b s t r a c t In insect, juvenile hormone (JH) titers are tightly regulated in different development stages through synthesis and degradation pathways. During JH degradation, JH epoxide hydrolase (JHEH) converts JH to JH diol, and hydrolyses JH acid to JH acid diol. In this study, two full length LdJHEH cDNAs were cloned from Leptinotarsa decemlineata, and were provisionally designated LdJHEH1 and LdJHEH2. Both mRNAs were detectable in the thoracic muscles, brain–corpora cardiaca–corpora allata complex, foregut, midgut, hindgut, ventral ganglia, Malpighian tubules, fat bodies, epidermis, and hemocytes of the day 2 fourth-instar larvae, and in female ovaries as well as male reproductive organs of the adults. Moreover, both LdJHEH1 and LdJHEH2 were expressed throughout all larval life, with the highest peaks occurring 32 h after ecdysis of the final (fourth) instar larvae. Four double-stranded RNAs (dsRNAs) (dsJHEH1-1, dsJHEH1-2, dsJHEH2-1, dsJHEH2-2) respectively targeting LdJHEH1 and LdJHEH2 were constructed and bacterially expressed. Ingestion of dsJHEH1-1, dsJHEH1-2, dsJHEH2-1, dsJHEH2-2, and a mixture of dsJHEH1-1 + dsJHEH2-1 successfully knocked down corresponding target gene function, and significantly increased JH titer and upregulated Krüppel homolog 1 (LdKr-h1) mRNA level. Knockdown of either LdJHEH1 or LdJHEH2, or both genes slightly reduced larval weight and delayed larval development, and significantly impaired adult emergence. Therefore, it is suggested that knockdown LdJHEH1 and LdJHEH2 affected JH degradation in the Colorado potato beetle. © 2015 Elsevier B.V. All rights reserved.

1. Introduction During development, juvenile hormone (JH) III acts in conjunction with 20-hydroxyecdysone (20E), to regulate larval–larval molting and larval–pupal metamorphosis (De Kort et al., 1982; Vermunt et al., 1999b) in the Colorado potato beetle Leptinotarsa decemlineata (Say), a notorious defoliator of potato in most major potato-growing areas of the world (Alyokhin et al., 2008; Alyokhin, 2009). JH is present throughout late embryonic development and larval life, and ensures that 20Einduced molting yields another larval stage and thereby allows for continued growth of the insect larvae (Riddiford, 1994). In the absence of JH, a pulse of 20E initiates larval–pupal metamorphosis (Goodman and Cusson, 2012). Thus, the synthesis and degradation of JH must be tightly regulated in different development stages (Hammock, 1985). In insect, JH is principally degraded by two hydrolases, JH epoxide hydrolase (JHEH,

Abbreviations: JH, juvenile hormone; 20E, 20-hydroxyecdysone; JHEH, juvenile hormone epoxide hydrolase; JHE, juvenile hormone esterase; RNAi, RNA interference; dsRNA, double-stranded RNA; ANOVA, analysis of variance. ⁎ Corresponding author. E-mail addresses: [email protected] (F.-G. Lü), [email protected] (K.-Y. Fu), [email protected] (W.-C. Guo), [email protected] (G.-Q. Li).

EC 3.3.2.3) and JH esterase (JHE, EC 3.1.1.1) (Share and Roe, 1988; Debernard et al., 1998; Hirai et al., 2002; Maxwell et al., 2002a,b; Li et al., 2005; Zhang et al., 2005). JHEH belongs to the microsomal epoxide hydrolase family, and transforms epoxides to compounds with decreased chemical reactivity, increased water solubility, and altered biological activity (Arand et al., 2005; Morisseau and Hammock, 2005). JHEH hydrolyses JH to JH diol (JHd), and converts JH acid (JHa) to JH acid diol (JHad) (Share and Roe, 1988). JHE is a member of the carboxylesterase family. It hydrolyzes JH to yield JHa, and catalyzes JHd to produce JHad (Share and Roe, 1988). Several JHEH genes have been cloned from insect species such as Manduca sexta (Wojtasek and Prestwich, 1996), Bombyx mori (Hirai et al., 2002; Zhang et al., 2005), Trichoplusia ni (Harris et al., 1999), Ctenocephalides felis (Keiser et al., 2002), Tribolium castaneum (Tsubota et al., 2010) and Apis mellifera (Mackert et al., 2010). The copy numbers of the JHEH genes vary. B. mori genome shows the presence of an authentic JHEH and five JHEH-like genes (Zhang et al., 2005; Seino et al., 2010; Cheng et al., 2014), while there are three JHEH-like genes in Drosophila melanogaster, three in Anopheles gambiae, one in A. mellifera, five in T. castaneum, and seven in Danaus plexippus (Mackert et al., 2010; Cheng et al., 2014). However, very little is known about the JH degrading activity of JHEH. A specific partition assay based on the inhibition of all of the JHE

http://dx.doi.org/10.1016/j.gene.2015.06.032 0378-1119/© 2015 Elsevier B.V. All rights reserved.

Please cite this article as: Lü, F.-G., et al., Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.032

2

F.-G. Lü et al. / Gene xxx (2015) xxx–xxx

activity present in insect tissue extracts (Share and Roe, 1988) has been used to determine to which extent JHEH participates in JH degradation (Touhara and Prestwich, 1993; Wojtasek and Prestwich, 1996; Debernard et al., 1998). The assay reveals that JHEH is as critical as JHE in degrading JH in certain insects (Campbell et al., 1992; Halarnkar et al., 1993; Lassiter et al., 1995; Debernard et al., 1998). In the fourth larval instar of Culex quinquefasciatus, for example, JHEH activity is higher than JHE activity (Lassiter et al., 1995), implying its major function in JH degradation. In D. melanogaster, both JHEH and JHE participate in JH catabolism during pupal to adult development, whereas JHEH is the main JH-hydrolyzing enzyme in adults (Khlebodarova et al., 1996). In contrast, JHE plays a more important role than JHEH in JH catabolism in C. felis (Keiser et al., 2002), Drosophila virilis (Khlebodarova et al., 1996) and A. mellifera (Mackert et al., 2010). In L. decemlineata, two putative JHE genes have been documented (Vermunt et al., 1997a,b, 1998, 1999a). Thus, we focused on JHEH in this study, and cloned two putative JHEH genes. Dietary introduction of double-stranded RNAs (dsRNAs: dsJHEH1-1, dsJHEH1-2, dsJHEH2-1, dsJHEH2-2, and a mixture of dsJHEH1-1 + dsJHEH2-1) against JHEH genes successfully knocked down the target genes at the fourth (final) larval instar. Moreover, we found that knockdown of either LdJHEH1 or LdJHEH2, or both genes increased the relative JH III levels in the hemolymph, and impaired adult emergence. 2. Methods and materials 2.1. Insect rearing L. decemlineata larvae and adults were reared in an insectary according to a previously described method (Zhou et al., 2013), using potato foliage at vegetative growth or tuber initiation stages. 2.2. Molecular cloning and phylogenetic analysis Two expressed sequence tags of putative LdJHEH genes were obtained from L. decemlineata transcriptome data (Kontogiannatos et al., 2013; Shi et al., 2013; Swevers et al., 2013; Kumar et al., 2014). To verify the correctness of the sequences, total RNA was isolated using TRIzol reagent according to the manufacturer's protocol from the fourth-instar larvae. Contaminating genomic DNA was removed by treatment with RNase-free DNase I (Invitrogen). One microgram of total RNA was reverse transcribed using the reverse transcriptase (M-MLV RT) (Takara Bio., Dalian, China). The cDNA sample was used as a template for polymerase chain reaction (PCR) using primers in Table 1. This was followed by 5′- and 3′-RACE to complete the sequence, with a SMARTer RACE cDNA amplification kit (Takara Bio., Dalian, China) and the SMARTer RACE kit (Takara Bio.). The antisense/sense gene-specific primers and specific nested primers corresponding to the 5′-ends and 3′-ends of the sequences were listed in Table 1. After obtaining the full-length cDNAs, two primer pairs (Table 1) were designed to verify the complete open reading frames (ORFs). The resulting sequences (LdJHEH1 and LDJHEH2) were submitted to GenBank (KP271045 and KP271046). Transmembrane domains were predicted using TMHMM 2.0 (www. cbs.dtu.dk/services/TMHMM). The JHEH sequences were retrieved from NCBI, and were respectively aligned with the predicted LdJHEH1 and LdJHEH2 using ClustalX (2.1) (Larkin et al., 2007). A neighbor-joining (NJ) tree of the JHEHs was constructed using MEGA6 (Tamura et al., 2013) under the Poisson correction method. The reliability of NJ tree topology was evaluated by bootstrapping a sampling of 1000 replicates. 2.3. Preparation of dsRNA The same method as described recently (Zhou et al., 2013) was used to express dsJHEH1-1 and dsJHEH1-2 derived from a 284 bp and 316 bp fragment of LdJHEH1, dsJHEH2-1 and dsJHEH2-2 from a 456 bp and

Table 1 Primers used in RT-PCR, 5′ and 3′ RACE, ORF verification, dsRNA synthesis, and qRT-PCR. Fragment name RT-PCR LdJHEH1 LdJHEH2 RACE LdJHEH1 5′-G LdJHEH1 5′-N LdJHEH1 3′-G LdJHEH1 3′-N LdJHEH2 5′-G LdJHEH2 5′-N LdJHEH2 3′-G LdJHEH2 3′-N

Forward primer

Reverse primer

CGGTTAAGCCAACCATTC GGAGGAAAAATGGTGGGG

CTTCACGTAGCTGCCAGT ACAGGGCTATCTCGTAGGGC

GCTGCCAGTTTGGATTGGTGCC TGGGGCCTTGTTAGGATCGGCA TGCCGATCCTAACAAGGCCCCA CAACGAGTCTCCTTTGGGATTGGC ATGTGCAGCATTTAGGCCGGGG TCGTAGAACTCCCTGACCGACCCTG TGCTGTTCGCCCCGGCCTAAAT GTGTCGCCCTACGAGATAGCCCTGT

ORF verification LdJHEH1 TGTATCACCTTCCTCATT LdJHEH2 GTTTGTACTTTGTAGCCGTAGC

TGTTATCAAGTAAATCGG ACAATTTCTCCACCTTATCGGT

dsRNA synthesis dsLdJHEH1-1 CTTCCTCATTATAGTCACA dsLdJHEH1-2 TACAACTGGAGAGAACGC dsLdJHEH2-1 TCCTCTACAGCTTCTATCCCTC dsLdJHEH2-2 ACTTTGTAGCCGTAGCTTGGGT dsegfp AAGTTCAGCGTGTCCG

CCTCAAGAGGTGGTGTTA TTTTGAATACCAACGCTA ACATCTCTCTCAAAATTGCCTC GGAAGGGCAGAGTGTCTGTCAG CTTGCCGTAGTTCCAC

qRT-PCR qLdJHEH1 qLdJHEH2 qLdKr-h1

TTGGTGCCAGATGTGAATTT ACCGGTATCTTTGGATGGAG AATTGGGAGGCGTAACAGTC

TGCAAGCTACGAAACCTGAC CTTCGGCGGCTATTAAACTC CGATGGTCTCAGAAGAAGGG

268 bp fragment of LdJHEH2, as well as dsegfp from a 414 bp fragment of the enhanced green fluorescent protein gene. The five dsRNAs were individually expressed with specific primers in Table 1, using Escherichia coli HT115 (DE3) competent cells lacking RNase III. Individual colonies were inoculated, and induced to express dsRNA by the addition of 0.1 mM isopropyl β-D-1-thiogalactopyranoside. The expressed dsRNA was extracted and confirmed by electrophoresis on 1% agarose gel (data not shown). Bacteria cells were centrifuged at 5000 × g for 10 min, and resuspended in 0.05 M phosphate buffered saline (PBS, pH 7.4) at the ratio of 1:1 (concentration of 1×), and then used for bioassay. The concentration of dsRNA in bacterial suspension was about 0.05 μg/μl.

2.4. Bioassay Bioassay was carried out with the newly-emerged fourth-instar larvae, with the same protocol as described recently (Kong et al., 2014). Briefly, potato leaves were individually dipped in one of the solutions/ suspensions containing (1) PBS (blank control), (2) dsegfp (negative control), (3) dsJHEH1-1, (4) dsJHEH1-2, (5) dsJHEH2-1, (6) dsJHEH2-2, or (7) dsJHEH1-1 + dsJHEH2-2 for 5 s. The treated leaves were dried for 2 h under airflow on filter paper, and then placed in Petri dishes (9 cm in diameter and 1.5 cm in height). The fourth-instar larvae were confined in petri dishes with one of the immerged-foliage. Each treatment was repeated 12 times. Six replicates were respectively used to extract total RNA and JH after continuously fed for 3 days. The remaining 6 replicates were fed on treated leaves for 3 days, and then kept on normal leaves in glass cups (5.0 cm in diameter and 15 cm in height) containing approximately 2/3 cup of soil to observe mortalities, larval weight and larval duration. The initiation of pupation was indicated by the soil-digging behavior. After the larvae in the remaining 6 replicates buried into soil for 7 days, three replicates in each treatment were randomly selected, removed all soil to check for pupation, whereas the other three replicates were continuously kept in soil to check for adult emergence. The emergence rates were evaluated during a 4-week trial period. Three biological replicates were carried out.

Please cite this article as: Lü, F.-G., et al., Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.032

F.-G. Lü et al. / Gene xxx (2015) xxx–xxx

2.5. Real-time quantitative PCR (qRT-PCR) For tissue expression analysis, cDNA templates were derived from the thoracic muscles, brain–corpora cardiaca–corpora allata complex, ventral ganglia, foregut, midgut, hindgut, Malpighian tubules, fat bodies, epidermis, and hemocytes of the day 2 fourth-instar larvae (I4D2). The templates were also prepared from female ovaries and male reproductive organs of the adults. For temporal expression analysis, cDNA templates were derived from the first (I1D0, I1D1, I1D2), second (I2D0, I2D1, I2D2), and third (I3D0, I3D1, I3D2) larval instars at an interval of one day, and from the fourth larval instars (I4H0, I4H8, I4H16, I4H24, I4H36, I4H48, I4H56, I4H64, I4H72, I4H80, I4H88 and I4H96) at an interval of 8 h (IxD0/IxH0 indicated newly ecdysed larvae), and from wandering larvae (W) one day after stopping to feed. For analysis of the effects of dsRNAs, total RNA was extracted from larvae subjected to 3-days of dsRNA exposure. For all samples, the RNA was extracted using an SV Total RNA Isolation System Kit (Promega). Each sample contained 5–20 individuals and repeated in biological triplicate. Quantitative mRNA measurements were performed by qRT-PCR in technical triplicate and normalized to internal control genes (RP18, RP4, ARF1, and ARF4) (Wan et al., 2013) using the 2−ΔΔCt method (Pfaffl, 2001; Vandesompele et al., 2002).

3

there was variation in the acidic residue of the catalytic triad: these amino acids are Asp, His, and Glu for most JHEHs, but are Asp, His, and Asp for LdJHEH1 and TcJHEH-3 (Fig. 1). JHEHs from M. sexta (Grieneisen et al., 1995; Wojtasek and Prestwich, 1996; Debernard et al., 1998), T. ni (Harris et al., 1999), and C. felis (Keiser et al., 2002) have a strong hydrophobic transmembrane anchor of approximately 20 residues at the N-terminus (Craft et al., 1990; Friedberg et al., 1994). Moreover, AmJHEH from A. mellifera contains two transmembrane helices (Mackert et al., 2010). We predicted the presence of a transmembrane domain using the software TMHMM 2.0. As expected, both LdJHEH1 and LdJHEH2 contain a transmembrane domain at the N-terminus (Fig. 2). The evolutionary relationship of JHEH-like proteins derived from cDNAs of 15 insect species was evaluated (Fig. 3). The JHEH-like proteins formed order based separate clades for Coleoptera, Siphonaptera, Hymenoptera, Lepidoptera and Diptera. Amongst the JHEHs in the Diptera clade, two from Aedes aegypti and C. quinquefasciatus formed a Nematocera subclade with 100% bootstrap support, and four from D. melanogaster and Bactrocera dorsalis formed a Cyclorrhapha subclade with 99% bootstrap support. These two subclades then joined together to form the Diptera clade, supported by bootstrap values of 98%. As expected, LdJHEH1 and LdJHEH2 belonged to the Coleoptera clade (Fig. 3).

2.6. JH titer measurement 3.2. The expression of LdJHEH genes Hemolymph was collected following the method described previously (Wan et al., 2014). The same method as described recently (Zhou et al., 2013) was used to extract JH. Liquid chromatography tandem mass spectrometry was used to quantify JH titers (ng per ml hemolymph) (Cornette et al., 2008). 2.7. Data analysis The data were pooled from three independent biological replicates, given as means ± SE, and were analyzed by ANOVAs followed by the Tukey–Kramer test, using SPSS for Windows (SPSS, Chicago, IL, USA). 3. Results 3.1. Identification of LdJHEH genes Two full length cDNAs of putative LdJHEH genes were cloned in L. decemlineata, and were provisionally designated LdJHEH1 and LdJHEH2. The LdJHEH1 cDNA consists of 1495 bp. Its ORF has the length of 1374 bp that encodes a 458 amino-acid protein. LdJHEH2 cDNA contains 1409 bp. It possesses an ORF of 1356 bp that encodes a 452 amino-acid protein. We analyzed and compared the amino acid sequence of eight JHEHlike proteins from insect species (Fig. 1). JHEH belongs to the microsomal epoxide hydrolase family (Arand et al., 2005; Morisseau and Hammock, 2005). The overall structure of BmJHEH from B. mori consists of three parts: the N-terminal region (Leu33–Tyr118), the α/β domain (Pro119–Leu255 and Gln392–Asn456) and the lid domain (Ser256– Val391). The N-terminal segments of LdJHEH1, LdJHEH2 and others contain a conserved ‘XWG’ motif (where X is an aromatic residue) (Fig. 1). This motif has been found to function as an anchor for the membrane association (Gilbert et al., 2000). The BmJHEH expressed in Sf9 cell was membrane-bounded (Zhang et al., 2005). These data suggests that both LdJHEH1 and LdJHEH2 may be membrane-bounded proteins in L. decemlineata. As a typical α/β hydrolase, the active site of BmJHEH contains a conserved catalytic triad, Asp227, His430, and Glu403. Moreover, the active-site pocket of BmJHEH has two tyrosine residues (Tyr298 and Tyr373), which stabilize and donate protons to the oxygen atom of the epoxide ring (Yamada et al., 2000). The catalytic triad and two Tyr residues were conserved in LdJHEH1, LdJHEH2 and others. However,

The tissue expression patterns of LdJHEH1 and LdJHEH2 were tested by qRT-PCR. Both mRNAs were detected in the thoracic muscles, brain– corpora cardiaca–corpora allata complex, foregut, midgut, hindgut, ventral ganglia, Malpighian tubules, fat bodies, epidermis, and hemocytes of the day 3 fourth-instar larvae, and female ovaries and male reproductive organs of the adults. LdJHEH1 was highly expressed in the thoracic muscles, foregut, midgut and hindgut. LdJHEH2 was highly expressed in the brain–corpora cardiaca–corpora allata complex, hindgut, Malpighian tubules and female ovaries (Fig. 4). The temporal expression profiles of both LdJHEH cDNAs were also determined in the larvae. They were expressed throughout all developmental stages. Within the first, second and third larval instars, the expression levels of both LdJHEH1 and LdJHEH2 were higher just before and right after the molt, and were lower in the intermediate instar. In the fourth larval instar, the highest peaks of both LdJHEH1 and LdJHEH2 occurred 32 h after ecdysis (Fig. 5). 3.3. Effect of dsJHEH1, dsJHEH2 and their mixture on JH signaling Ingesting dsJHEH1-1, dsJHEH1-2, dsJHEH2-1, dsJHEH2-2, or a mixture of dsJHEH1-1 + dsJHEH2-1 for 3 days by the four-instar larvae decreased LdJHEH1 mRNA abundance by 94.5%, 90.7%, 14.0%, 20.1% and 77.5%; and reduced LdJHEH2 transcripts by 13.5%, 9.0%, 58.5%, 63.5% and 76.5% respectively, compared with blank control. In contrast, LdJHEH mRNA levels varied little in dsegfp-ingested larvae. ANOVA analysis revealed that dsJHEH1-1, dsJHEH1-2, dsJHEH2-1 and dsJHEH2-2 successfully knocked down their corresponding genes, and the mixture silenced both LdJHEH1 and LdJHEH2 (Fig. 6, the first and second panels). As expected, exposure of the final larval instars to dsJHEH1-1, dsJHEH1-2, dsJHEH2-1, dsJHEH2-2, and the mixture for 3 days increased 2.5, 3.3, 2.5, 2.7, and 4.8-fold JH titers respectively, compared with blank control. In contrast, JH titers did not change in dsegfp-ingested larvae. ANOVA analysis showed that knockdown of either LdJHEH1 or LdJHEH2, or both genes significantly affected JH degradation (Fig. 6, the third panel). Since the Krüppel homolog 1 gene (Kr-h1) is a JH early-inducible gene in L. decemlineata (Zhou et al., 2013; Kong et al., 2014) and in other insect species (Minakuchi et al., 2008, 2009; Lozano and Belles, 2011; Kayukawa et al., 2012), LdKr-h1 expression levels in L. decemlineata

Please cite this article as: Lü, F.-G., et al., Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.032

4

F.-G. Lü et al. / Gene xxx (2015) xxx–xxx

Fig. 1. Multiple alignment of eight insect JHEHs. The N-terminal membrane anchor motif “XWG” is labeled as triangles. The structure, α-helices and β-sheets, are indicated above the alignment according to the result from B. mori (Zhou et al., 2014). The catalytic triad (Asp225, His429, and Asp404), HGWP motif and two tyrosine residues (Tyr297 and Tyr374) are labeled as stars (the amino acid position is in LdJHEH1). All sequences were downloaded from the NCBI database (www.ncbi.nlm.nih.gov). The sequences are (NCBI accession number codes are in parentheses) Tribolium castaneum JHEH-like proteins 1 and 3 (T.cas-1, NP_001161904.1; T.cas-3, NP_001161906.1), Drosophila melanogaster JHEH-like protein 2 (D.mel-2, NP_611386.2), Ctenocephalides felis JHEH-like protein 1 (C.fel-1, Q8MZR6.3) Bombyx mori JHEH 1 (B.mor, NP_001037201.1) and Harpegnathos saltator JHEH-like protein (H.sal, EFN83232).

RNAi hypomorphs were tested. Ingestion of dsJHEH1-1, dsJHEH1-2, dsJHEH2-1, dsJHEH2-2, and the mixture at the final instar significantly increased 3.7, 3.8, 3.7, 2.6 and 4.1-fold the LdKr-h1 mRNA levels.

ANOVA analysis revealed that high JH titers resulted in high LdKr-h1 mRNA levels in the RNAi hypomorphs of LdJHEH1, LdJHEH2 or both genes (Fig. 6, lower panel).

Fig. 2. Transmembrane domains of LdJHEH1 and LdJHEH2. The domains were predicted using TMHMM 2.0, and were indicated by arrows.

Please cite this article as: Lü, F.-G., et al., Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.032

F.-G. Lü et al. / Gene xxx (2015) xxx–xxx

5

Fig. 3. Phylogenetic analysis of JHEH homologs from different insect species based on amino acid sequences. JHEH-like proteins originate from two Coleoptera Leptinotarsa decemlineata (L.dec) and Tribolium castaneum (T.cas), a Siphonaptera Ctenocephalides felis (C.fel), four Hymenoptera Athalia rosae (A.ros), Acromyrmex echinatior (A.ech), Camponotus floridanus (C.flo), and Harpegnathos saltator (H.sal), four Lepidoptera Manduca sexta (M.sex), Trichoplusia ni (T.ni), Helicoverpa armigera (H.arm) and Bombyx mori (B.mor), and four Diptera Aedes aegypti (A.aeg), Culex quinquefasciatus (C.qui), Drosophila melanogaster (D.mel) and Bactrocera dorsalis (B.dor). Bootstrap values (1000 replicates) are displayed by the nodes. The genetic distance is drawn to scale.

3.4. Effect of dsJHEH1, dsJHEH2 and their mixture on larval performance

4. Discussion

Continuous ingestion of dsJHEH1-1, dsJHEH1-2, dsJHEH2-1, dsJHEH2-2, and the mixture slightly reduced larval weight and delayed larval development, and significantly impaired adult emergence. In contrast, knockdown of either LdJHEH1 or LdJHEH2, or both genes did not affect survivorship and pupation of L. decemlineata larvae (Table 2).

Coincident with its physiological function, JH titer is tightly regulated in different development stages through synthesis and degradation pathways (Hammock, 1985). In the present paper, we focused on JH degradation and cloned two putative JHEH genes in L. decemlineata. We compared the amino acid sequences of two LdJHEHs with several homologs from other insect species. We found minor but significant

Fig. 4. Tissue expression patterns of LdJHEH genes. cDNA templates were derived from thoracic muscles (TM), brain–corpora cardiaca–corpora allata complex (BR), foregut (FG), midgut (MG), hindgut (HG), ventral ganglia (VG), Malpighian tubules (MT), fat bodies (FB), epidermis (EP), and hemocytes (HE) of the day 2 fourth-instar larvae. The templates were also from female ovaries (OV) and male reproductive organs (MRO) of the adults. For each sample, 3 independent pools of 5–30 individuals were measured in technical triplicate using qRT-PCR. The bars represent 2−ΔΔCt method (±SE) normalized to the geometrical mean of housekeeping gene expression.

Please cite this article as: Lü, F.-G., et al., Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.032

6

F.-G. Lü et al. / Gene xxx (2015) xxx–xxx

Fig. 5. Temporal expression patterns of LdJHEH genes. cDNA templates were derived from the whole bodies of the first (I1D0, I1D1, I1D2), second (I2D0, I2D1, I2D2), and third (I3D0, I3D1, I3D2) larval instars at an interval of one day, and from the fourth larval instars (I4H0, I4H8, I4H16, I4H24, I4H36, I4H48, I4H56, I4H64, I4H72, I4H80, I4H88 and I4H96) at an interval of 8 h (IxD0/IxH0 indicated newly ecdysed larvae), and from wandering larvae (W) one day after stopping to feed. For each sample, 3 independent pools of 5–30 individuals were measured in technical triplicate using qRT-PCR. The bars represent 2−ΔΔCt method (±SE) normalized to the geometrical mean of housekeeping gene expression.

variation in the residue of the catalytic acid: these amino acids are Asp, His, and Glu for most insect JHEHs, but are Asp, His, and Asp for LdJHEH1 and TcJHEH-3. Previous analysis revealed that the substitution of this

Fig. 6. Effects of dietary ingestion of dsJHEH on JH signaling. The newly-enclosed fourthinstar larvae were allowed to ingest potato foliage immersed with water (blank control), dsegfp (negative control), dsJHEH1-1, dsJHEH1-2, dsJHEH2-1, dsJHEH2-2, or a mixture of dsJHEH1-1 + dsJHEH2-1 for 3 days. LdJHEH1 and LdJHEH2 expression levels (the first and second panels), JH titer (the third panel), and LdKr-h1 transcripts (the fourth panels) of the whole bodies were measured. The relative transcripts and JH titers were the ratios of the data in treated larvae to that in blank control larvae. The columns represent averages with vertical lines indicating SE. Bars topped with the same lowercase or uppercase letters are not statistically different at P b 0.05 or 0.01.

Glu to Asp in rat mEH increased the substrate turnover rate, and the conversion of the corresponding Asp of Aspergillus niger mEH to Glu decreased the turnover rate (Arand et al., 1999a,b). Examination of enzymatic activities using recombinant TcJHEH proteins showed that TcJHEH-3 with Asp, His and Asp catalytic triads had strong degradation activity for JH III (Tsubota et al., 2010). Comparably, recombinant BmJHEH from B. mori with Asp, His and Glu catalytic triads showed high levels of enzyme activity (Zhang et al., 2005). In the present paper, we did not measure the enzymatic activities of LdJHEH1 and LdJHEH2. We suggest that both LdJHEHs may be involved in JH degradation in L. decemlineata. Our results showed that LdJHEH1 and LdJHEH2 transcripts were detected in the thoracic muscles, brain–corpora cardiaca–corpora allata complex, foregut, midgut, hindgut, ventral ganglia, Malpighian tubules, fat bodies, epidermis, and hemocytes of the day 2 fourth-instar larvae, and female ovaries and male reproductive organs of the adults. Similarly, in B. mori JHEH was expressed in almost all tested tissues such as the Malpighian tubules, silk glands, hemocytes, epidermis, fat bodies, midgut, head and genitalia (Yang et al., 2011). This indicated that JHEH might degrade JH in various tissues. In holometabolous insects, a pulse of 20-hydroxyecdysone (20E) and high JH titer elicit larval–larval molt, whereas a pulse of 20E and a drop in JH during the final larval instar trigger larval–pupal metamorphosis (Dubrovsky, 2005). It seems that rapid degradation of JH at the final-instar stage is critical for larval–pupal metamorphosis. In this study, we found that the highest peaks of both LdJHEH1 and LdJHEH2 occurred 32 h after ecdysis of the final larval instar. Consistent with our results, JHE and JHE-l1 were highly expressed during B. mori pupation (Zhang et al., 2005). JHEH, JHEH-l2, JHEH-l4, and JHEH-l5 were mainly expressed before wandering. JHEH-l1 and JHEH-l3 displayed a high expression in females during pupa–adult transition (Cheng et al., 2014). Similarly, clones of TcJHEH-3, possessing strong JH-degrading activity, were found only in T. castaneum larval stage (Tsubota et al., 2010). Such a high level of expression of JHEH mRNA in the early stage of the final larval instar is also observed in T. ni (Harris et al., 1999). These results are compatible with the common idea that JHEH functions in the final larval instars for JH degradation.

Please cite this article as: Lü, F.-G., et al., Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.032

F.-G. Lü et al. / Gene xxx (2015) xxx–xxx

7

Table 2 The performance of L. decemlineata subjected to dietary dsRNA exposure.

Weight (mg) Duration (days) Survivorship Pupation rate Emergence rate

CK

dsegfp

dsJHEH1-1

dsJHEH1-2

dsJHEH2-1

dsJHEH2-2

Mixture

132.5 ± 10.4 a 6.2 ± 0.4 a 1.00 ± 0.00 a 1.00 ± 0.00 a 0.95 ± 0.00 a

130.6 ± 11.3 a 6.0 ± 0.3 a 0.95 ± 0.00 a 0.95 ± 0.00 a 0.96 ± 0.00 a

122.5 ± 13.2 a 6.5 ± 0.4 a 0.98 ± 0.03 a 0.94 ± 0.04 a 0.54 ± 0.05 b

120.4 ± 10.7 a 6.7 ± 0.3 a 0.95 ± 0.04 a 0.93 ± 0.02 a 0.56 ± 0.04 b

118.7 ± 11.5 a 6.8 ± 0.4 a 0.94 ± 0.04 a 0.90 ± 0.06 a 0.64 ± 0.07 b

125.6 ± 12.0 a 6.6 ± 0.3 a 0.91 ± 0.03 a 0.91 ± 0.055 a 0.58 ± 0.05 b

121.7 ± 12.1 a 6.8 ± 0.4 a 0.95 ± 0.04 a 0.93 ± 0.08 a 0.57 ± 0.07 b

Different lowercase letters in each line indicate significant difference at P value b0.05.

A next step in this study was to downregulate LdJHEH1, LdJHEH2 or both genes using RNAi to evaluate the possible effects on JH signaling and larval performance at the final larval instar stage in L. decemlineata. Our results showed that RNAi-mediated knockdown of either LdJHEH1 or LdJHEH2, or both genes significantly increased JH titer in the hemolymph of the resulting larvae. Moreover, the expression levels of LdKr-h1, a JH early-inducible gene in L. decemlineata (Zhou et al., 2013) and in other insect species (Minakuchi et al., 2008, 2009; Lozano and Belles, 2011; Kayukawa et al., 2012), were significantly increased. This result strongly suggested that both LdJHEH1 and LdJHEH2 were involved in JH degradation in L. decemlineata. Consistent with our results, in certain insects, JHEHs are critical JH degradative enzymes (Campbell et al., 1992; Halarnkar et al., 1993; Lassiter et al., 1995; Khlebodarova et al., 1996; Debernard et al., 1998). Our data showed that knockdown of either LdJHEH1 or LdJHEH2, or both genes using RNAi slightly affected larval growth and delayed larval development, and significantly impaired adult emergence in L. decemlineata. Similarly, knockdown LdAS-C significantly increased JH titer, affected the larval growth and delayed the development (Meng et al., 2015). Moreover, topical application of a JH analogue S-71639 also delayed the onset of pupation and prevented adult emergence in L. decemlineata (Koopmanschap et al., 1989). It appears that L. decemlineata RNAi hypomorphs of LdJHEH1, LdJHEH2 or both genes showed typical phenotypes caused by excess JH or JH analogue. An interesting phenomenon in this study is: knockdown of LdJHEH1, LdJHEH2 or both genes showed similar phenotypic defects. It is suggested that knockdown of a JHEH gene cannot be compensated by high expression of other JHEH genes. A possible explanations is that different JHEHs function in different tissues. Consistent with the suggestion, our results showed that two LdJHEH genes had specific tissue expression patterns. LdJHEH1 was highly expressed in the thoracic muscles, foregut, midgut and hindgut, whereas LdJHEH2 was highly expressed in the brain–corpora cardiaca–corpora allata complex, hindgut, Malpighian tubules and female ovaries. In other insect species, there were also several copy numbers of the JHEH genes (Zhang et al., 2005; Mackert et al., 2010; Seino et al., 2010; Cheng et al., 2014). Moreover, pieces of experimental evidence revealed that JHEH in other insect species also showed specific tissue expression profiles, although there were no comparative studies on expression levels of different JHEH genes. In B. mori, for example, JHEH was highly expressed in the gut, Malpighian tubule and silk gland (Cheng et al., 2014). In Gryllus assimilis, midgut and fat bodies JHEH activities exhibited a mid-stadium peak (Anand et al., 2008). Thus, our results supported the hypothesis proposed by Yang et al. (2011), that different JHEHs, probably JHEs as well, mediate hydrolysis of JH in various tissues. The JH metabolites are then transported to the midgut and further hydrolyzed by JHDK which is then excreted out of the body (Yang et al., 2011). Acknowledgments This research was supported by the National Natural Science Foundation of China (31360442 and 31272047), the Nationally Special Fund of China for Agri-scientific Research in the Public Interest (201103026), the Science and Technology Project of Xinjiang Uygur Autonomous Region (2013911091) and the Fundamental Research Funds for the Central Universities (KYTZ201403).

References Alyokhin, A., 2009. Colorado potato beetle management on potatoes: current challenges and future prospects. Fruit, Veg. Cereal Sci. Biotechnol. 3, 10–19. Alyokhin, A., Baker, M., Mota-Sanchez, D., Dively, G., Grafius, E., 2008. Colorado potato beetle resistance to insecticides. Am. J. Potato Res. 85, 395–413. Anand, A., Crone, E.J., Zera, A.J., 2008. Tissue and stage-specific juvenile hormone esterase (JHE) and epoxide hydrolase (JHEH) enzyme activities and Jhe transcript abundance in lines of the cricket Gryllus assimilis artificially selected for plasma JHE activity: implications for JHE microevolution. J. Insect Physiol. 54, 1323–1331. Arand, M., Cronin, A., Adamska, M., Oesch, F., 2005. Epoxide hydrolases: structure, function, mechanism, and assay. Methods Enzymol. 400, 569–588. Arand, M., Hemmer, H., Dürk, H., Baratti, J., Archelas, A., Furstoss, R., Oesch, F., 1999a. Cloning and molecular characterization of a soluble epoxide hydrolase from Aspergillus niger that is related to mammalian microsomal epoxide hydrolase. Biochem. J. 344, 273–280. Arand, M., Müller, F., Mecky, A., Hinz, W., Urban, P., Pompon, D., Kellner, R., Oesch, F., 1999b. Catalytic triad of microsomal epoxide hydrolase: replacement of Glu404 with Asp leads to a strongly increased turnover rate. Biochem. J. 337, 37–43. Campbell, P.M., Healy, M.J., Oakshott, J.G., 1992. Characterization of juvenile hormone esterase in Drosophila melanogaster. Insect Biochem. Mol. Biol. 22, 665–677. Cheng, D., Meng, M., Peng, J., Qian, W., Kang, L., Xia, Q., 2014. Genome-wide comparison of genes involved in the biosynthesis, metabolism, and signaling of juvenile hormone between silkworm and other insects. Genet. Mol. Biol. 37, 444–459. Cornette, R., Gotoh, H., Koshikawa, S., Miura, T., 2008. Juvenile hormone titers and caste differentiation in the damp-wood termite Hodotermopsis sjostedti (Isoptera, Termopsidae). J. Insect Physiol. 54, 922–930. Craft, J.A., Baird, S., Lamont, M., Burchell, B., 1990. Membrane topology of epoxide hydrolase. Biochim. Biophys. Acta 1046, 32–39. De Kort, C.A.D., Bergot, B.J., Schooley, D.A., 1982. The nature and titre of juvenile hormone in the Colorado potato beetle, Leptinotarsa decemlineata. J. Insect Physiol. 28, 471–474. Debernard, S., Morisseau, C., Severson, T.F., Feng, L., Wojtasek, H., Prestwich, G.D., Hammock, B.D., 1998. Expression and characterization of the recombinant juvenile hormone epoxide hydrolase (JHEH) from Manduca sexta. Insect Biochem. Mol. Biol. 28, 409–419. Dubrovsky, E.B., 2005. Hormonal cross-talk in insect development. Trends Endocrinol. Metab. 16, 6–11. Friedberg, T., Lollmann, B., Becker, R., Holler, R., Oesch, F., 1994. The microsomal epoxide hydrolase has a single membrane signal anchor sequence which is dispensable for the catalytic activity of this protein. Biochem. J. 303, 967–972. Gilbert, L.I., Granger, N.A., Roe, R.M., 2000. The juvenile hormones: historical facts and speculations on future research directions. Insect Biochem. Mol. Biol. 30, 617–644. Goodman, W.G., Cusson, M., 2012. The juvenile hormones. In: Gilbert, L.I. (Ed.), Insect Endocrinology. Academic Press, New York, NY, USA, pp. 310–365. Grieneisen, M.L., Kieckbusch, T.D., Mok, A., Dorman, G., Latli, B., Prestwich, G.D., 1995. Characterization of the juvenile-hormone epoxide hydrolase (JHEH) and juvenilehormone diol phosphotransferase (JHDPT) from Manduca sexta Malpighian tubules. Arch. Insect Biochem. Physiol. 30, 255–270. Halarnkar, P.P., Jackson, G.P., Straub, K.M., Schooley, D.A., 1993. Juvenile hormone catabolism in Manduca sexta: homologue selectivity of catabolism and identification of a diol-phosphate conjugate as a major end product. Experientia 49, 988–994. Hammock, B.D., 1985. Regulation of juvenile hormone titer. In: Kerkut, G.A., Gilbert, L.I. (Eds.), Comprehensive Insect Physiology, Biochemistry and Pharmacology. Pergamon Press, Oxford, pp. 431–472. Harris, S., Thompson, D.M., Linderman, R., Tomalski, M., Roe, R., 1999. Cloning and expression of a novel juvenile hormone-metabolizing epoxide hydrolase during larval–pupal metamorphosis of the cabbage looper, Trichoplusia ni. Insect Mol. Biol. 8, 85–96. Hirai, M., Kamimura, M., Kikuchi, K., Yasukochi, Y., Kiuchi, M., Shinoda, T., Shiotsuki, T., 2002. cDNA cloning and characterization of Bombyx mori juvenile hormone esterase: an inducible gene by the imidazole insect growth regulator KK-42. Insect Biochem. Mol. Biol. 32, 627–635. Kayukawa, T., Minakuchi, C., Namiki, T., Togawa, T., Yoshiyama, M., Kamimura, M., Mita, K., Imanishi, S., Kiuchi, M., Ishikawa, Y., 2012. Transcriptional regulation of juvenile hormone-mediated induction of Krüppel homolog 1, a repressor of insect metamorphosis. Proc. Natl. Acad. Sci. U. S. A. 109, 11729–11734. Keiser, K.C.L., Brandt, K.S., Silver, G.M., Wisnewski, N., 2002. Cloning, partial purification and in vivo developmental profile of expression of the juvenile hormone epoxide hydrolase of Ctenocephalides felis. Arch. Insect Biochem. Physiol. 50, 191–206. Khlebodarova, T.M., Grunteko, N.E., Grenback, L.G., Sukhanova, M.Z., Mazukov, M.M., Rauschenbach, I.Y., Tomas, B.A., Hammock, B.D., 1996. A comparative analysis of

Please cite this article as: Lü, F.-G., et al., Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.032

8

F.-G. Lü et al. / Gene xxx (2015) xxx–xxx

juvenile hormone metabolizing enzymes in two species of Drosophila during development. Insect Biochem. Mol. Biol. 26, 829–835. Kong, Y., Liu, X.-P., Wan, P.-J., Shi, X.-Q., Guo, W.-C., Li, G.-Q., 2014. The P450 enzyme Shade mediates the hydroxylation of ecdysone to 20-hydroxyecdysone in the Colorado potato beetle, Leptinotarsa decemlineata. Insect Mol. Biol. 23, 632–643. Kontogiannatos, D., Swevers, L., Maenaka, K., Park, E.Y., Iatrou, K., Kourti, A., 2013. Functional characterization of a juvenile hormone esterase related gene in the moth Sesamia nonagrioides through RNA interference. PLoS One 8, e73834. Koopmanschap, A.B., Oouchi, H., De Kort, C.A.D., 1989. Effects of a juvenile hormone analogue on the eggs, post-embryonic development, metamorphosis and diapause induction of the Colorado potato beetle, Leptinotarsa decemlineata. Entomol. Exp. Appl. 50, 255–263. Kumar, A., Congiu, L., Lindström, L., Piiroinen, S., Vidotto, M., Grapputo, A., 2014. Sequencing, de novo assembly and annotation of the Colorado potato beetle, Leptinotarsa decemlineata, transcriptome. PLoS ONE 9, e86012. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948. Lassiter, M.T., Apperson, C.S., Roe, R.M., 1995. Juvenile hormone metabolism during the fourth stadium and pupal stage of the Southern House Mosquito Culex quinquefasciatus. J. Insect Physiol. 41, 869–876. Li, S., Zhang, Q.R., Xu, W.H., Schooley, D.A., 2005. Juvenile hormone diol kinase, a calciumbinding protein with kinase activity, from the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 35, 1235–1248. Lozano, J., Belles, X., 2011. Conserved repressive function of Krüppel homolog 1 on insect metamorphosis in hemimetabolous and holometabolous species. Sci. Rep. 1, 163. Mackert, A., Hartfelder, K., Bitondi, M.M.G., Simões, Z.L.P., 2010. The juvenile hormone (JH) epoxide hydrolase gene in the honey bee Apis mellifera genome encodes a protein which has negligible participation in JH degradation. J. Insect Physiol. 56, 1139–1146. Maxwell, R.A., Welch, W.H., Horodyski, F.M., Schegg, K.M., Schooley, D.A., 2002a. Juvenile hormone diol kinase. II. Sequencing, cloning, and molecular modeling of juvenile hormone-selective diol kinase from Manduca sexta. J. Biol. Chem. 277, 21882–21890. Maxwell, R.A., Welch, W.H., Schooley, D.A., 2002b. Juvenile hormone diol kinase. I. Purification, characterization, and substrate specificity of juvenile hormoneselective diol kinase from Manduca sexta. J. Biol. Chem. 277, 21874–21881. Meng, Q.-W., Liu, X.-P., Lü, F.-G., Fu, K.-Y., Guo, W.-C., Li, G.-Q., 2015. Involvement of a putative allatostatin in regulation of juvenile hormone titer and the larval development in Leptinotarsa decemlineata (Say). Gene 554, 105–113. Minakuchi, C., Namiki, T., Shinoda, T., 2009. Krüppel homolog 1, an early juvenile hormoneresponse gene downstream of Methoprene-tolerant, mediates its anti-metamorphic action in the red flour beetle Tribolium castaneum. Dev. Biol. 325, 341–350. Minakuchi, C., Zhou, X., Riddiford, L.M., 2008. Krüppel homolog 1 (Kr-h1) mediates juvenile hormone action during metamorphosis of Drosophila melanogaster. Mech. Dev. 125, 91–105. Morisseau, C., Hammock, B.D., 2005. Epoxide hydrolases: mechanisms, inhibitor designs, and biological roles. Annu. Rev. Pharmacol. Toxicol. 45, 311–333. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45. Riddiford, L.M., 1994. Cellular and molecular actions of juvenile hormones. I: general considerations and premetamorphic actions. Adv. Insect Physiol. 24, 213–273. Seino, A., Ogura, T., Tsubota, T., Shimomura, M., Nakakura, T., Tan, A., Mita, K., Shinoda, T., Nakagawa, Y., Shiotsuki, T., 2010. Characterization of juvenile hormone epoxide hydrolase and related genes in the larval development of the silkworm Bombyx mori. Biosci. Biotechnol. Biochem. 74, 1421–1429. Share, M.R., Roe, R.M., 1988. A partition assay for the simultaneous determination of insect juvenile hormone esterase and epoxide hydrolase activity. Anal. Biochem. 169, 81–88. Shi, X.-Q., Guo, W.-C., Wan, P.-J., Zhou, L.-T., Ren, X.-L., Tursun, A., Fu, K.-Y., Li, G.-Q., 2013. Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say). BMC Res. Notes 6, 93.

Swevers, L., Huvenne, H., Menschaert, G., Kontogiannatos, D., Kourti, A., Pauchet, Y., Smagghe, G., 2013. Colorado potato beetle (Coleoptera) gut transcriptome analysis: expression of RNA interference‐related genes. Insect Mol. Biol. 22, 668–684. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mo.l Biol. Evol. 30, 2725–2729. Touhara, K., Prestwich, G.D., 1993. Juvenile hormone epoxide hydrolase. Photo-affinity labeling, purification, and characterization from tobacco hornworm eggs. J. Biol. Chem. 268, 19604–19609. Tsubota, T., Nakakura, T., Shiotsuki, T., 2010. Molecular characterization and enzymatic analysis of juvenile hormone epoxide hydrolase genes in the red flour beetle Tribolium castaneum. Insect Mol. Biol. 19, 399–408. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (RESEARCH0034). Vermunt, A.M., Koopmanschap, A.B., Vlak, J.M., de Kort, C.A., 1997a. Cloning and sequence analysis of cDNA encoding a putative juvenile hormone esterase from the Colorado potato beetle. Insect Biochem. Mol. Biol. 27, 919–928. Vermunt, A.M., Koopmanschap, A.B., Vlak, J.M., de Kort, C.A., 1998. Evidence for two juvenile hormone esterase-related genes in the Colorado potato beetle. Insect Mol. Biol. 7, 327–336. Vermunt, A.M., Koopmanschap, A.B., Vlak, J.M., de Kort, C.A., 1999a. Expression of the juvenile hormone esterase gene in the Colorado potato beetle, Leptinotarsa decemlineata: photoperiodic and juvenile hormone analog response. J. Insect Physiol. 45, 135–142. Vermunt, A.M., Vermeesch, A.M., de Kort, C.A., 1997b. Purification and characterization of juvenile hormone esterase from hemolymph of the Colorado potato beetle. Arch. Insect Biochem. Physiol. 35, 261–277. Vermunt, A.M.W., Koopmanschap, A.B., Vlak, J., De Kort, C.A.D., 1999b. Expression of the juvenile hormone esterase gene in the Colorado potato beetle, Leptinotarsa decemlineata: photoperiodic and juvenile hormone analog response. J. Insect Physiol. 45, 135–142. Wan, P.-J., Lü, D., Guo, W.-C., Ahmat, T., Yang, L., Mu, L.-L., Li, G.-Q., 2014. Molecular cloning and characterization of a putative proline dehydrogenase gene in the Colorado potato beetle, Leptinotarsa decemlineata. Insect Sci. 21, 147–158. Wan, P.-J., Shi, X.-Q., Kong, Y., Zhou, L.-T., Guo, W.-C., Ahmat, T., Li, G.-Q., 2013. Identification of cytochrome P450 monooxygenase genes and their expression profiles in cyhalothrin-treated Colorado potato beetle, Leptinotarsa decemlineata. Pestic. Biochem. Physiol. 107, 360–368. Wojtasek, H., Prestwich, G.D., 1996. An insect juvenile hormone-specific epoxide hydrolase is related to vertebrate microsomal epoxide hydrolases. Biochem. Biophys. Res. Commun. 220, 323–329. Yamada, T., Morisseau, C., Maxwell, J.E., Argiriadi, M.A., Christianson, D.W., Hammock, B.D., 2000. Biochemical evidence for the involvement of tyrosine in epoxide activation during the catalytic cycle of epoxide hydrolase. J. Biol. Chem. 275, 23082–23088. Yang, H.-J., Fang, Z., Awquib, S., Malik, F.A., Roy, B., Xing-hua, L., Jia-biao, H., Chun-guang, S., Niu, Y., Yun-gen, M., 2011. Expression pattern of enzymes related to juvenile hormone metabolism in the silkworm, Bombyx mori L. Mol. Biol. Rep. 38, 4337–4342. Zhang, Q.R., Xu, W.H., Chen, F.S., Li, S., 2005. Molecular and biochemical characterization of juvenile hormone epoxide hydrolase from the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 35, 153–164. Zhou, K., Jia, N., Hu, C., Jiang, Y.L., Yang, J.P., Chen, Y., Li, S., Li, W.F., Zhou, C.Z., 2014. Crystal structure of juvenile hormone epoxide hydrolase from the silkworm Bombyx mori. Proteins 82, 3224–3229. Zhou, L.-T., Jia, S., Wan, P.-J., Kong, Y., Guo, W.-C., Ahmat, T., Li, G.-Q., 2013. RNA interference of a putative S-adenosyl-L-homocysteine hydrolase gene affects larval performance in Leptinotarsa decemlineata (Say). J. Insect Physiol. 59, 1049–1056.

Please cite this article as: Lü, F.-G., et al., Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.032