Characterization of type I and II procollagen α1chain in Amur sturgeon (Acipenser schrenckii) and comparison of their gene expression

Gene 579 (2016) 8–16

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Characterization of type I and II procollagen α1chain in Amur sturgeon (Acipenser schrenckii) and comparison of their gene expression Xi Zhang 1, Noriko Azuma ⁎,1, Seishi Hagihara, Shinji Adachi, Kazuhiro Ura, Yasuaki Takagi Graduate School of Fisheries Sciences, Hokkaido University, Hakodate, Japan

a r t i c l e

i n f o

Article history: Received 31 July 2015 Received in revised form 20 November 2015 Accepted 17 December 2015 Available online 6 January 2016 Keywords: Amur sturgeon Acipenser schrenckii Collagen Molecular cloning Gene expression

a b s t r a c t To characterize type I and II collagen in the Amur sturgeon at the molecular level, mRNAs encoding the proα chain of both types of collagen were cloned and sequenced. Full sequences of both were obtained, and the molecular phylogeny based on the deduced amino acid sequence indicated that the correct sequences of the target genes were obtained. Analyses of primary structure of the proα chains revealed that type I and II collagen share the basic structure of the proα chain of fibril collagen, but have different characteristics, especially in residues related to thermal stability. In the triple helical domain, Gly–Pro–Pro sequence stabilizing the tripeptide unit was more frequent in type II than in type I, and Gly–Gly, which likely decline in thermal stability, was more frequent in type I than in type II. These results suggested that the denaturation temperature of type II would be remarkably higher than type I. The spatial pattern of gene expression was analyzed by quantitative real-time PCR, which showed that relatively ubiquitous type I gene and strongly skewed distribution of type II gene, which highly expressed only in vertebra, snout cartilage, and notochord. This pattern was similar to the distribution pattern of each collagen protein detected by previous biochemical analyses using Amur and Bester sturgeons. The present study is the first report of the cloning of the full-length cDNAs for both of type I and type II collagen in the Amur sturgeon, and is the first comparative analysis of type I and II collagens in a sturgeon species at the molecular level. The results provide basic and general information on collagens in sturgeons. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Collagen is a major fibrillar protein that is widely distributed in most of the organs in vertebrates and contributes to the physiological functions and mechanical properties of skin, tendons, bones, cartilage and other tissues (Gordon and Hahn, 2010; Ikoma et al., 2003). It includes many types: to date, I–XXIX types have been identified in humans (Gordon and Hahn, 2010). Among them, the fibrillar collagen group, including type I, II, III, V, and XI, has been well analyzed. These collagen molecules comprise three super-coiled subunits, termed α chains, which have identical or similar amino acid sequences in each molecule. In the fibrillar collagens, the precursors of the α chain (proα chain) comprise N- and C-terminal propeptides, N- and C-terminal telopeptides and a central triple-helical domain containing Gly–X–X triplets covering more than 300 residues. The N- and C-terminal

Abbreviation: Ala or A, alanine; Arg or R, arginine; Asn or N, asparagine; Asp or D, aspartic acid (aspartate); Cys or C, cysteine; Gln or Q, glutamine; Glu or E, glutamic acid (glutamate); Gly or G, glycine; His or H, histidine; Ile or I, isoleucine; Leu or L, leucine; Ly or K, lysine; Met or M, methionine; Phe or F, phenylalanine; Pro or P, proline; Ser or S, serine; Thr or T, threonine; Trp or W, tryptophan; Tyr or Y, tyrosine; Val or V, valine. ⁎ Corresponding author. E-mail address: [email protected] (N. Azuma). 1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.gene.2015.12.038 0378-1119/© 2015 Elsevier B.V. All rights reserved.

propeptides are cleaved from the mature α chain, which thus comprises the N- and C-terminal telopeptides flanking the triple-helical domain. Among these fibrillar collagens, the most abundant in vertebrate tissues is type I, a major component of the extracellular matrix. Type I collagen of many bony fish species comprises three slightly different chains, named α1(I), α2(I) and α3(I) (Kimura and Ohno, 1987; Kimura et al., 1987; Ramshaw et al., 1988). In contrast, another major fibril collagen, type II, which is abundant in cartilaginous tissues, comprises a homotrimer of α1(II). Collagen has been widely used in food, photographic film, cosmetics, and collagen-based biomaterial for medical research and tissue engineering (Zhang et al., 2009; Parenteau-Barei et al., 2010). Sturgeons are candidate collagen resource because of their large body size and highly efficient extraction, especially from the skin and swimming bladder (Zhang et al., 2014), which contain abundant type I collagen. Additionally, sturgeons are expected to be a source of type II collagen, because of their cartilaginous skeleton and notochord (Billard and Lecointre, 2001). Recently, collagens from the Bester sturgeon, the Amur sturgeon, and the white sturgeon were analyzed using biochemical methods, and the different characteristics between type I and II were revealed (Liang et al., 2014; Mizuta et al., 2012; Wang et al., 2014a, 2014b; Zhang et al., 2014). However, molecular-based studies of sturgeon collagen are rare, and none of them have compared type I and II collagen in sturgeons.

X. Zhang et al. / Gene 579 (2016) 8–16

In addition, studying sturgeon collagen is important to understand collagen evolution. Sturgeons are classified as one of the most ancestral groups among all ray-finned fish species (Near et al., 2012), having a specific skeleton whose major component is cartilage that includes a quantity of type II collagen, similar to chondrichthyans and different from other ray-finned fish, such as the Teleostei. The molecular phylogeny of collagens is expected to clarify the evolution and status of sturgeon collagen among those of other fish, including chondrichthyans and ray-finned fish. The aim of the present study was to reveal the primary structure of proα chains of type I and II collagen in the Amur sturgeon, Acipenser schrenckii, and to discuss the predicted characteristics and functions of type I and II collagen. Many aquaculture sturgeon species are hybrids, such as Bester (Huso huso × Acipenser ruthenus); however, the Amur sturgeon is a pure species and it was expected to be more amenable to gene cloning than the hybrid. We cloned and sequenced cDNAs representing the genes encoding the proα1 chain of type I and II collagen in the Amur sturgeon (named Ascol1a1 and Ascol2a1, respectively), analyzed their predicted biofunctional domains and other components of the deduced amino acid sequences in comparison with the proteins of other vertebrate species, and observed the expression of mRNA in several organs in juveniles. Phylogenetic analysis of Ascol1a1 and Ascol2a1 deduced amino acid sequences was also conducted. 2. Materials and methods 2.1. Ethics statement In the present study, all procedures were performed in accordance with National and Institutional guidelines on animal experimentation and care, and were approved by the Animal Research Committee of Hokkaido University (approval ID: 22-1). 2.2. Molecular cloning of procollagen α1(I) and α1(II) gene in Amur sturgeon (ascol1a1 and ascol2a1) A live cultured Amur sturgeon (6.4 cm length, 0.97 g weight, 2 months old) was procured from the Nanae Fresh-Water Station, Field Science Center for Northern Biosphere, Hokkaido University, Japan. The fish was deeply anesthetized in 2-phenoxyethanol solution. The skin, swimming bladder, and notochord were dissected out and placed in liquid nitrogen. These tissue samples were stored in −80 °C until RNA extraction. Total RNA was extracted from the tissues using Isogen (Nippon Gene, Tokyo, Japan), purified with Takara Recombinant DNase I (TaKaRa Bio, Otsu, Japan) to remove genomic DNA (gDNA), and reverse-transcribed into cDNA using SMARTScribe Reverse Transcriptase (Clontech, Palo Alto, CA, USA) and the Oligo dT-3sites Adaptor Primer (RTG dT-Primer, Takara Bio), following the manufacturers' instructions. cDNA from the skin and swimming bladder were used to clone ascol1a1, and that from the notochord was used for ascol2a1. The PCR-based cloning strategy is shown in Fig. 1. Several oligonucleotide primers were used for PCR in which partial sequences of the target regions were amplified; some were designed from nucleotide sequences in the conserved regions of col1a1 and col2a1 from several vertebrate taxa (primers in black letters in Fig. 1), and others were designed from sequences newly obtained in the present study (red letters in Fig. 1). The sequences and location of primers used for cloning are shown in Table 1 and Fig. 1. PCR was carried out in 20-μl reactions comprising 2.0 μl of 10 × Ex Taq buffer, 1.6 μl of 0.2 mM dNTP mix, approximately 10 ng of cDNA (1 μl), 0.1 μl of 0.5 U Ex Taq (Takara Bio), and 0.15 μl each of 50 μM forward and reverse primers. The thermal cycling profile was 94 °C for 3 min; followed by 35 cycles of 94 °C for 30 s, 58–60 °C for 30 s, and 72 °C for 50 s; followed by a final extension period of 72 °C for 30 min. The PCR products were subcloned and sequenced. After partial cloning within the protein coding region (open reading frame, ORF), we performed rapid amplification of cDNA ends (RACE)

9

to obtain the 5′ and 3′ untranslated region (UTR) sequences of ascol1a1 and ascol2a1. The specific cDNA for 5′ RACE was reverse-transcribed using a SMART RACE cDNA Amplification kit (Clontech), which adds adapter oligonucleotides to the 5′ end suitable for PCR using a forward primer that is complementary to the adapter sequence, and a genespecific reverse primer. The 5′ and 3′ RACE were carried out using adapter primers and specific primers designed from the obtained sequences. Finally, the ORF regions were amplified and fully sequenced using primers based on the UTR sequences detected by RACE. 2.3. Characterization and phylogenetic analysis of ascol1a1 and ascol2a1 The nucleotide sequences obtained from molecular cloning were translated into amino acid sequences. Signal peptide cleavage sites were predicted using SignalP 4.1 online (Petersen et al., 2011), and cleavage sites for the N- and C-telopeptides, triple-helical domains, potential integrin- and cell-binding sites, and putative cross-linking sites were predicted by comparisons with Col1a1-3 from rainbow trout (Saito et al., 2001) and Col1a1 from Pacific blue tuna, trout, skate, and humans (Tanaka et al., 2014). Molecular phylogenetic trees of the deduced amino acid sequences of Col1a1 and Col2a1 were constructed using the maximum-likelihood (ML) method with the WAG model and by the minimum-evolution (ME) method with the JTT model in MEGA 6 (Tamura et al., 2013). For phylogenetic analyses, amino acid sequences of Col1a1 and Col2a1 of several vertebrate species and Col3a1 of mouse, as an outgroup, were obtained from GenBank/ DDBJ. The sequences were aligned over 1295 amino acids, including the triple-helical to C-terminal region, and used to reconstruct the molecular phylogeny. Bootstrap values were estimated by 1000 replications to evaluate the probability of each branch. 2.4. Gene expression analysis by quantitative real-time PCR To compare the gene expression levels of ascol1a1 and ascol2a1 in notochord, vertebral cartilage, snout cartilage, skin, scale, bladder, muscle, stomach, intestine and fin, quantitative real-time PCR (qPCR) was used. Total RNA was extracted from each organ from three individuals of 3-month-old Amur sturgeons. Sample treatment and RNA extraction were conducted similarly to that for molecular cloning except for the tissue preservation methods, which used the RNAlater reagent (Life Technologies, Carlsbad, CA, USA) in this case. Reverse transcription was performed using a Takara Prime Script RT reagent kit with gDNA Eraser Perfect Real Time (Takara Bio). The PCR primers a1qF (5′-GAT CTG TGT ATG TGA CAG CGG TA-3′) and a1qR (5′-AGT CCC CTG TCA CCC TTT AT TCC-3′) were used to amplify partial ascol1a1, and q2F (5′-AAG GCC CTG CGT GTC TAA TA-3′) and q2R (5′-TCC TGG TTC ACC CTT CTG AC-3′) were used for ascol2a1. To normalize the expression level, β-actin was used as a reference gene. Forward (5′-GAG GCT CAG AGC AAG AGA GGT ATC-3′) and reverse (5′-TTG AAG GTC TCA AAC ATG ATC TGG-3′) primers were used for measuring β-actin expression. Each 20-μl reaction contained cDNA corresponding to approximately 5 ng total RNA, 7 μl of FastStart Universal SYBR Green Master (Rox) (Roche, Basel, Switzerland) and 7.5 pmol of each primer. The specific amplification for each primer pair was confirmed by dissociation curve analysis at the end of the PCR reaction. QPCR was performed twice for each cDNA sample on a StepOne Plus Real-Time PCR instrument (Applied Biosystems, Foster City, CA, USA). 3. Results 3.1. Cloning of ascol1a1 and ascol2a1 Classification of the obtained sequences (type of collagen) of the PCR fragments was tested by BLAST searching at every step. The BLAST search of the ORF regions of the sequences produced top hits that were mostly col1a1 of several vertebrates for fragments assumed to be

10

X. Zhang et al. / Gene 579 (2016) 8–16

Fig. 1. Name and position of PCR primers and the lengths of amplicons for mRNA cloning. Primers in black letters were designed from a sequence comparison among certain species other than Amur sturgeon, and those in red letters were designed from sequences newly obtained in the present study. As forward and reverse primers for 5′ RACE and 3′ RACE, respectively, universal primers supplied by the manufacturer were used. After PCR, each amplicon was subcloned and sequenced.

ascol1a1 and col2a1 for those assumed to be ascol2a1, indicating we had correctly captured the target gene sequences. Using 5′ and 3′ RACE and ORF full PCR-sequence, we obtained 4607 and 4929 nucleotide sequences for ascol1a1 and ascol2a1, respectively. They included ORF

Table 1 Primersequneceforcloningofascol1a1andascol2a1inAmursturgeon. Target

Name

Sequence (5′-3′)

ascol1a1

F1 R1 F2 R2 F3 R3 F4 R4 5Rr 3Rf ORFf ORFr F1 R1 F2 R2 F3 R3 5Rr 3Rf ORFf ORFr

TGGAGACTGGTGAGACTTGC GACGTCGATGCCAAACTCTT GGTATTCCTGGACCTCAAGGTATT GTGGGATGTTGGCCTGGGTTGGG TGCCCCTGGTGGTCGTGGTTTCCC GCAATACCTTGAGGTCCAGGAATA CCTGCCAGATCTGCGTATGCGA CTGATCCATCAGCACCAGGGAAA GCTCGCCTTTTGGTCCCTGAGGT CTCCCGCCTGCCCATCATCGACA AACAAGAATTCGTCTGACCTCAAA ACTGCTAGAAAAAACAATTCCAAG ATGCCTGGTGAGAGAGGCGCTTC GTTTGCCAGGTTCACCAGAT GGATCGATCCCAACCAGGGCT GCAATGTCCACAATGGGCA CTTGGCGGAAACTTTGCTGCTCA GGTCCGGACACGCCAGTTGGGCCCTG GCTCCATTCTCACCAGAAGAACCAGCT GACGGTAATCGAGTACAAATCCCAGAAG TCTTCCTCAAAGGCCCTGCGTGTCTAAT TTTTGCTTTCTTTTTGAGTGTGAGTG

ascol2a1

regions: 4371 encoding 1457 amino acids in ascol1a1 and 4266 encoding 1421 amino acids in ascol2a1 (Fig. 1). We found sequence variation of ORF regions within each type. Five different nucleotide sequences were identified for ascol1a1 and were deposited in DDBJ with accession numbers LC008481–8485. For asol2a1, the different sequences were deposited with accession nos. AB922835–922836. The nucleotide differences within each type, i.e. five of ascol1 and three of ascol2, were less than 1%, and thus are likely to be alleles, not orthologs. The Amur sturgeon is a high-polyploid, evolutionary octaploid or functional tetraploid (Zhang et al., 1999); more than three alleles in an individual is not unreasonable. Two deduced amino acid sequences were produced for each of Ascol1a1 and Ascol2a1 (Figs. 2 and 3). The amino acid sequence of Ascol1a1-1 showed 82% sequence similarity to gold fish, rainbow trout, zebrafish and chicken, 81% to medaka fish, 80% to frog and mouse, and 75% to skate Col1a1. In the same way, Ascol2a1-1 showed 89% sequence similarity to chicken Col2a1, 88% to frog and medaka fish, 87% to mouse and 86% to zebrafish. These similarity levels provided a rough identification of collagen type; however, it should be noted that they do not directly indicate phylogenetic relationships. The alignment of amino acid sequences of collagen in many taxa revealed that the Nterminal propeptides and telopeptides varied too much to make a proper alignment for phylogenetic reconstruction. Thus, the 168 amino acids of Ascol1a1 and 134 of Ascol2a1 from the N termini were excluded from the following phylogenetic analysis. A molecular phylogenetic tree was reconstructed based on deduced sequences of 1295 amino acids (Fig. 4). The ML and ME tree showed similar topologies; therefore, we showed the ML tree with bootstrap

X. Zhang et al. / Gene 579 (2016) 8–16

11

Fig. 2. Deduced amino acid sequences of collagen pro-a1(I) chain of the Amur sturgeon, Ascol1a1. Two different sequences are shown, and dots in the sequence on the second line indicate identical amino acids in the first sequence. The vertical line indicates the predicted cleavage site for the signal peptide, and arrows indicate cleavage sites for the N- and C-telopeptides. The triple-helical domains are bracketed. The potential integrin- and cell-binding sites are boxed by solid and dotted lines, respectively. The putative cross-linking site is underlined. The positions of Cys residues in the N- and C-propeptide and Asn–X–Thr (glycosylation site) in the C-terminal propeptide are indicated by closed and open circles, respectively.

values estimated in both methods. The tree indicated that all examined sequences were clustered as Col1a1 or Col2a1, and that the detected clones corresponded precisely to the col1a1 and col2a1 sequences of the Amur sturgeon. Both Col1a1 and Col2a1 groups were confirmed as monophyletic clades with high bootstrap support of 99–100%. In each Col1a1 and Col2a1 cluster, the topology was consistent with the known phylogeny of vertebrate species. The database accession numbers of the related sequences are shown in Fig. 4. 3.2. Primary structure of procollagen Ascol1a1 and Ascol2a1 As shown in Fig. 2, the deduced amino acid sequence of Ascol1a1 included a signal peptide, N- and C-propeptides, telopeptides, and a triple-helical domain (1014 amino acids) comprising uninterrupted Gly–X–Y triplets. A Lys–Gly–His–Arg (underlined KGHR in Figs. 2 and 3) sequence appeared close to the N- and C-ends of the triple-helical

domain. This is likely a substrate for cross-linking of fibrils (Eyre et al., 1984), and is well conserved in other type I and II collagens in all species in the above phylogenetic analysis. A Gly–Phe–Hyp–Gly–Glu–Arg (GFPGER boxed by solid lines in Figs. 2 and 3) sequence, which is a collagen-specific, possible integrin-binding site (cell-adhesion site), and three Arg–Gly–Asp (RGD boxed by dotted lines in Figs. 2 and 3) motifs, which are possible cell-binding sites, were also conserved in Ascol1a1 and Ascol2a1, and in most of the species examined in the present study. Additionally, the positions of Cys residues and Asn–X– Thr (glycosylation site) in the C-terminal propeptide were conserved in both Ascol1a1 and Ascol2a1. 3.3. Characterization of Ascol1a1 and Ascol2a1 The amino acid compositions of procollagen and the triple-helical domain of Ascol1a1 and Ascol2a1 are shown in Table 2. In both Ascol1a1

12

X. Zhang et al. / Gene 579 (2016) 8–16

Fig. 3. Deduced amino acid sequences of collagen pro-a1(II) chain of the Amur sturgeon, Ascol2a1. Two different sequences are shown, and dots in the sequence on the second line indicate identical amino acids in the first sequence. Sequence characteristics are marked in the same way as in Fig. 2.

and Ascol2a1, Gly was the most abundant, followed by Pro and Ala. No Cys or Trp residues were present in the triple-helical domain. No Tyr residues appeared in triple-helical domains in Ascol1a1, but the triple-helical domain in Ascol2a1 included one Tyr at position 102. The Col2a1s of all other vertebrate species examined in the present study had this Tyr residue, except zebrafish. In the triple-helical domain, Ala, Gly, and Arg were more abundant in Ascol1a1 than in Ascol2a1, and Leu, Pro and Gln were more abundant in Ascol2a1 than in Ascol1a1. These results are basically consistent with the amino acid compositions detected by biochemical analyses using collagen from the skin of the Amur sturgeon (Col1) (Wang et al., 2014b), and the swimming bladder (Col1) and notochord (Col2) of the Bester sturgeon (Zhang et al., 2014). Table 3 shows the number of amino acid residues of Pro, Gly–Pro– Pro, and Gly–Gly in the triple-helical domain, which probably influences

collagen stability. Ascol1a1 has fewer Gly–Pro–Pro and more Gly–Gly than Ascol2a1. In comparison with Col1a1s among several vertebrates, there are more Gly–Gly units in Ascol1a1 than in any other species except rainbow trout, and Ascol1a1 contained the fewest Gly–Pro–Pro among the examined species. In Col2a1, Gly–Pro–Pro in Ascol2a1 was the highest, but was roughly comparable to other species, and the number of Gly–Glys in Ascol2a1 was moderate among the examined species. 3.4. Comparative expression of ascol1a1 and ascol2a1 in various organs Gene expression of ascol1a1 and ascol2a1, standardized by the expression of β-actin, is shown in Fig. 5. Their expression levels varied widely among the organs. Nevertheless, the type I collagen gene, ascol1a1, appeared relatively ubiquitous, being expressed in every

X. Zhang et al. / Gene 579 (2016) 8–16

13

Fig. 4. Maximum-likelihood (ML) tree based on the amino acid sequences of procollagen type I and II. The sequences were aligned over 1295 amino acids, including the triple-helical to the C-terminal region (i.e., lacking the N-terminal pro- and telo-peptides). AsCol1a1-1, AsCol1a1-2, AsCol1a2-1, and AsCol1a2-2 were predicted by cDNA sequences obtained in the present study. The others were downloaded from the protein database with accession nos. in parentheses. The number on each branch indicates the bootstrap value from 1000 replicates in ML and minimum-evolution (in parentheses) methods.

Table 2 Amino-acid component of α1chains of type I and II procollagen in Amur sturgeon based on deduced amino acid sequences. Procollagen

Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln Arg Ser Thr Val Trp Tyr

Triple-helical domain

ASCol1a1-1

ASCol1a1-2

ASCol2a1-1

ASCol2a1-2

ASCol1a1-1

ASCol1a1-2

ASCol2a1-1

ASCol2a1-2

n

(%)

n

(%)

n

(%)

n

(%)

n

(%)

n

(%)

n

(%)

n

(%)

153 18 65 77 29 405 9 32 59 40 19 36 231 43 68 75 46 33 5 14

(10.50) (1.24) (4.46) (5.28) (1.99) (27.80) (0.62) (2.20) (4.05) (2.75) (1.30) (2.47) (15.85) (2.95) (4.67) (5.15) (3.16) (2.26) (0.34) (0.96)

153 18 65 77 29 406 9 32 59 40 19 36 231 43 68 74 46 33 5 14

(10.50) (1.24) (4.46) (5.28) (1.99) (27.87) (0.62) (2.20) (4.05) (2.75) (1.30) (2.47) (15.85) (2.95) (4.67) (5.08) (3.16) (2.26) (0.34) (0.96)

133 10 60 70 26 397 11 25 60 51 18 35 241 56 73 65 39 35 6 10

(9.36) (0.70) (4.22) (4.93) (1.83) (27.94) (0.77) (1.76) (4.22) (3.59) (1.27) (2.46) (16.96) (3.94) (5.14) (4.57) (2.74) (2.46) (0.42) (0.70)

132 10 60 70 26 397 11 26 60 50 18 35 243 56 72 66 38 35 6 10

(9.29) (0.77) (4.22) (4.93) (1.83) (27.94) (0.77) (1.83) (4.22) (3.52) (1.27) (2.46) (17.10) (3.94) (5.07) (4.64) (2.67) (2.46) (0.42) (0.70)

124 0 31 47 13 355 4 11 35 15 9 16 195 22 52 51 22 12 0 0

(12.23) (0.00) (3.06) (4.64) (1.28) (35.01) (0.39) (1.08) (3.45) (1.48) (0.89) (1.58) (19.23) (2.17) (5.13) (5.03) (2.17) (1.18) (0.00) (0.00)

124 0 31 47 13 356 4 11 35 15 9 16 195 22 52 50 22 12 0 0

(12.23) (0.00) (3.06) (4.64) (1.28) (35.11) (0.39) (1.08) (3.45) (1.48) (0.89) (1.58) (19.23) (2.17) (5.13) (4.93) (2.17) (1.18) (0.00) (0.00)

103 0 31 50 14 344 5 9 37 27 6 16 206 38 33 60 21 14 0 1

(10.16) (0.00) (3.06) (4.93) (1.38) (33.93) (0.49) (0.89) (3.65) (2.66) (0.59) (1.58) (20.32) (3.75) (3.25) (5.92) (2.07) (1.38) (0.00) (0.10)

102 0 31 50 13 344 5 9 37 26 6 16 208 38 33 61 21 14 0 1

(10.06) (0.00) (3.06) (4.93) (1.28) (33.93) (0.49) (0.89) (3.65) (2.56) (0.59) (1.58) (20.52) (3.75) (3.25) (6.02) (2.07) (1.38) (0.00) (0.10)

14

X. Zhang et al. / Gene 579 (2016) 8–16

Table 3 Number of amino-acid residues in the triple helical domain of α1chains of type I and II collagen. Pro

Gly–Pro–Pro

Gly–Gly

Col1a1 AsCol1a1-1 AsCol1a1-2 Skate Rainbow trout Zebrafish Medaka fish Frog Chicken Mouse

194 194 177 177 202 210 208 234 233

17 17 21 23 31 28 31 40 41

15 16 3 22 4 5 8 0 3

Col2a1 AsCol2a1-1 AsCol2a1-2 Zebrafish Medaka fish Frog Chicken Mouse

205 207 205 215 202 226 216

31 31 26 27 26 30 29

5 5 4 5 7 0 4

organ, even in the vertebral and snout cartilage, which probably comprises much type II and little type I collagen protein. Contrastingly, the expression level of ascol2a1 was extremely high only in the notochord, vertebral cartilage and snout cartilage, and was not detected in the swimming bladder, stomach, and intestines. In the vertebral and snout cartilage, the expression of ascol2a1 was more than 10- and 100-fold that of ascol1a1 in each organ, respectively. 4. Discussion In the present study, deduced amino acid sequences of Ascol1a1 and Ascol2a1 have several characteristic common aspects in fibrillar collagens. Comparing to amino acid sequences of Col1a1 and Col2a1 in mammals, e.g. BC050014 BC051383 in Mus musculus available from GenBank, the residues assumed important for collagen function, Lys–Gly–His–Arg (cross-linking site of fibrils), Gly–Phe–Hyp–Gly–Glu–Arg (possible celladhesion site), and Arg–Gly–Asp (possible cell-binding site) in triple helical domain and Cys residues and Asn–X–Thr (glycosylation site) in the C-terminal propeptide were well conserved in amino acid

sequences deduced in the present study. These observations indicated that the cloned sequences were those of the proα chain of Col1 and Col2, and these collagens in Amur sturgeons were expected to share basic biofunctions of fibrillar collagen, such as cell-adhesion and cellbinding, common in many vertebrate species including mammals. The results thus suggested that type I and type II collagens in Amur sturgeon are likely available for industrial and medical usage like mammalian collagens in the market. The phylogenetic tree based on the deduced amino acid sequence indicated a clear separation of Col1a1 and Col2a1 in all examined vertebrate species. Although sturgeons (Acipenseriformes) are included in the second most ancestral lineage in the Actinopterygii, which separated from other ray-finned fish in the Devonian period (Near et al., 2012), Ascol1a1 appeared in a monophyletic group with teleost fish, definitely separated from chondrichthyans, such as skate (Okamejei kenojei). Thus, the molecular phylogeny of Col1a1 coincided well with current systematics, which categorize sturgeons as ray-finned fish. In both the Col1a1 and Col2a1 groups, ray-finned fish and higher vertebrates (tetrapods) appeared as a separated monophyly clade, indicating that collagen molecules of ray-finned fish diversified after separation from the ancestor of tetrapods. The branches of fish lineages in each Col1a1 and Col2a1 clade were longer than those in tetrapods, indicating that amino acid sequence variation was larger in fish lineages than in tetrapods. This larger variation is associated with various components of Col1a1 and Col2a1 among fish species, as indicated in Table 3, and thus it suggests a variety of characteristics in fish collagen that might meet the various demands for industrial use. The results of the analyses of amino acid composition and specific residues indicated that the properties of type I and II collagens in the Amur sturgeon are basically similar to those identified by biochemical studies (Liang et al., 2014; Wang et al., 2014a, 2014b; Zhang et al., 2014). In Col1 extracted by pepsin digestion (PSC) from Amur sturgeons (Wang et al., 2014b), pro- and telopeptide regions were lost in the natural maturation of the collagen protein after synthesis and in artifact through digestion; thus, these data should be compared with those of the triple-helical domain in AsCol1. Additionally, it should be noted that some Lys and Pro residues changed into Hyl and Hyp, respectively. Taking these points into account, the composition of the deduced amino acids of Ascol1a1 and the PSC are mostly similar, with slight differentiation that probably resulted from the existence of two other chains, α2 and α3 in the PSC. In the comparison of the amino acid composition

Fig. 5. Relative expression of ascol1a1 and ascol2a1 in various tissues in 3-month-old Amur sturgeons. Relative mRNA represents the mean ± S.E. of samples from three different fish. In the notochord ascol1a1 was not detected (ND), and in swimming bladder, stomach, and intestine ascol2a1 was not detected (ND). Note that a logarithmic scale is used for the relative expression level.

X. Zhang et al. / Gene 579 (2016) 8–16

of type I and II, the amino acid species that appeared more abundant in Ascol1a1 than in Ascol2a1 in the present study were also more abundant in type I collagen compared with type II in previous biochemical analyses in the Bester sturgeon (Zhang et al., 2014), and vice versa. The tentative results of our biochemical analysis of collagen from the Amur sturgeon were also in basic agreement with the deduced amino acid composition in the present study. The deduced amino acid sequences obtained in the present study suggested that the denaturation temperature of type I collagen would be lower than that of type II. The Gly–Pro–Pro sequence, whose content is reflected in the content of Gly–Pro–Hyp and stabilizes the tripeptide unit, was more frequent in Ascol2a1 than in Ascol1a1, and Gly–Gly, which likely contributes to the partial skew in the triple helix and the decline in thermal stability (Tanaka et al., 2014), was more frequent in Ascol1a1 than in Ascol2a1. These results agreed well with the biochemical results of Zhang et al. (2014), indicating that the denaturation temperature, measured by a circular dichroism spectrometer, of notochord collagen (type II) was higher than those of scale, skin, muscle, the swimming bladder and digestive tract collagens (type I) in the Bester sturgeon (Zhang et al., 2014). This also agreed with the suggestion of Amudeswari et al. (1987) that type II collagen has higher thermal stability than type I collagen in sturgeons. The sequence of the triple-helical domain of Ascol1, in which Gly–Gly was more frequent and Gly–Pro– Pro was less frequent than in the Col1a1s in other species, indicated that the denaturation temperature is lower for Ascol1 than for its homologs in other species, probably corresponding to their cold water habitat. The differentiation of thermal stability is expected to provide different merits of type I and II collagens in Amur sturgeon for industrial or medical usage. The expression profiling analyzed by qPCR in 10 organs demonstrated different expression patterns of ascol1a1 and ascol2a1, relatively ubiquitous ascol1a1 and strongly skewed ascol2a1. Assuming immobility of fibril collagen molecules after synthesis by translation, these results suggested: collagen in swimming bladder and digestive tract is solely type I; skin, scale, muscle, and fin include much type I and less type II; vertebra and snout cartilage include extremely high amounts of type II collagen and moderate type I collagen; and notochord includes almost solely type II. These patterns basically coincided with general knowledge and the results of biochemical analyses of collagen, indicating type I and II in the ratio of about 1:2 in cartilage and much of type I in skin in Amur sturgeon (Liang et al., 2014; Wang et al., 2014a, 2014b), and abundance of type I in scales, skin, muscle, swimming bladder, and digestive tract and type II in notochord and snout cartilage in Bester sturgeon (Zhang et al., 2014). A slight inconsistency was the expression of ascol1a1 in snout cartilage, which was higher than expected based on the previous results, indicating that type I collagen was not abundant in snout cartilage (Zhang et al., 2014). Possible causes of this inconsistency will be discussed below. Nevertheless, the main purpose of the qPCR analyses in the present study was to compare the expression levels between ascol1a1 and ascol2a1 in each organ rather than to compare the expression of either ascol1a1 or ascol2a1 among organs. From this viewpoint, the expression level of ascol1a1 and ascol2a1 demonstrated in the present study provided precise and significant information, even in the snout cartilage. The expression of ascol1a1 was moderate in the snout cartilage, being less than 1/100 of that of ascol2a1, which roughly corresponds to the component of collagen species in this cartilaginous organ, which generally includes 85–90% of type II and 10–15% of other types in the total collagen (Xi et al., 2006). Collagen species from vertebral cartilage was reported as type I in an analysis in white sturgeons (Mizuta et al., 2012). Although Mizuta et al. (2012) could not detect type II, which had been expected to be the main collagen in the cartilaginous vertebra of sturgeons, they suggested the existence of undetectable type II collagen. Thus, the results of their work and the present study do not contradict each other in terms of gene expression in the vertebral cartilage, although the estimated existence ratio of Col1 and Col2 is different. The co-existence of type I and II in

15

the fin was similar to the situation in skate (Mizuta et al., 2003). Thus, the present results demonstrated that the highest expression of the mRNA of type II collagen compared with one of type I occurred in the notochord, not in cartilaginous organs. The existence of ascol1a1 in cartilaginous organs such as vertebra and snout cartilage likely correlates with the tissue structure of these organs, which consist not only of cartilage but also other tissues. Another approach, such as visualizing expression patterns by microscopic observation using in situ hybridization methods, is needed to clarify the detailed spatial expressions of type I and II collagen genes in these tissues. 5. Conclusion The present study is the first report of the cloning of the full-length cDNAs encoding the proα chains of type I and II collagen in the Amur sturgeon. The obtained molecular data well indicated characteristics of Ascol1a1 and Ascol2a1. Deduced amino acid sequences suggested that both of type I and II collagens in Amur sturgeon are expected to have basic biofunction similar to mammalian type I and II collagens, and that each of type I and II collagens has different merits as materials for industrial or medical usage. In addition, the characteristics of Ascol1a1 and Ascol2a1 predicted from the molecular data well coincided with ones obtained from biochemical analysis of type I and II collagen proteins in sturgeon. It indicates that molecular analyses can predict characteristics of collagen protein, and thus partly compensate biochemical analyses that generally need specific technique, longer time and higher amount of bioresource compared with molecular analyses of genes. Recently, fish collagen is promoted as an alternative to avoid zoonosis risk of the bovine skin collagen that is the most common in the market (Parenteau-Barei et al., 2010). Molecular analyses of fish collagen genes can provide essential information needed for usage of fish collagen for human welfare. Acknowledgements We thank the Nanae Fresh-Water Station, Field Science Center for Northern Biosphere, Hokkaido University, for the help with rearing sturgeons. The present study was supported by Regional Innovation Strategy Support Program, Ministry of Education, Culture, Sports, Science and Technology, Japan. References Amudeswari, S., Liang, J.N., Chakrabarti, B., 1987. Polar–apolar characteristics and fibrillogenesis of glycosylated collagen. Coll. Relat. Res. 7, 215–223. Billard, R., Lecointre, G., 2001. Biology and conservation of sturgeon and paddlefish. Rev. Fish Biol. Fish. 10, 355–392. Eyre, D.R., Paz, M.A., Gallop, P.M., 1984. Cross-linking collagen and elastin. Annu. Rev. Biochem. 53, 717–748. Gordon, M.K., Hahn, R.A., 2010. Collagen. Cell Tissue Res. 339, 247–257. Ikoma, T., Kobayashi, H., Tanaka, J., Walsh, D., Mann, S., 2003. Physical properties of type I collagen extracted from fish scales of Pagrus major and Oreochromis niloticas. Int. J. Biol. Macromol. 32, 199–204. Kimura, S., Ohno, Y., 1987. Fish type I collagen: tissue-specific existence of two molecular forms, (α1)2α2 and α1α2α3, in Alaska Pollack. Comp. Biochem. Physiol. B Comp. Biochem. 88, 409–413. Kimura, S., Ohno, Y., Miyauchi, Y., Uchida, N., 1987. Fish skin type I collagen: wide distribution of an α3 subunit in teleosts. Comp. Biochem. Physiol. B Comp. Biochem. 88, 27–34. Liang, Q., Wang, L., Sun, W., Wang, Z., Xu, J., Ma, H., 2014. Isolation and characterization of collagen from the cartilage of Amur sturgeon (Acipenser schrenckii). Process Biochem. 49, 318–323. Mizuta, S., Hwang, J.-H., Yoshinaka, R., 2003. Molecular species of collagen in pectoral fin cartilage of skate (Raja kenojei). Food Chem. 80, 1–7. Mizuta, S., Asano, C., Yokoyama, Y., Taniguchi, M., 2012. Molecular species of collagen in muscular and vertebral parts of white sturgeon Acipenser transmontanus. Fish. Sci. 78, 399–406. Near, T.J., Eytan, R.I., Dornburg, A., Kuhn, K.L., Moore, J.A., Davis, M.P., Wainwright, P.C., Friedman, M., Smith, W.L., 2012. Resolution of ray-finned fish phylogeny and timing of diversification. Proc. Natl. Acad. Sci. U. S. A. 109, 13698–13703. Parenteau-Barei, R., Gauvin, R., Berthod, F., 2010. Collagen-based biomaterials for tissue engineering applications. Materials 3, 1863–1887.

16

X. Zhang et al. / Gene 579 (2016) 8–16

Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785–786. Ramshaw, J.A.M., Werkmeister, J.A., Bremner, H.A., 1988. Characterization of type I collagen from the skin of blue grenadier Macruronus novaezelandiae. Arch. Biochem. Biophys. 267, 497–502. Saito, M., Takenouchi, Y., Kunisaki, N., Kimura, S., 2001. Complete primary structure of rainbow trout type collagen consisting of α1(I)α2(I)α3(I) heterotrimers. Eur. J. Biochem. 268, 2817–2827. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tanaka, T., Takahashi, K., Adachi, K., Ohta, H., Yoshimura, Y., Agawa, Y., Sawada, Y., Takaoka, O., Biswas, A.K., Takii, K., Zaima, N., Moriyama, T., Kawamura, Y., 2014. Molecular cloning and expression profiling of procollagen α1(I) of cultured Pacific Bluefin tuna. Fish. Sci. 80, 603–612. Wang, L., Liang, Q., Chen, T., Wang, Z., Xu, J., Ma, H., 2014a. Characterization of collagen from the skin of Amur sturgeon (Acipenser schrenckii). Food Hydrocoll. 38, 104–109.

Wang, L., Liang, Q., Wang, Z., Xu, J., Liu, Y., Ma, H., 2014b. Preparation and characterisation of type I and V collagens from the skin of Amur sturgeon (Acipenser schrenckii). Food Chem. 148, 410–414. Xi, C., Liu, N., Liang, F., Guo, S., Sun, Y., Yang, F., Xi, Y., 2006. Molecular cloning, characterization and localization of chicken type II procollagen gene. Gene 366, 67–76. Zhang, S.M., Yang, Y., Deng, H., Wei, Q.W., Wu, Q.J., 1999. Genome size and ploidy characters of several species of sturgeons and paddlefishes with comments on cellular evolution of Acipenseriformes. Acta Zool. Sin. 45, 200–206. Zhang, M., Liu, W., Li, G., 2009. Isolation and characterisation of collagens from the skin of largefin longbarbel catfish (Mystus macropterus). Food Chem. 115, 826–831. Zhang, X., Ookawa, M., Tan, Y., Ura, K., Adachi, S., Takagi, Y., 2014. Biochemical characterisation and assessment of fibril-forming ability of collagens extracted from Bester sturgeon Huso huso × Acipenser ruthenus. Food Chem. 160, 305–312.