Chemokines and Inflammation in the Nasal Passages of Infants with Respiratory Syncytial Virus Bronchiolitis

Clinical Immunology Vol. 104, No. 1, July, pp. 86 –95, 2002 doi:10.1006/clim.2002.5248

Chemokines and Inflammation in the Nasal Passages of Infants with Respiratory Syncytial Virus Bronchiolitis Terry L. Noah,* ,† ,1 Sally S. Ivins,* Paula Murphy,* Irina Kazachkova,‡ Billie Moats-Staats,* and Frederick W. Henderson* *Department of Pediatrics and †Center for Environmental Medicine and Lung Biology, 635 Burnett-Womack Bldg., CB #7220, The University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-7220; and ‡Maimonides Medical Center, Brooklyn, New York 11201-8423z

RSV remains a significant public health problem due to its association with high hospitalization rates in certain populations, high morbidity in children with underlying cardiorespiratory diseases, and subsequent risk for recurrent wheezing (3, 4). The severe RSVinduced bronchiolitis associated with prior formalininactivated vaccine administration in early trials (5) and relatively low viral burden in the lower airways of children with fatal RSV bronchiolitis (6) suggest that acute inflammatory and immune responses to RSV play important roles in determining clinical outcomes. We and others have shown that a variety of cytokines and chemokines are upregulated during acute illness due to RSV and other viruses in early childhood (7–10), and Bont et al. recently reported an inverse relationship between RSV severity and interferon-␥ levels in nasal secretions (11). However, few data are available characterizing the relationship between inflammatory chemokines in respiratory secretions and clinical symptoms during acute RSV infection in infants. The chemokines are chemoattractant peptides with varying specificities, determined by expression of receptors on leukocyte target cells. Chemokines are known to be major determinants of inflammatory and immune responses. Lymphocytes, monocytes, and eosinophils express receptors for the C-C chemokines such as Released on Activation, Normal T-cell Expressed and Secreted (RANTES), while neutrophils preferentially express receptors for the C-X-C chemokines, including interleukin-8 (IL-8) (12, 13). Thus, the balance of these factors at the respiratory mucosal surface could potentially help regulate the quantity and type of inflammatory effector cells responding to an infection, in turn influencing the clinical manifestations of infection. The nasal passages are readily and safely accessible in infants, and limited evidence suggests that cellular and soluble components of nasal secretions may correlate with inflammatory markers in the lower airways (14, 15). Additionally, it is known from in vitro studies (16 –19) and experimental infection in humans (5) that

This study measured chemokines in nasal lavage fluids (NLF) from infants with respiratory syncytial virus (RSV) bronchiolitis, defined by lung hyperinflation and wheezing. Comparison was made to RSV-positive infants without bronchiolitis and RSV-negative infants with acute respiratory illnesses. RSV-positive illnesses were associated with increased epithelial shedding, increased RANTES/protein ratios, and increased IL-8/protein ratios in NLF compared to RSVnegative illnesses. Among RSV-positive infants, bronchiolitics had greater total cell counts and percentage epithelial cells in NLF than nonbronchiolitics. Bronchiolitics also had roughly twice the NLF RANTES/ IL-8 ratio than nonbronchiolitics (P ⴝ .043). Semiquantitative reverse transcriptase–polymerase chain reaction of nasal epithelium suggested similar RANTES/IL-8 ratio increases among bronchiolitics. A more mildly affected, RSV-positive outpatient population showed none of these differences. We conclude that RSV bronchiolitis is associated with a shift toward relatively more RANTES in nasal secretions of infants sick enough to require hospitalization, and mucosal epithelium may contribute to this process. Similar processes in the lower airways may enhance inflammation due to RANTES-responsive cell types and affect clinical manifestations. © 2002 Elsevier Science (USA) Key Words: RSV; bronchiolitis; RANTES; IL-8; epithelium. INTRODUCTION

Acute viral bronchiolitis in infants is characterized by signs and symptoms of peripheral airways obstruction. While clinical definitions vary, wheezing and hyperinflation are important clinical features distinguishing bronchiolitis from other lower respiratory illnesses (1, 2). Respiratory syncytial virus (RSV) is the most common cause of acute bronchiolitis in infants. 1 To whom correspondence and reprint requests should be addressed. Fax: (919) 966-6179. E-mail: [email protected].

1521-6616/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.

86

NASAL CHEMOKINES IN RSV BRONCHIOLITIS

RSV is capable of inducing both IL-8 and especially RANTES production in respiratory epithelium. Some of the characteristic symptoms and signs of acute bronchiolitis (wheeze, prolonged expiratory phase, and hyperinflation) resemble those of asthma. Since it is currently felt that asthmatic airway physiology depends on inflammation involving cell types expressing C-C receptors such as eosinophils and lymphocytes, we hypothesized that infants with RSV bronchiolitis would have relatively greater amounts of the C-C chemokine RANTES in nasal secretions, when compared to infants RSV-positive illnesses other than bronchiolitis. Our major goal in the present study was thus to compare relative quantities of these chemokines, and other inflammatory markers, in nasal lavage fluids (NLF) from infants with RSV bronchiolitis and from infants with RSV-positive illnesses other than bronchiolitis. A second goal was to compare nasal epithelial chemokine mRNA abundance between these groups of infants. MATERIALS AND METHODS

Study Design and Subjects During three consecutive winters (1997–2000), nasal aspirate RSV antigen-positive children admitted to University of North Carolina hospitals during the interval from December 1 to April 1 were recruited for participation. Children were excluded from the study if they had been treated with corticosteroids during the illness or if they had any underlying cardiopulmonary disease (e.g., bronchopulmonary dysplasia, recurrent pneumonia, recurrent wheezing, or immunodeficiency). Infants with a history of prematurity alone (without BPD) were not excluded. A history was taken to determine the date of onset and character of symptoms, and the chart was reviewed for physical examination findings and results of chest radiographs. Nasal lavage for determination of inflammatory cells, total protein, and chemokines was performed during the acute illness at the time of entry into the study. This was typically done within a day after admission. If hospitalization was prolonged, a second nasal lavage was performed 1 week after the first. In a subset of infants (determined by parental consent), a superficial scrape biopsy of epithelium from underneath the inferior nasal turbinate was taken immediately after the first nasal lavage. Hospitalized RSV-positive children were subgrouped according to hyperinflation of the lungs and wheezing, clinical features specific for bronchiolitis (1, 2). Hyperinflation on radiograph, as the more objective finding, was considered to represent bronchiolitis regardless of findings on auscultation. However, chest radiographs were not obtained in all hospitalized RSV-positive children. RSV-positive inpatients for whom radiographs

87

were not obtained were classified as having bronchiolitis if wheezing was noted on physical examination by the admitting physician or by the investigators at the time of nasal lavage. Children with wheezing on auscultation but radiographs not showing hyperinflation were considered ambiguous with regard to these criteria and were excluded from the comparison between bronchiolitis and nonbronchiolitis. For comparison with RSV-positive infants, infants enrolled in a day care program were also studied in similar fashion during acute respiratory illnesses. These illnesses were defined as acute onset of rhinorrhea with or without fever. New-onset rhinnorhea reported by parents and corroborated by day care staff was reported to the investigators, who performed physical examination of the respiratory system and nasal lavage. Since regular access to these infants was possible, they were studied during all acute respiratory illnesses. Nasal lavage fluids from these infants were assayed for RSV using a commercial antigen detection kit (Abbott Labs, Abbott Park, IL). The great majority of these were RSV-negative; the few who were RSVpositive were included in the data analysis for “All” RSV-positive children, but were not included in the comparison of bronchiolitis vs nonbronchiolitis in hospitalized infants. As a further comparison, NLF were also obtained from nonhospitalized infants less than 1 year of age in a separate community (Laurinburg, NC) over a single winter. In this substudy, parents of infants with acute respiratory illnesses being seen at a pediatric practice were approached concerning consent to nasal lavage. Nasal lavage was performed within 4 days after onset of symptoms. This study was approved by the University of North Carolina School of Medicine’s Committee for the Protection of the Rights of Human Subjects. Nasal Lavage and Biopsy Nasal lavage was performed as previously described (6). Briefly, infants were held in the lateral recumbent position, and 5 ml of sterile normal saline solution was instilled into the upper nostril 1–2 ml at a time over a total time of 30 – 60 s. NLF passively flowing from the inferior nostril was collected in a paper cup. A soft rubber bulb syringe was used to gently suction any remaining fluid from both nostrils and added to the material in the cup. The NLF was transferred to a capped polypropylene tube, placed on crushed ice, and transported to the laboratory for initial processing within 2 h after the lavage was performed. Initial laboratory processing consisted of determination of cell number by hemocytometer, preparation of cytocentrifuged slides from an aliquot of NLF, and then centrifugation of remaining fluid (500g ⫻ 5 min) to remove

88

NOAH ET AL.

cells and mucus. The cell-free NLF supernatant was frozen at ⫺80°C until use in assays described below. Superficial scrape biopsy of nasal respiratory epithelium was performed immediately after nasal lavage in the subset of subject whose parents consented to this procedure. This was done using a sterile plastic curette (Rhinoprobe, Arlington Scientific, Inc., Arlington, TX). The infant was placed supine and the curette tip was placed near the posterior part of the area underneath the inferior nasal turbinate and then drawn anteriorly for about 1 cm while exerting gentle pressure. The resulting plug of cells was placed immediately in cell culture media on crushed ice for transport to the laboratory. Initial processing of the biopsy included determination of cell differential using cytocentrifuged slide preparations stained with modified Wright stain (Hema-3; Fisher Scientific, Pittsburgh, PA). All specimens included in data analysis contained ⬎90% epithelium by morphologic assessment. RNA was isolated from remaining cells using guanidimium isothiocyanate (GITC) method described previously (6) and stored at ⫺80°C for later use in reverse transcriptase–polymerase chain reaction (RT– PCR) assay as described below. For infants in the Laurinburg outpatient substudy, the same nasal lavage technique was used. However, 3 ml of the unprocessed NLF was aliquoted into 3 ml of virus transport medium (Life Technologies, Rockville, MD), mixed, and stored at ⫺70°C. Prior to assays for chemokines, thawed NLF samples were centrifuged at 400g to remove cellular debris. Due to these differences in initial processing, chemokine data derived from this population were analyzed separately from the primary study. There was no evidence for interference in the chemokine enzyme-linked immunosorbent assays (ELISA) by virus transport medium. Nasal Lavage Fluid Assays Differential cell counts were determined by microscopic inspection of 200 consecutive cytocentrifuged, stained cells under high power by an observer blinded as to clinical status of the patient. Specimens with inadequate cell numbers to perform an accurate cell differential were excluded from data analysis. Total protein was quantified using a commercial assay (Sigma, St. Louis, MO) based on intensity of staining with Coomassie blue. Chemokines were quantified in NLF using commercial ELISA kits (R&D, Minneapolis, MN) according to the manufacturers’ instructions. Chemokines measured were IL-8 (sensitivity ⫽ 10 pg/ ml, dynamic range ⫽ 31.2–2000 pg/ml) and RANTES (sensitivity ⫽ 5 pg/ml, dynamic range ⫽ 31.2–2000 pg/ml). Eosinophil cationic protein (ECP) was measured using commercial RIA kits (Pharmacia, Uppsala, Sweden) with a sensitivity of 2 ng/ml and dynamic

range of 2–200 ng/ml. Samples containing unquantifiably high values were diluted and rerun; samples containing unquantifiably low values were assigned the lower limit of assay sensitivity for data analysis. For data analysis, mediator levels were expressed as a ratio to total protein to normalize for variation in dilution of nasal secretions by lavage fluid. Semiquantitative RT–PCR in Nasal Cells RNA was purified using Trizol (Life Sciences, Rockville, MD) according to the manufacturer’s protocol. cDNA was generated from 0.2 ␮g of purified RNA, with reverse transcription buffers and reagents as previously described (10). For PCR amplification, 10 ␮l cDNA was added to 90 ␮l PCR reaction mix consisting of 10 mM Tris–HCl buffer (pH 8.7), 50 mM KCl, 3 mM MgCl 2, and 0.1 mg/ml BSA, with 0.05 mM dNTP and 0.025 U/␮l Taq polymerase (HotStar Taq, Qiagen, LaJolla, CA). Primer pairs were as follows: IL-8 (20) (sense, identical to bases 46 –72) 5⬘ TCTGCAGCTCTGTGTGAAGGTGCAGTT 3⬘ and antisense 5⬘ AACCCTCTGCACCCAGTTTTCCTT 3⬘ (complementary to bases 264 –287) and RANTES (21) (sense, identical to bases 51–70) 5⬘ GCTGTCATCCTCATTGCTAC 3⬘ and antisense 5⬘ TCCATCCTAGCTCATCTCCA 3⬘ (complementary to bases 308 –327). Identity of PCR products using these primers had been previously verified by DNA sequencing. The PCR was carried out in a 96-well thermocycler (MJ Research, Watertown, MA). Ten microliters of PCR product was run out on 2.8% agarose gel at 40 and 45 cycles to ensure a cycle-dependent increase in reaction product. Digital images of UV-illuminated gels were scanned for integrated optical band densities with a computerized densitometer (Image Pro, Media Cybernetics, Baltimore, MD). Statistical Analysis Comparisons of data between subject groups were done using an unpaired t test with Welch’s correction for unequal variances. Linear regression was calculated by the method of least squares. The statistical software program GraphPad Prism (GraphPad Software, San Diego, CA) was used to make these calculations. A value of P ⬍ .05 was considered significant throughout. RESULTS

Characteristics of Subjects Table 1 shows selected demographic characteristics of the subjects in the primary study. Similar numbers of RSV-positive (47 cases) and RSV-negative (51 cases)

89

NASAL CHEMOKINES IN RSV BRONCHIOLITIS

TABLE 1 Characteristics of Subjects and Nasal Lavage Fluids (NLF)

Number of subjects Number of illnesses Age at illness (months), SE ⫾ mean (range) Number of NLF obtained Days after onset of illness when NLF obtained, SE ⫾ mean (range) % return NLF, SE ⫾ mean

RSV-negative

RSV-positive (all)

Hospitalized RSV-positive (bronchiolitis)

Hospitalized RSV-positive (nonbronchiolitis)

28 51 7.5 ⫾ 0.3 (2–12) 81 8.1 ⫾ 0.3 (4–15) 63 ⫾ 2

47 a 47 3.9 ⫾ 0.7* (1–23) 64 7.7 ⫾ 0.4 (4–16) 67 ⫾ 3

26 26 3.6 ⫾ 0.9 (1–23) 34 7.7 ⫾ 0.6 (4–16) 63 ⫾ 4

15 15 4.1 ⫾ 1.5 (1–23) 22 7.9 ⫾ 0.7 (4–16) 70 ⫾ 6

a

Three RSV-positive subjects had wheezing but no hyperinflation on chest radiograph and are not fincluded in either the bronchiolitis or nonbronchiolitis subgroup. Three RSV-positive day care (nonhospitallized) subjects are also included in RSV-positive (All). * P ⬍ .05 vs RSV negative.

illnesses were studied. As noted under Materials and Methods, the RSV-negative illnesses were in children attending a research day care center. Because these children were routinely available, it was possible to study more than one illness for each infant. In the RSV-positive group, each subject was studied during a single illness. The RSV-positive group, most of whom were hospitalized, was significantly younger than the RSV-negative group (mean ages 3.9 months and 7.5 months, respectively). Due to the young age of these subjects at the time of illness, and the exclusion of those with histories of recurrent wheeze or other respiratory conditions, it is assumed that most RSV illnesses studied represented initial RSV infections. There were no differences between groups or subgroups for time after onset of symptoms when NLF was obtained or for percentage return of NLF. Among hospitalized RSV-positive infants, 26 had “bronchiolitis” as defined clinically (see Materials and Methods), and these infants did not differ in age from the hospitalized nonbronchiolitic infants with RSV. Clinical characteristics of these hospitalized infants are shown in Table 2. In general, infants with bronchiolitis were more likely to have respiratory distress, and to need supplemental O 2, than nonbronchiolitics. Differential Cell Counts in NLF Total cell count in NLF did not differ significantly between RSV-positive and RSV-negative illnesses. However, Table 3 shows that the percentage of epithelial cells present in NLF was higher for the RSV illnesses. Analysis of data for RSV-positive illnesses shows that bronchiolitis was associated with a tendency for higher cell counts and a significantly greater proportion of epithelial cells than in nonbronchiolitics, and the percentage of neutrophils was correspondingly significantly lower in bronchiolitics. Thus, RSV bron-

chiolitis appeared to be associated with more epithelial shedding from the nasal mucosa. No group or subgroup had any statistically significant tendency for eosinophilia in NLF. Correlations among NLF Cell Types and Mediators Linear regression was calculated for each cell type vs IL-8, RANTES, or ECP in NLF (Table 4). Among these mediators, the only significantly positive association with epithelial cells was observed for RANTES (P ⫽ .021), though this was relatively weak (r 2 ⫽ .055). Neutrophils were significantly correlated with all three mediators, while mononuclear cells showed a weak but significant correlation with ECP levels. Linear regression between ECP and both IL-8 and RANTES in NLF yielded significantly positive relationships. Protein and Chemokines in NLF Total protein in NLF was lower in RSV-positive subjects (0.23 ⫾ 0.03 mg/ml) than in RSV-negative subjects (0.34 ⫾ 0.03 mg/ml) (P ⫽ .013). This result was surprising given the increase in epithelial shedding in RSV-positive infants, which might be expected to increase rather than decrease epithelial permeability to proteins. Although in all children the lavage was performed over a short period of time (less than 60 s), lavage may have proceeded more quickly in the RSVpositive children, who were in greater respiratory distress prior to the procedure. A shorter “dwell time” in these infants might have thus resulted in lower overall protein concentrations in returned NLF. However, among the RSV-positive infants, there was no significant difference between NLF total protein concentrations in bronchiolitic (0.22 ⫾ 0.03 mg/ml) vs nonbronchiolitic (0.26 ⫾ 0.06 mg/ml) subjects.

90

NOAH ET AL.

TABLE 2 Clinical Characteristics of Hospitalized RSV-Positive Subjects

Number of subjects Gestational age ⬍34 weeks Presenting symptoms reported by parents Respiratory distress Cough Poor appetite Fever Apnea/ALTE Chest radiograph obtained Hyperinflation Pneumonia Atelectasis Supplemental O 2 given during illness Wheeze on auscultation at admission or at time of nasal lavage Respiratory rate at admission (range) Room-air SpO 2 at admission (range)

Mechanical ventilation during illness a

Bronchiolitis a

Nonbronchiolitis

26 4/26

15 2/15

21/26 18/26 14/26 9/26 6/26 22/26 22/22 7/22 6/22 20/26 17/26 50 ⫾ 3/min (16–112) 87 ⫾ 4% (recorded in 15/25 subjects) (40–99) 1/26

5/15 10/15 8/15 8/15 3/15 7/15 0/7 2/7 2/7 3/15 0/15 44 ⫾ 3/min (30–70) 95 ⫾ 1% (recorded in 6/15 subjects) (89–99) 2/15

See text of Materials and Methods for criteria for inclusion in “bronchiolitis” group.

Both IL-8 (Fig. 1) and RANTES (Fig. 2), expressed as a ratio to total protein in NLF, were increased in RSVpositive compared to RSV-negative illnesses. Among RSV-positive illnesses, neither chemokine differed significantly when subjects with bronchiolitis were compared with subjects without bronchiolitis. However, there was a tendency for greater increases in IL-8 among the nonbronchiolitics and greater RANTES among the bronchiolitics. When the ratio of RANTES to IL-8 was calculated for each NLF sample, infants with bronchiolitis had a significantly increased ratio, which was on average roughly double that in those without bronchiolitis (Fig. 3). ECP levels in NLF varied widely among subjects but there were no significant differences associated with either RSV infection or bronchiolitis (Fig. 4).

Chemokine mRNA Abundance in Nasal Epithelial Cells Thirteen of the RSV-positive infants underwent a superficial “scrape” type nasal epithelial biopsy under the inferior nasal turbinate, immediately following nasal lavage, as described under Materials and Methods. Of these infants, 10/13 had clinical bronchiolitis. Semiquantitative RT–PCR was used to assess chemokine mRNA abundance in nasal epithelial cells. GAPDH mRNA abundance did not differ between bronchiolitics and nonbronchiolitics (data not shown). For both RANTES and IL-8, band density increased for all subjects between 40 and 45 cycles of PCR, suggesting continued amplification, and there was good correlation of the ratios (P ⬍ .001) at these two cycle num-

TABLE 3 Total Cell Counts and Differentials for Nasal Lavage Fluids (NLF)

Total cell count (⫻ 10 3/ml % Epithelium % Neutrophils % Mononuclear % Eosinophils

NLF)

RSV-negative

RSV-positive (all)

RSV-positive bronchiolitis (hospitalized)

RSV-positive nonbronchiolitis (hospitalized)

1557 ⫾ 303 17 ⫾ 3 78 ⫾ 3 5⫾ 1 (⬍1)

1740 ⫾ 421 29 ⫾ 4* 68 ⫾ 4 3⫾ 1 (⬍1)

1497 ⫾ 426 41 ⫾ 7** 55 ⫾ 7** 4⫾ 1 (⬍1)

1045 ⫾ 374 21 ⫾ 5 76 ⫾ 5 2⫾ 1 (⬍1)

a Data are given as mean ⫾ SE. * P ⬍ 0.05 vs RSV negative. ** P ⬍ 0.05 vs RSV positive/nonbronchiolitis.

NASAL CHEMOKINES IN RSV BRONCHIOLITIS

91

TABLE 4 Correlation Coefficients (r 2) and P Values for Linear Regression Calculated between NLF Mediators and ECP or Specific Cell Types in NLF

ECP Neutrophils Epithelial cells Mononuclear cells Eosinophils

IL-8

RANTES

ECP

r 2 ⫽ .398 P ⬍ .001* r 2 ⫽ .293 P ⬍ .001* r 2 ⫽ .005 P ⫽ .458 r 2 ⫽ .019 P ⫽ .148 r 2 ⬍ .001 P ⫽ .847

r 2 ⫽ .267 P ⬍ .001* r 2 ⫽ .181 P ⬍ .001* r 2 ⫽ .055 P ⫽ .021* r 2 ⫽ .029 P ⫽ .079 r 2 ⫽ .012 P ⫽ .265

— r 2 ⫽ .423 P ⬍ .001* r 2 ⫽ .008 P ⫽ .364 r 2 ⫽ .091 P ⫽ .002* r 2 ⫽ .009 P ⫽ .602

* Statistically significant, positive relationship.

bers. The identity of the IL-8 and RANTES PCR products was confirmed by direct sequencing. Mean RANTES/IL-8 mRNA abundance at 45 cycles in bronchiolitics was about twice that of nonbronchiolitics (Fig. 5), though this tendency did not reach statistical significance. However, there was no significant correlation between RANTES/IL-8 ratios in epithelial mRNA and in NLF for the same infants. Outpatient Substudy Data Since the primary study involved a hospitalized RSV-positive population, therefore representing a minority of all children who become infected with RSV, we also made similar comparisons of relative NLF chemokine abundance for more mildly affected, nonhospi-

FIG. 1. IL-8 (as ratio to total protein) in nasal lavage fluids from infants with RSV-negative acute respiratory illnesses [RSV(⫺)], RSV-positive illnesses [RSV(⫹) All], hospitalized RSV-positive infants with bronchiolitis [RSV(⫹) B], and hospitalized RSV-positive infants with acute illnesses other than bronchiolitis [RSV(⫹) NB]. The latter two groups are subgroups of RSV(⫹) All. Bars represent mean ⫾ SEM for each group. *P ⬍.05 vs RSV(⫺).

FIG. 2. RANTES (as ratio to total protein) in nasal lavage fluids from infants with RSV-negative acute respiratory illnesses [RSV(⫺)], RSV-positive illnesses [RSV(⫹) All], hospitalized RSVpositive infants with bronchiolitis [RSV(⫹) B], and hospitalized RSVpositive infants with acute illnesses other than bronchiolitis [RSV(⫹) NB]. The latter two groups are subgroups of RSV(⫹) All. Bars represent mean ⫾ SEM for each group. *P ⬍ .05 vs RSV(⫺).

talized infants (⬍ 12 months old) enrolled in a separate outpatient study of the course of naturally acquired RSV infection. For this outpatient substudy, NLF were available from 80 acute illnesses in 73 infants. Subjects were classified as RSV positive or negative, based on antigen detection in NLF. Of the 80 illnesses, 20 were RSV positive, and 8/20 were associated with mild wheezing by chest auscultation. In the outpatient substudy, there were no RSV-specific or wheezing-specific increases in IL-8 or RANTES (expressed as ratio to total protein), nor was the ratio of RANTES to IL-8 altered in association with wheezing (Table 5). The RANTES/IL-8 ratio for these infants was similar to that of the nonbronchiolitic group in the primary study (Table 5, Fig. 3). ECP as a ratio to

FIG. 3. RANTES/IL-8 ratio in nasal lavage fluids from hospitalized infants with RSV-positive acute respiratory illnesses. RSV(⫹) B ⫽ RSV-positive infants with bronchiolitis; RSV(⫹) NB ⫽ RSVpositive infants with acute illnesses other than bronchiolitis. Bars represent mean ⫾ SEM for each group. *P ⬍ .05 vs RSV(⫹) NB.

92

NOAH ET AL.

FIG. 4. Eosinophil cationic protein (ECP) (as ratio to total protein) in nasal lavage fluids from infants with RSV-negative acute respiratory illnesses [RSV(⫺)], RSV-positive illnesses [RSV(⫹) All], hospitalized RSV-positive infants with bronchiolitis [RSV(⫹) B], and hospitalized RSV-positiveinfants with acute illnesses other than bronchiolitis [RSV(⫹) NB]. The latter two groups are subgroups of RSV(⫹)All. Bars represent mean ⫾ SEM for each group.

protein was also not predictive of wheezing in the substudy population (Table 5). DISCUSSION

Bronchiolitis is an acute lower respiratory illness of infants, clinically distinguished by signs and symptoms of airways obstruction similar to those in acute asthma episodes (wheezing and hyperinflation) and caused most commonly by RSV infection (1– 4). This study was primarily designed to test whether infants hospitalized with clinically defined RSV bronchiolitis differ from infants with other RSV-positive acute respiratory illnesses with respect to inflammatory cells and the chemokines RANTES and IL-8 in nasal lavage fluids. These two chemokines were the focus because they have been investigated extensively in vitro in relation to RSV infection of airway epithelium (16 –19). RSV-positive infants generally had an increased proportion of epithelial cells in NLF compared to RSVnegative infants, and this appeared to be mainly due to the infants with bronchiolitis (Table 3). IL-8 and RANTES were both significantly increased in proportion to total protein in RSV-positive vs RSV-negative infants (Figs. 1 and 2). However, in infants with RSV, the proportion of RANTES relative to IL-8 was significantly increased in bronchiolitics compared to nonbronchiolitics (Fig. 3). This proportional increase in RANTES was not observed in wheezing but more mildly affected infants in the Laurinburg outpatient substudy population, suggesting that increased clinical severity (i.e., sufficient to require hospitalization) might be necessary to observe this result. Our results are consistent with those recently reported by Garofalo et al. [22], who noted that in infants with RSV bron-

chiolitis, there is an association between hypoxia and elevated levels of RANTES and MIP-1␣ in nasal secretions. With the caveats discussed below, these data are consistent with the hypothesis that the clinical manifestations of RSV infection are related to chemokine balance at the respiratory mucosal surface. Among RSV-positive infants, the NLF cell differential feature most closely associated with bronchiolitis was an increase in the proportion of epithelial cells (Table 3). This is interesting in the context of reports in the pathology literature that the main lesion in fatal acute RSV bronchiolitis is epithelial necrosis with consequent plugging of the bronchiolar lumen (23). Of the three NLF mediators measured, only RANTES had statistically significant correlation with numbers of epithelial cells (Table 4). While this correlation was not strong (r 2 ⫽ .055; P ⫽ .021), it suggests that processes leading to increased RANTES release may generally occur in tandem with increased epithelial shedding. Possible explanations include increased viral burden within the epithelium or increased release of RANTES and epithelial targeting by infiltrating T cells. The predominant inflammatory cell in NLF during RSV and other acute viral illnesses in this study was the neutrophil. IL-8, RANTES, and ECP all correlated significantly with neutrophil numbers in NLF (Table 4). Few morphologically distinct eosinophils were found in our study, and while ECP was readily detectable in NLF from some subjects and showed significant correlation with both IL-8 and RANTES, there was no significant increase in ECP among bronchiolitics as a group. This result corroborates findings in bronchial

FIG. 5. Ratio of RANTES/IL-8 mRNA (45 cycles), expressed as ratio of integrated optical density of ethidium-stained RT-PCR product bands (IOD), in biopsied nasal epithelial cells from infants with RSV-positive acute respiratory illnesses. RSV(⫹) B ⫽ RSV-positive infants with bronchiolitis (n ⫽ 10); RSV(⫹) NB ⫽ RSV-positive infants with acute illnesses other than bronchiolitis (n ⫽ 3). Bars represent mean ⫾ SEM for each group. The difference between the two data sets did not reach statistical significance.

93

NASAL CHEMOKINES IN RSV BRONCHIOLITIS

TABLE 5 NLF Chemokines in Infants in the Laurinburg Outpatient Substudy

Picograms IL-8/mg total protein Picograms RANTES/mg total protein Picograms RANTES/pg IL-8 Nanograms ECP/mg TP

RSV-negative (all)

RSV-positive (all)

RSV-positive (bronchiolitis)

RSV-positive (nonbronchiolitis)

23,980 ⫾ 3275 129 ⫾ 27 0.012 ⫾ 0.004 645 ⫾ 150

24,880 ⫾ 7124 135 ⫾ 32 0.011 ⫾ 0.003 323 ⫾ 52

30,610 ⫾ 13,790 117 ⫾ 39 0.008 ⫾ 0.004 343 ⫾ 89

19,150 ⫾ 4329 153 ⫾ 53 0.013 ⫾ 0.005 308 ⫾ 67

Data are given as mean ⫾ SE. Differences between RSV-positive (n ⫽ 21) and RSV-negative (n ⫽ 59), and between RSV-positive bronchiolitics (n ⫽ 7) and nonbronchiolitics (n ⫽ 14), were not statistically significant. NLF with total protein levels below detectable range of assay were excluded from analysis of chemokine levels as ratio to total protein. a

lavage fluids from RSV-infected infants with respiratory failure in a study previously published by Everard and colleagues (24). Thus, despite a relative increase in RANTES among bronchiolitics, there was no apparent associated increase in C-C receptor-expressing cell types in NLF. However, this does not rule out a significant functional role for the chemokine changes observed, since lavage studies may poorly reflect inflammatory changes beneath the mucosal surface, where mononuclear and possibly eosinophilic infiltrates are likely to be most prominent (23). Several caveats must be noted regarding our study design. We relied on clinical criteria to distinguish hospitalized infants with bronchiolitis from those with other syndromes. Since hyperinflation on chest radiograph is a relatively objective finding, this was considered the primary indicator of bronchiolitis for the study. In RSV-positive children without chest radiographs, the presence or absence of wheeze, a more variable and subjective finding, was used as the main criterion for classification. Because some of our infants with “bronchiolitis” had hyperinflation on X ray, but no wheeze noted on auscultation, it is possible that our “nonbronchiolitis” group also included some infants without wheeze but who would have shown hyperinflation if radiographs had been obtained. If so, our data may underestimate the differences between the groups. Finally, it is also possible that bronchiolitis occurs in all hospitalized infants with RSV, with differences only in degree of severity. Given the apparent differences between our subgroups in oxygen requirement and symptoms of respiratory distress (Table 2), it seems likely that we at least distinguished a more severely affected subgroup of infants with RSV bronchiolitis. The epithelium lining the extrathoracic airways, including the nasal passages, is the initial site of RSV infection for most infants. Numerous studies in our laboratory and others have documented that respiratory epithelium is responsive to RSV infection with increased production of several chemokines and cytokines through NF-␬B-dependent pathways (16 –19).

We have also shown that nasal epithelium from healthy adults experimentally infected with RSV has increased abundance of RANTES (but not IL-8) mRNA (7). In the present study, we found that nasal epithelial cells from infants with RSV bronchiolitis had, on average, higher RANTES/IL-8 mRNA ratios than RSV-positive infants without bronchiolitis (Fig. 5). This result, while not statistically significant in the relatively low numbers of biopsies available, was similar to the result found in NLF, suggesting that the epithelium may in part drive differences in chemokine balance. The quantity of RSV-induced cytokine production in vitro appears to be inoculum-dependent (16), and in some epithelial model systems RSV induces RANTES more potently than it induces IL-8 (17). Thus, one explanation for the observed relative increase in RANTES may be a larger inoculum of RSV at the start of infection. Interindividual differences in airway chemokine balance could also be due to differences in susceptibility to the chemokine-inducing effects of RSV at the epithelial level, the immune response level, or both. Hull et al. (25) recently reported that a polymorphism identified 251 bp upstream of the IL-8 transcription start site was significantly associated with increased whole-blood IL-8 production in response to LPS, as well as increased clinical severity of RSV bronchiolitis. The relationship between IL-8 and other chemokines was not determined in that study, but it suggests that a genetic susceptibility linked to chemokine expression can influence the clinical course of RSV infection. It is unclear whether inflammatory events in the nasal passages during RSV infection are completely recapitulated in the lower airways. However, it is known that in asthmatic adults, experimental nasal inoculation of rhinovirus leads to increased bronchial hyperreactivity and nasal neutrophils and cytokines and that similar inflammatory changes are found in the lower airways 4 days later (14, 15). These changes could be due to either progression of the infection itself to distal airways sites or perhaps to immune responses initiated in the upper airways. In either case, available

94

NOAH ET AL.

data in older subjects suggest that virus-triggered inflammatory changes in the nasal passages are linked to subsequent changes in lower airways function or reactivity. Garofalo et al. (22) recently reported a highly significant correlation between the upper and lower respiratory secretion levels of several cytokines, including RANTES, in infants intubated for severe RSV infection. Nasal lavage and biopsy are safe and appropriate for the study of large numbers of nonintubated infants, who represent the population of greatest interest in RSV infection. The interpretation of airway lavage data is limited by its inability to characterize submucosal events, which may be important in regulating airways function, and by the inherent difficulties in estimating dilution of secretions by lavage fluids. In this study, we focused on the ratio of RANTES to IL-8 within NLF and its association with clinical manifestations of bronchiolitis among infants with RSV infection. This approach has the theoretical advantage of circumventing the difficulty of estimating dilution of nasal secretions by lavage fluid, for which there is currently no proven reliable method (26, 27). Expression of mediator concentrations as a ratio to total protein in NLF has often been used in previous studies, but has the potential disadvantage that protein concentrations in nasal secretions may themselves be increased in the presence of infection due to exudation across a damaged epithelium (28). Inflammatory cells are likely to respond not to proportions of chemotactic mediators, but rather to absolute concentrations (which are difficult to determine using lavage methods). Additionally, the ratio of two specific mediators in respiratory fluids presumably results not solely from changes in production by a single cell type, but instead from a complex equilibrium of degradation and production rates by multiple cell types. However, calculation of ratios of mediators of interest in lavage fluids, and comparisons between clinically distinct populations, may represent a useful technique for formulating mechanistic hypotheses of inflammatory and immune mechanisms of airways disease. Significant differences in proportions of chemokines after a stimulus might represent a marker for variability in overall chemokine responsiveness among a population. Such variability might be genetically inherent as suggested by previous studies (25), environmentally influenced, or both. ACKNOWLEDGMENTS We acknowledge the assistance of the staff of the Frank Porter Graham Research Day Care Program in Chapel Hill, North Carolina; and Dr. Frederick Mabry of the Purcell Clinic in Laurinburg, North Carolina. This study was supported by the NIH (P50 HL56395) and by the University of North Carolina Center for Environmental Medicine and Lung Biology (Philip A. Bromberg, MD, Director; U.S.

Environmental Protection Agency Cooperative Agreement CR 817643). REFERENCES 1. Wohl, M. E. B., Bronchiolitis. In “Disorders of the Respiratory Tract in Children,” (V. Chernick, T. F. Boat, E. L. Kendig, Eds.), 6th ed., pp. 473– 485, W.B. Saunders Co., Philadelphia, 1998. 2. Black-Payne, C., Bronchiolitis. In “Pediatric Respiratory Disease” (B. Hilman, Ed.), pp. 205–215, W.B. Saunders Co., Philadelphia, 1993. 3. Denny, F., and Clyde, W., Acute lower respiratory infections in non-hospitalized children. J. Pediatr. 108, 635– 646, 1986. 4. Busse, W. W., The role of respiratory infections in airway hyperresponsiveness and asthma. Am. J. Resp. Crit. Care Med. 150, S77–S79, 1994. 5. Kim, H. W., Canchola, J. G., Brandt, C. D., Pyles, G., Chanock, R. M., Jensen, K. E., and Parrott, R. H., Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am. J. Epidemiol. 80, 422, 1969. 6. Gardner, P. S., McQuillin, J., and Court, S. D. M., Speculation on pathogenesis in death from respiratory syncytial virus infection. Br. Med. J. 1, 327–330, 1970. 7. Noah, T. L., and Becker, S., Chemokines in nasal secretions of normal adults experimentally infected with respiratory syncytial virus. Clin. Immunol. 2000. 8. Noah, T. L., Henderson, F. W., Wortman, I. A., Devlin, R. B., Handy, J. H., Koren, H. S., and Becker, S., Nasal cytokine production in viral acute upper respiratory infection of childhood. J. Infect. Dis. 171, 584 –592, 1995. 9. Abu-Harb, M., Bell, F., Finn, A., Rao, W. H., Nixon, L., Shale, D., and Everard, M. L., IL-8 and neutrophil elastase levels in the respiratory tract of infants with RSV bronchiolitis. Eur. Resp. J. 14, 139 –143, 1999. 10. Sheeran, P., Jafri, H., Carubelli, C., Saavedra, J., Johnson, C., Krisher, K., Sanchez, P. J., and Ramilo, O., Elevated cytokine concentrations in the nasopharyngeal and tracheal secretions of children with respiratory syncytial virus disease. Ped. Infect. Dis. J. 18, 115–122, 1999. 11. Bont, L., Heijnen, C. J., Kavelaars, A., van Aaldern, W. M., Brus, F., Draaisma, J. M., Pekelharing-Berghuis, M., van DiemenSteenvoorde, R. A., and Kimpen, J. L., Local interferon-gamma levels during respiratory syncytial virus lower respiratory tract infection are associated with disease severity. J. Infect. Dis. 184, 355–358, 2001. 12. Graziano, F. M., Cook, E. B., and Stahl, J. L., Cytokines, chemokines, RANTES, and eotaxin. Allergy Asthma Proc. 20, 141–146, 1999. 13. Baggiolini, M., and Loetscher, P., Chemokines in inflammation and immunity. Immunol. Today 21, 418 – 420, 2000. 14. Grunberg, K., Timmers, M. C., Smits, H. H., de Klerk, E. P., Dick, E. C., Spaan, W. J., Hiemstra, P. S., and Sterk, P. J., Effect of experimental rhinovirus 16 colds on airway hyperresponsiveness to histamine and interlukin-8 in nasal lavage in asthmatic subjects in vivo. Clin. Exp. Allergy 27, 36 – 45, 1997. 15. Jarjour, N. N., Gern, J. E., Kelly, E. A., Swenson, C. A., Dick, C. R., and Busse, W. W., The effect of experimental rhinovirus 16 infection on bronchial lavage neutrophils. J. Allergy Clin. Immunol. 105, 1169 –1177, 2000. 16. Noah, T. L., and Becker, S., Respiratory syncytial virus-induced cytokine production by a human bronchial epithelial cell line. Am. J. Physiol. Lung Cell Mol. Physiol. 265(9), L472–L478, 1993. 17. Becker, S., Reed, W., Henderson, F. W., and Noah, T. L., RSV infection of human airway epithelial cells causes production of

NASAL CHEMOKINES IN RSV BRONCHIOLITIS

18.

19.

20.

21.

22.

the ␤-chemokine RANTES. Am. J. Physiol. 272, L512–L520, 1997. Fiedler, M., Wernke-Dollries, K., and Stark, J., Respiratory syncytial virus increases IL-8 gene expression and protein release in A549 cells. Am. J. Physiol. 269, L865–L872, 1995. Mastronarde, J., Monick, M., and Hunninghake, G., Oxidant tone regulates IL-8 production in epithelium infected with respiratory syncytial virus. Am. J. Resp. Cell Mol. Biol. 13, 237–344, 1995. Matsushima, K., Morishita, K., Yoshimura, T., Lavu, S., Kobayashi, Y., Lew, W., Appella, E., Kung, H. F., Leonard, E. J., and Oppenheim, J. J., Molecular cloning of a human monocyte derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin 1 and tumor necrosis factor. J. Exp. Med. 167, 1883–1893, 1988. Schall, T. J., Jongstra, J., Dyer, B. J., Jorgnsen, D. J., Clayberger, C., Davis, M. M., and Krensky, A. M., A human T cellspecific molecule is a member of a new gene family. J. Immunol. 141, 1018 –1025, 1988. Garofalo, R. P., Patti, J., Hintz, K. A., Hill, V., Ogra, P. L., and Welliver, R. C., Macrophage inflammatory protein-1␣ (not T helper type 2 cytokines) is associated with severe forms of respiratory syncytial virus bronchiolitis. J. Infect. Dis. 184, 393–399, 2001.

Received January 14, 2002; accepted with revision May 16, 2002

95

23. Aherne, W., Bird, T., Court, S. D. M., Gardner, P. S., and McQuillin, J., Pathological changes in virus infections of the lower respiratory tract in children. J. Clin. Pathol. 23, 7–18, 1970. 24. Everard, M. L., Swarbrick, A., Wrightman, M., McIntyre, J., Dunkley, C., James, P. D., Sewell, H. F., and Milner, A. D., Analysis of cells obtained by bronchial lavage of infants with respiratory syncytial virus. Arch. Dis. Child. 71, 428 – 432, 1994. 25. Hull, J., Thomson, A., and Kwiatkowksi, D., Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax 55, 1023–1027, 2000. 26. Ward, C., Diddridge, M., Fenwick, J., Williams, S., Gardiner, P. V., Hendrick, D. J., and Walters, E. H. The origin of water and urea sampled at bronchoalveolar lavage in asthmatic and control subjects. Am. Rev. Resp. Dis. 146, 444 – 447, 1992. 27. Marcy, T. W., Merrill, W. W., Rankin, J. A., and Reynolds, H. Y., Limitations of using urea to quantify epithelial lining fluid recovered by bronchoalveolar lavage. Am. Rev. Resp. Dis. 135, 1276 –1280, 1987. 28. Raphael, G. D., Igarashi, Y., White, M. V., and Kaliner, M. A., The pathophysiology of rhinitis. V. Sources of protein in allergen-induced nasal secretions. J. Allergy Clin. Immunol. 88, 33– 42, 1991.